FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1991877881> ?p ?o ?g. }

• W1991877881 endingPage "23588" @default.
• W1991877881 startingPage "23581" @default.
• W1991877881 abstract "Here, we report that Sau3AI, an unusually large type II restriction enzyme with sequence homology to the mismatch repair protein MutH, is a monomeric enzyme as shown by gel filtration and ultracentrifugation. Structural similarities in the N- and C-terminal halves of the protein suggest that Sau3AI is a pseudo-dimer, i.e. a polypeptide with two similar domains. Since Sau3AI displays a nonlinear dependence of cleavage activity on enzyme concentration and a strong preference for substrates with two recognition sites over those with only one, it is likely that the functionally active form of Sau3AI is a dimer of a pseudo-dimer. Indeed, electron microscopy studies demonstrate that two distant recognition sites are brought together through DNA looping induced by the simultaneous binding of twoSau3AI molecules to the DNA. We suggest that the dimeric form of Sau3AI supplies two DNA-binding sites, one that is associated with the catalytic center and one that serves as an effector site. Here, we report that Sau3AI, an unusually large type II restriction enzyme with sequence homology to the mismatch repair protein MutH, is a monomeric enzyme as shown by gel filtration and ultracentrifugation. Structural similarities in the N- and C-terminal halves of the protein suggest that Sau3AI is a pseudo-dimer, i.e. a polypeptide with two similar domains. Since Sau3AI displays a nonlinear dependence of cleavage activity on enzyme concentration and a strong preference for substrates with two recognition sites over those with only one, it is likely that the functionally active form of Sau3AI is a dimer of a pseudo-dimer. Indeed, electron microscopy studies demonstrate that two distant recognition sites are brought together through DNA looping induced by the simultaneous binding of twoSau3AI molecules to the DNA. We suggest that the dimeric form of Sau3AI supplies two DNA-binding sites, one that is associated with the catalytic center and one that serves as an effector site. polymerase chain reaction base pair(s) Orthodox type II restriction endonucleases are homodimeric enzymes that cleave their substrates within or directly adjacent to their recognition sequence (for reviews, see Refs. 1Roberts R.J. Halford S.E. Linn S.M. Lloyd R.S. Roberts R.J. Nucleases. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1993: 35-88Google Scholar and2Pingoud A. Jeltsch A. Eur. J. Biochem. 1997; 246: 1-22Crossref PubMed Scopus (301) Google Scholar). It became increasingly apparent over the last years that several variations to this theme exist, namely in the form of the monomeric type IIs restriction endonucleases that dimerize on the DNA substrate via their catalytic domains, e.g. FokI (3Bitinaite J. Wah D.A. Aggarwal A.K. Schildkraut I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10570-10575Crossref PubMed Scopus (390) Google Scholar, 4Wah D.A. Bitinaite J. Schildkraut I. Aggarwal A.K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10564-10569Crossref PubMed Scopus (177) Google Scholar); the dimeric type IIe enzymes, e.g. EcoRII andNaeI, which require binding to a second recognition site for cleavage (5Krüger D.H. Barcak G.J. Reuter M. Smith H.O. Nucleic Acids Res. 1988; 16: 3997-4008Crossref PubMed Scopus (116) Google Scholar, 6Conrad M. Topal M.D. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9707-9711Crossref PubMed Scopus (64) Google Scholar); dimeric restriction endonucleases likeSgrAI, which also require two recognition sites for activity and tetramerize on the DNA (7Bilcock D.T. Daniels L.E. Bath A.J. Halford S.E. J. Biol. Chem. 1999; 274: 36379-36386Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar); and tetrameric type IIf restriction endonucleases like SfiI, Cfr10I, andNgoMIV (8Wentzell L.M. Halford S.E. J. Mol. Biol. 1998; 281: 433-444Crossref PubMed Scopus (58) Google Scholar, 9Siksnys V. Skirgaila R. Sasnauskas G. Urbanke C. Cherny D. Grazulis S. Huber R. J. Mol. Biol. 1999; 291: 1105-1118Crossref PubMed Scopus (78) Google Scholar, 10Deibert M. Grazulis S. Sasnauskas G. Siksnys V. Huber R. Nat. Struct. Biol. 2000; 7: 792-799Crossref PubMed Scopus (147) Google Scholar), which interact with two recognition sites, loop out the DNA, and cleave the two sites in a concerted manner. Structural information is available for FokI (4Wah D.A. Bitinaite J. Schildkraut I. Aggarwal A.K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10564-10569Crossref PubMed Scopus (177) Google Scholar, 11Wah D.A. Hirsch J.A. Dorner L.F. Schildkraut I. Aggarwal A.K. Nature. 1997; 388: 97-100Crossref PubMed Scopus (214) Google Scholar),NaeI (12Huai Q. Colandene J.D. Chen Y. Luo F. Zhao Y. Topal M.D. Ke H. EMBO J. 2000; 19: 3110-3118Crossref PubMed Google Scholar), Cfr10I (9Siksnys V. Skirgaila R. Sasnauskas G. Urbanke C. Cherny D. Grazulis S. Huber R. J. Mol. Biol. 1999; 291: 1105-1118Crossref PubMed Scopus (78) Google Scholar), and NgoMIV (10Deibert M. Grazulis S. Sasnauskas G. Siksnys V. Huber R. Nat. Struct. Biol. 2000; 7: 792-799Crossref PubMed Scopus (147) Google Scholar), in addition to structural information on the orthodox homodimeric type II restriction endonucleases BamHI, BglI,BglII, BsoBI, EcoRI, EcoRV,MunI, and PvuII (for review, see Ref. 13Pingoud, A., and Jeltsch, A. (2001) Nucleic Acids Res., in press.Google Scholar). The typical restriction endonuclease fold is also found in endonucleases involved in DNA repair (MutH (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar) and Vsr endonuclease (15Tsutakawa S.E. Jingami H. Morikawa K. Cell. 1999; 99: 615-623Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar)), recombination (T7 endonuclease I (16Hadden J.M. Convery M.A. Declais A.C. Lilley D.M. Phillips S.E. Nat. Struct. Biol. 2001; 8: 62-67Crossref PubMed Scopus (82) Google Scholar) and λ-exonuclease (17Kovall R. Matthews B.W. Science. 1997; 277: 1824-1827Crossref PubMed Scopus (186) Google Scholar)), and transposition (TnsA (18Hickman A.B. Li Y. Mathew S.V. May E.W. Craig N.L. Dyda F. Mol. Cell. 2000; 5: 1025-1034Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar)). It was interesting to note that the type II restriction endonucleaseSau3AI shares sequence homology with the DNA mismatch repair endonuclease MutH (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar). Both Sau3AI and MutH recognize the same DNA sequence (GATC); but whereas MutH nicks the unmethylated strand of a hemimethylated or unmethylated GATC site, Sau3AI cleaves both strands of GATC sites regardless of the methylation status (19Kessler C. Manta V. Gene ( Amst. ). 1990; 92: 1-248Crossref PubMed Scopus (118) Google Scholar). MutH is a monomer, both in solution and in the crystal, which makes sense because it only nicks the DNA (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar, 20Welsh K.M. Lu A.L. Clark S. Modrich P. J. Biol. Chem. 1987; 262: 15624-15629Abstract Full Text PDF PubMed Google Scholar). In vivo, it shows only catalytic activity after mismatch-dependent activation by MutS and MutL (21Modrich P. Annu. Rev. Genet. 1991; 25: 229-253Crossref PubMed Scopus (774) Google Scholar), whereas in vitro, the requirement for MutS and MutL is less pronounced (22Ban C. Junop M. Yang W. Cell. 1999; 97: 85-97Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar, 23Hall M.C. Matson S.W. J. Biol. Chem. 1999; 274: 1306-1312Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). In contrast to MutH, however, Sau3AI is an active enzyme by itself. The quaternary structure of Sau3AI is not known, but it is likely that it is a functional dimer, as most type II restriction endonucleases that have to catalyze a double-strand cut.Sau3AI is an unusually large restriction endonuclease. It possesses an additional 270 residues C-terminal to the presumptive catalytic N-terminal domain which is homologous in sequence to MutH (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar), resulting in its being twice the size of MutH. Therefore, the question arises concerning the function of this additional C-terminal domain. It has been speculated (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar) that the role of these residues inSau3AI may be the functional equivalent to that of MutL and MutS in the case of MutH, such that Sau3AI is permanently activated. Since there is only a small amount of information regarding the biochemistry of Sau3AI, we therefore started to investigate some of the properties of Sau3AI, namely its quaternary structure and its mode of DNA cleavage. Here, we provide evidence thatSau3AI defines a new subtype of type II restriction endonucleases, being a monomer in solution that, to become active, has to dimerize in the presence of DNA, probably by binding to two recognition sites, which is accompanied by DNA looping. We conclude this from the following findings. First, we show thatSau3AI, unlike most other type II restriction endonucleases, is a monomer in solution. Second, the rate of DNA cleavage bySau3AI is not linearly proportional to the protein concentration, suggesting a requirement for cooperative binding ofSau3AI to DNA to afford cleavage. Third, substrates containing more than one GATC site are cleaved by an order of magnitude more quickly than substrates with a single GATC site, suggesting either that a monomer of Sau3AI is interacting with two GATC sites or, more likely, that Sau3AI dimerizes on the DNA, in response to binding to two GATC sites, a conclusion that is substantiated by electron microscopy, which shows thatSau3AI induces loops on DNA with two GATC sites. Oligodeoxynucleotides were obtained from MWG Biotech AG (Ebersberg, Germany).Taq DNA polymerase was purchased from Promega (Mannheim, Germany). Sau3AI was obtained from Roche Molecular Biochemicals (Mannheim). Protein purity was checked by SDS-polyacrylamide gel electrophoresis and was >95%.Sau3AI concentration was determined by UV spectroscopy using the theoretical extinction coefficient at 280 nm of 85,600m−1 cm−1based on the amino acid sequence of Sau3AI (24Pace C.N. Vajdos F. Fee L. Grimsley G. Gray T. Protein Sci. 1995; 4: 2411-2423Crossref PubMed Scopus (3452) Google Scholar). Protein sequences were obtained from the NCBI Entrez server. In a search for structural homologs of the C-terminal domains of Sau3AI,LlaKR2I, and Sth368I, we used fold recognition methods based on sequence-derived predictions. For this purpose, we employed the metaserver Pcons (25Bujnicki J.M. Elofsson A. Fischer D. Rychlewski L. Protein Sci. 2001; 10: 352-361Crossref PubMed Scopus (110) Google Scholar), which uses severalfold recognition programs, namely the Fold and Function Assignment System FFAS (26Rychlewski L. Jaroszewski L. Li W. Godzik A. Protein Sci. 2000; 9: 232-241Crossref PubMed Scopus (452) Google Scholar), the 3D-PSSM server (27Kelley L.A. MacCallum R.M. Sternberg M.J. J. Mol. Biol. 2000; 299: 499-520Crossref PubMed Scopus (1121) Google Scholar), GenTHREADER (28Jones D.T. J. Mol. Biol. 1999; 287: 797-815Crossref PubMed Scopus (785) Google Scholar), FUGUE, INBGU (29Fischer D Pac. Symp. Biocomput. 2000; : 119-130PubMed Google Scholar), Sam-T99 (30Karplus K. Barrett C. Cline M. Diekhans M. Grate L. Hughey R. Proteins Struct. Funct. Genet. 1999; 3 (suppl.): 121-125Crossref Google Scholar), and Protein Data Bank BLAST, in addition to the secondary structure prediction servers PSIpred (31McGuffin L.J. Bryson K. Jones D.T. Bioinformatics. 2000; 16: 404-405Crossref PubMed Scopus (2741) Google Scholar) and Jpred2 (32Cuff J.A. Barton G.J. Proteins Struct. Funct. Genet. 2000; 40: 502-511Crossref PubMed Scopus (660) Google Scholar). Protein sequence alignments of the N-terminal domains of Sau3AI, LlaKR2I, andSth368I with MutH protein sequences and alignment of the C-terminal domains of Sau3AI, LlaKR2I, andSth368I were performed using the ClustalW program (33Lloyd A. embnet.news. 1997; 4: 2Google Scholar, 34Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55767) Google Scholar). The alignment of the C-terminal domain of LlaKR2I withEscherichia coli MutH is based on the results of the fold prediction server Pcons. The alignments were combined and analyzed further using the program GeneDoc (35Nicholas K.B. Nicholas H.B.J. Deerfield D.W.I. embnet.news. 1997; 4: 14Google Scholar). Sau3AI (100 μl, 400 nm) was analyzed on a 4.4-ml linear sucrose density gradient from 8 to 38% (w/w) sucrose in 20 mmHEPES-KOH, pH 8.0, 50 mm KCl, and 0.1 mm EDTA at 4 °C in an SW 60Ti rotor using a Beckman L-60 ultracentrifuge at 55,000 rpm for 16 h. Samples of 200 μl were fractionated from the bottom of the tube using an Amersham Pharmacia Biotech P1 pump and analyzed for restriction endonuclease activity using pUC8 as a substrate (see below). The following marker proteins were used: β-amylase (Mr = 200,000,s20,w = 8.9 S), alcohol dehydrogenase (Mr = 155,000,s20,w = 7.9), bovine serum albumin (Mr = 66,000,s20,w = 4.3 S), ovalbumin (Mr = 42,000,s20,w = 3.5), carbonic anhydrase (Mr = 29,000,s20,w = 2.8), and cytochromec (Mr = 12,000,s20,w = 2.1). Gel filtration was performed withSau3AI (100 μl, 400 nm) on a Superdex 200TM column (Amersham Pharmacia Biotech) equilibrated with 10 mm Tris-HCl, pH 7.5, 10 mm CaCl2150 mm NaCl, and 5% (v/v) glycerol at 22 °C with a flow rate of 1 ml/min using a Merck-Hitachi Model 6200A high pressure liquid chromatography apparatus with a Model 655 photometer (set at 280 nm) and a Model D-2500 Chromato-Integrator. The same standard proteins were used as described for sucrose density gradient centrifugation. The concentration of pUC8 plasmid DNA isolated from the dam-negative strain JM110 was determined spectrophotometrically at 260 nm with an extinction coefficient of 3.6 × 107m−1 cm−1. Cleavage reactions were performed at 37 °C with 20 ng/μl pUC8 (11 nm) in 33 mm Tris-HCl, pH 7.9, 10 mm magnesium acetate, 66 mm potassium acetate, 0.5 mm dithiothreitol, 0.05 mg/ml bovine serum albumin, andSau3AI at the concentrations indicated. Cleavage reactions were stopped by removing 10-μl aliquots from the reaction mixture and adding 0.2 volume of gel loading buffer (250 mm EDTA, pH 8.0, 25% (w/v) sucrose, 0.1% (w/v) bromphenol blue, and 0.1% (w/v) xylene cyanol). The reaction products were analyzed by 1.2% agarose gel electrophoresis. The ethidium bromide-stained gels were analyzed with a video documentation system (INTAS, Göttingen, Germany). The intensities of the DNA bands were quantified using the program TINA (Version 2.07d). Initial rates were calculated from the disappearance of the supercoiled form of the plasmid and the appearance of the linear form of the plasmid, respectively. Substrates containing either one or two Sau3AI recognition sequences were produced by PCR using Taq DNA polymerase. Either plasmid pET15b-XhoI (a variant of pET15b in which three GATC sites at positions 491, 497, and 501 were mutated and a newXhoI site at position 491 was introduced) or pHisPI-SceI-N (36Wende W. Grindl W. Christ F. Pingoud A. Pingoud V. Nucleic Acids Res. 1996; 24: 4123-4132Crossref PubMed Scopus (49) Google Scholar) was used as a template to obtain PCR products of varying length and site distance using the primers indicated in Table I. PCR purification was performed with the PCR purification kit from QIAGEN Inc. (Hilden, Germany). Each substrate (548 and 529 bp in length, respectively) at a concentration of 20 nm was incubated for 10 min at 37 °C with the indicated concentrations ofSau3AI in the same buffer as used in the plasmid DNA cleavage assay. At defined time intervals, samples were removed from the reaction mixture. The reaction was stopped by addition of 0.2 volume of gel loading buffer, and the reaction products were analyzed on 6% polyacrylamide gels. After staining with ethidium bromide, the gels were analyzed as described above for the plasmid DNA cleavage assay.Table ILength of PCR substrates and position of Sau3AI recognition sequenceTemplatePrimer A1-aGEX-her-lang, ATAAACAAATAGGGGTTCCGCGCAC; A783, ATCTCGACGCTCTCCCTTATGCG; B236, TAGAGGCCCCAAGGGGTTAT; PRIM1, AACGCAGTCAGGCACCGTGT; HomeB, ATGGATTGGTGATGGATTGTCTGACA; HomeG, CGCGCGAGGCAGCTCTAGAGCGGC.Primer B1-aGEX-her-lang, ATAAACAAATAGGGGTTCCGCGCAC; A783, ATCTCGACGCTCTCCCTTATGCG; B236, TAGAGGCCCCAAGGGGTTAT; PRIM1, AACGCAGTCAGGCACCGTGT; HomeB, ATGGATTGGTGATGGATTGTCTGACA; HomeG, CGCGCGAGGCAGCTCTAGAGCGGC.LengthNo. of GATC sitesPosition of GATC site(s)Distance between sitesbppET15b-XhoIGEX-her-langA7839082447719272pET15b-XhoIB236A783548287359272pET15b-XhoIPRIM1A3025291257pHisPI-SceI-NHomeBHomeG120413021-a GEX-her-lang, ATAAACAAATAGGGGTTCCGCGCAC; A783, ATCTCGACGCTCTCCCTTATGCG; B236, TAGAGGCCCCAAGGGGTTAT; PRIM1, AACGCAGTCAGGCACCGTGT; HomeB, ATGGATTGGTGATGGATTGTCTGACA; HomeG, CGCGCGAGGCAGCTCTAGAGCGGC. Open table in a new tab DNA fragments of 1204 or 906 bp in length containing one or two Sau3AI recognition sequences, respectively, were produced by PCR (TableI). The DNA fragments were purified by gel extraction using NucleoSpin® Extract 2-in-1 (Macherey Nagel, Düren, Germany). DNA and protein were incubated at 37 °C for 10 min in a 10-μl reaction volume containing 5 nm DNA and various concentrations of Sau3AI ranging from 0 to 100 nm (molar ratios of enzyme to DNA between 1:1 and 20:1) in 10 mm in Tris-HCl, pH 8.0, 50 mm NaCl, 1 mm EDTA, 1 mmdithiothreitol, and 2 mm CaCl2. Complexes were fixed with 0.2% (v/v) glutaraldehyde for 10 min at 37 °C and, after 3-fold dilution in 10 mm triethanolamine chloride, pH 7.5, and 10 mm MgCl2, adsorbed to freshly cleaved mica as described (37Spiess E. Lurz R. Methods Microbiol. 1988; 20: 293-323Crossref Scopus (64) Google Scholar). Micrographs were taken using a Philips CM100 electron microscope at 100 kV and a BioCam CCD camera (Tietz Video and Image Processing Systems GmbH, Gauting, Germany). To determine contour length, measurements were carried out on projections of 35-mm negatives using a digitizer (LM4, Brühl, Nuremberg, Germany). Histograms were generated as described (38Weigel C. Schmidt A. Ruckert B. Lurz R. Messer W. EMBO J. 1997; 16: 6574-6583Crossref PubMed Scopus (91) Google Scholar). An analysis of the molecular weight and quaternary structure of type II restriction endonucleases revealed that Sau3AI has an unusual high molecular weight for a typical type II restriction endonuclease. Based on its amino acid sequence, theMr of 56,468 for Sau3AI is well above the average molecular weight of an orthodox dimeric type II restriction enzyme (excluding type IIs restriction endonucleases), which is ∼31,000 ± 8000 (mean ± S.D.). Of 152 restriction endonucleases (Rebase 01/25/2001) classified as type II, 143 haveMr values below 45,000. Type IIs restriction endonucleases, a subclass of type II enzymes, haveMr values ranging from 34,000 to 116,000, with a median of 52,000. For one type IIs restriction endonuclease,FokI (Mr = 66,215), it has been shown that it is monomeric in solution, but has to dimerize on the DNA to form an active endonuclease (3Bitinaite J. Wah D.A. Aggarwal A.K. Schildkraut I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10570-10575Crossref PubMed Scopus (390) Google Scholar). Other larger than average type II restriction endonucleases are type IIe enzymes, e.g. EcoRII, which is a homodimer (Mr = 2 × 45,608) in solution and has two binding sites for DNA, one of which is only catalytically competent (39Reuter M. Kupper D. Meisel A. Schroeder C. Krueger D.H. J. Biol. Chem. 1998; 273: 8294-8300Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 40Kupper D. Reuter M. Krueger D.H. Gene ( Amst. ). 1995; 157: 97-98Crossref PubMed Scopus (2) Google Scholar, 41Petrauskiene O.V. Karpova E.A. Gromova E.S. Guschlbauer W. Biochem. Biophys. Res. Commun. 1994; 198: 885-890Crossref PubMed Scopus (26) Google Scholar, 42Gabbara S. Bhagwat A.S. J. Biol. Chem. 1992; 267: 18623-18630Abstract Full Text PDF PubMed Google Scholar). Some other type II restriction endonucleases with an unusually high molecular weight have been shown to be monomeric (at least in the absence of substrate),e.g. CcrI with an Mr of 65,300 (43Syddall R. Stachow C. Biochim. Biophys. Acta. 1985; 825: 236-243Crossref Scopus (10) Google Scholar) and BsuRI with an Mr of 66,300 (44Bron S. Horz W. Methods Enzymol. 1980; 65: 112-132Crossref PubMed Scopus (16) Google Scholar), for which only little biochemical information is available. To examine the quaternary structure of Sau3AI, we subjected Sau3AI to both gel filtration and sucrose density gradient centrifugation analyses. Both methods can be used to determine the native molecular weight of a protein. As shown in Fig. 1,Sau3AI sedimented between bovine serum albumin (Mr = 66,000) and ovalbumin (Mr = 42,000). On a Superdex 200 gel filtration column, Sau3AI again eluted between bovine serum albumin and ovalbumin. Our results therefore suggest that, in the absence of DNA,Sau3AI, whose predicted Mr is 56,468, is as a monomer in solution. This raises the question of how a monomeric enzyme can catalyze a concerted double-strand cut, whichSau3AI does (Fig. 2). Two possibilities must be considered. 1) Sau3AI has two active sites/monomer, or 2) Sau3AI dimerizes in the presence of DNA.Figure 2Time course of supercoiled plasmid DNA cleavage by Sau3AI. pUC8 DNA (11 nm) was incubated with 0.9 nm Sau3AI. Aliquots were withdrawn at the times indicated, and the reaction products were analyzed by agarose gel electrophoresis. The supercoiled (sc) substrate was cleaved to give the linear (li) DNA without the accumulation of the open circle (oc) form.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The N-terminal domain of Sau3AI has been reported to share sequence homology with MutH (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar). Since the catalytically important residues of MutH are conserved in the N-terminal domain ofSau3AI (Fig. 3), it is likely that this domain of Sau3AI is responsible for DNA cleavage. The function of the C-terminal domain of Sau3AI is not known. In a search for a function of the C-terminal domain comprising ∼270 amino acid residues, we looked for sequence homologs. The only other sequence homologs of the C-terminal domain of Sau3AI found are the C-terminal domains of LlaKR2I andSth368I, putative type II restriction endonucleases that have sequence homology to both the N- and C-terminal domains ofSau3AI (Table II). PSI-BLAST searches (45Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59933) Google Scholar) with the C-terminal domain ofSau3AI, LlaKR2I, or Sth368I failed to identify significant sequence similarity to any other protein in the data base. Therefore, we searched for structural homologs of the C-terminal domains of Sau3AI, LlaKR2I, andSth368I using the metaserver Pcons, which employs severalfold recognition programs (see “Experimental Procedures”). Remarkably, the top hit for all three C-terminal domains was MutH (Table III). The pattern of secondary structures predicted for the C-terminal domains of Sau3AI,LlaKR2I, and Sth368I agreed with the experimentally determined structure of MutH (data not shown), further supporting the threading results. Moreover, inspection of the sequence alignment using the N- and C-terminal domains of Sau3AI,LlaKR2I, and Sth368I and all available MutH protein sequences revealed that almost all of the conserved residues are located in the structural core and/or around the active site of the crystal structure of MutH (14Ban C. Yang W. EMBO J. 1998; 17: 1526-1534Crossref PubMed Scopus (177) Google Scholar). This led us to the conclusion thatSau3AI can be considered to be a pseudo-dimer,i.e. a polypeptide with two structurally similar domains. However, since only some of the catalytically important active-site residues (which are all present in the presumptive active site of the N-terminal domain) can be found in the C-terminal domain ofSau3AI (or LlaKR2I and Sth368I), it is unlikely that the C-terminal domain contains a functional active site.Table IIIdentities and similarities in the sequence alignment of E. coli MutH, Sau3AI, LlaKR2I, and Sth368ILength (amino acid residues)Sau3AILlaKR2ISth368IN-terminal halfC-terminal halfN-terminal halfC-terminal halfN-terminal halfC-terminal half%%%MutH229202-aPercentage of residues whose juxtaposition yields a >0 score in the Blosum 35 scoring table (upper line, identity; lower line, similarity).716141612392-aPercentage of residues whose juxtaposition yields a >0 score in the Blosum 35 scoring table (upper line, identity; lower line, similarity).2633343532Sau3AIN-terminal half2189341117112950284131C-terminal half271820111326422834LlaKR2IN-terminal half25081811303929C-terminal half2469143135Sth368IN-terminal half2321135C-terminal half2592-a Percentage of residues whose juxtaposition yields a >0 score in the Blosum 35 scoring table (upper line, identity; lower line, similarity). Open table in a new tab Table IIIResults of fold recognition analysisMethod3-aAs described under “Experimental Procedures.”Query3-bQuery protein sequence with first and last amino acid residues.First rank3-cProtein Data Bank codes are as follows: 1A4P, calcium/phospholipid-binding protein; 1AZO/2AZO, MutH;1QR0, 4′-phosphopantetheinyltransferase Sfp; 3BTA, botulinum neurotoxin serotype A.Score3-dAt a Pcons score of 3, 87% of all models are supposed to be correct. At a Pcons score of 5, 98% of all models are supposed to be correct.Second rank3-cProtein Data Bank codes are as follows: 1A4P, calcium/phospholipid-binding protein; 1AZO/2AZO, MutH;1QR0, 4′-phosphopantetheinyltransferase Sfp; 3BTA, botulinum neurotoxin serotype A.Score3-dAt a Pcons score of 3, 87% of all models are supposed to be correct. At a Pcons score of 5, 98% of all models are supposed to be correct.PconsSau3AI-(216–489)2AZO3.73BTA1.96LlaKR21-(251–496)1AZO5.251QR01.78Sth368I-(231–491)1AZO3.721A4P1.923-a As described under “Experimental Procedures.”3-b Query protein sequence with first and last amino acid residues.3-c Protein Data Bank codes are as follows: 1A4P, calcium/phospholipid-binding protein; 1AZO/2AZO, MutH;1QR0, 4′-phosphopantetheinyltransferase Sfp; 3BTA, botulinum neurotoxin serotype A.3-d At a Pcons score of 3, 87% of all models are supposed to be correct. At a Pcons score of 5, 98% of all models are supposed to be correct. Open table in a new tab There are only few examples of monomeric endonucleases that are capable of making a specific double-strand cut in one binding event, e.g.PI-SceI, which harbors two catalytic centers (46Christ F. Schoettler S. Wende W. Steuer S. Pingoud A. Pingoud V. EMBO J. 1999; 18: 6908-6916Crossref PubMed Scopus (41) Google Scholar). On the other hand, there are now examples of type IIs (e.g. FokI) and IIf (e.g. SgrAI) restriction endonucleases known, which are monomeric (dimeric) in the absence of DNA, but dimerize (tetramerize) in the presence of DNA to achieve catalytic activity (3Bitinaite J. Wah D.A. Aggarwal A.K. Schildkraut I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10570-10575Crossref PubMed Scopus (390) Google Scholar, 47Bilcock D.T. Halford S.E. Mol. Microbiol. 1999; 31: 1243-1254Crossref PubMed Scopus (24) Google Scholar). In these cases, a nonlinear dependence of catalytic activity on protein concentration has been reported. Therefore, the rate of DNA cleavage catalyzed by Sau3AI at various concentrations was determined to establish the relationship between the initial velocity of the reaction and the enzyme concentration. Supercoiled pUC8 plasmid DNA containing 15Sau3AI recognition sites was used as a substrate.Sau3AI restriction endonuclease was added to the reaction mixture, and the extent of cleavage was measured by withdrawing aliquots at defined time intervals and analyzing the amount of supercoiled plasmid DNA remaining. Typical results of such cleavage assays are shown in Fig. 4 A. Initial velocities (v0) were calculated for any given concentration of Sau3AI as described under “Experimental Procedures.” In the v0 versus Sau3AI concentration plot, a nonlinear dependence was obtained (Fig. 4 B). The fact that, at lowSau3AI concentrations, the initial velocity of the reaction is not directly proportional to the enzyme concentration suggests that the Sau3AI-catalyzed reaction is higher than first order with respect to the concentration of Sau3AI. The nonlinear relationship of v0 versus Sau3AI concentration is best explained by a cooperative binding of Sau3AI molecules to the DNA substrate. An alternative explanation for a sigmoidal dependence of the initial rate of DNA cleavage on the enzyme concentration could be that the enzyme is being inactivated at low concentrations. Although this cannot be excluded, we regard it as unlikely because the DNA cleavage assay was carried out in the presence of 0.05 mg/ml bovine serum albumin. It must be emphasized that the intermediates with only one recognition site left (Fig. 4, I-1) were cleaved only very slowly, an observation typical for type IIe restriction enzymes, which require two sites for efficient DNA cleavage. The cooperative interaction of Sau3AI with DNA could be explained by different mechanisms. For instance, it could be that the active site is formed only by dimerization of the N-terminal domains of two Sau3AI molecules, as observed for FokI endonuclease (3Bitinaite J. Wah D.A. Aggarwal A.K. Schildkraut I. Proc. Natl. Acad. Sci" @default.
• W1991877881 created "2016-06-24" @default.
• W1991877881 creator A5040457416 @default.
• W1991877881 creator A5072025848 @default.
• W1991877881 creator A5082517458 @default.
• W1991877881 creator A5088616795 @default.
• W1991877881 date "2001-06-01" @default.
• W1991877881 modified "2023-10-17" @default.
• W1991877881 title "Sau3AI, a Monomeric Type II Restriction Endonuclease That Dimerizes on the DNA and Thereby Induces DNA Loops" @default.
• W1991877881 cites W1010760336 @default.
• W1991877881 cites W1022869512 @default.
• W1991877881 cites W1518916247 @default.
• W1991877881 cites W1520249041 @default.
• W1991877881 cites W1569201777 @default.
• W1991877881 cites W1917300465 @default.
• W1991877881 cites W1963939468 @default.
• W1991877881 cites W1965962340 @default.
• W1991877881 cites W1971374540 @default.
• W1991877881 cites W1971782862 @default.
• W1991877881 cites W1977787294 @default.
• W1991877881 cites W1979244293 @default.
• W1991877881 cites W1996242834 @default.
• W1991877881 cites W1996338282 @default.
• W1991877881 cites W1997200688 @default.
• W1991877881 cites W1999361928 @default.
• W1991877881 cites W2001054940 @default.
• W1991877881 cites W2006417881 @default.
• W1991877881 cites W2006869216 @default.
• W1991877881 cites W2011769393 @default.
• W1991877881 cites W2014571977 @default.
• W1991877881 cites W2029764477 @default.
• W1991877881 cites W2041508914 @default.
• W1991877881 cites W2049685795 @default.
• W1991877881 cites W2051854517 @default.
• W1991877881 cites W2052666367 @default.
• W1991877881 cites W2058046308 @default.
• W1991877881 cites W2058713270 @default.
• W1991877881 cites W2061648185 @default.
• W1991877881 cites W2076300945 @default.
• W1991877881 cites W2078335525 @default.
• W1991877881 cites W2084466582 @default.
• W1991877881 cites W2086564003 @default.
• W1991877881 cites W2087997045 @default.
• W1991877881 cites W2090511281 @default.
• W1991877881 cites W2093687299 @default.
• W1991877881 cites W2094470264 @default.
• W1991877881 cites W2101937540 @default.
• W1991877881 cites W2104017463 @default.
• W1991877881 cites W2106882534 @default.
• W1991877881 cites W2110120447 @default.
• W1991877881 cites W2118514248 @default.
• W1991877881 cites W2126237980 @default.
• W1991877881 cites W2135917793 @default.
• W1991877881 cites W2137618022 @default.
• W1991877881 cites W2139582206 @default.
• W1991877881 cites W2141798197 @default.
• W1991877881 cites W2142529984 @default.
• W1991877881 cites W2144483796 @default.
• W1991877881 cites W2147667050 @default.
• W1991877881 cites W2158714788 @default.
• W1991877881 cites W2167002150 @default.
• W1991877881 cites W2171273528 @default.
• W1991877881 cites W2401294581 @default.
• W1991877881 cites W4235000932 @default.
• W1991877881 doi "https://doi.org/10.1074/jbc.m101694200" @default.
• W1991877881 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11316811" @default.
• W1991877881 hasPublicationYear "2001" @default.
• W1991877881 type Work @default.
• W1991877881 sameAs 1991877881 @default.
• W1991877881 citedByCount "59" @default.
• W1991877881 countsByYear W19918778812012 @default.
• W1991877881 countsByYear W19918778812013 @default.
• W1991877881 countsByYear W19918778812014 @default.
• W1991877881 countsByYear W19918778812016 @default.
• W1991877881 countsByYear W19918778812017 @default.
• W1991877881 countsByYear W19918778812019 @default.
• W1991877881 countsByYear W19918778812020 @default.
• W1991877881 countsByYear W19918778812021 @default.
• W1991877881 countsByYear W19918778812022 @default.
• W1991877881 countsByYear W19918778812023 @default.
• W1991877881 crossrefType "journal-article" @default.
• W1991877881 hasAuthorship W1991877881A5040457416 @default.
• W1991877881 hasAuthorship W1991877881A5072025848 @default.
• W1991877881 hasAuthorship W1991877881A5082517458 @default.
• W1991877881 hasAuthorship W1991877881A5088616795 @default.
• W1991877881 hasBestOaLocation W19918778811 @default.
• W1991877881 hasConcept C104317684 @default.
• W1991877881 hasConcept C128319531 @default.
• W1991877881 hasConcept C153911025 @default.
• W1991877881 hasConcept C185592680 @default.
• W1991877881 hasConcept C195116880 @default.
• W1991877881 hasConcept C2777028655 @default.
• W1991877881 hasConcept C40767141 @default.
• W1991877881 hasConcept C54355233 @default.
• W1991877881 hasConcept C552990157 @default.
• W1991877881 hasConcept C55493867 @default.
• W1991877881 hasConcept C86803240 @default.
• W1991877881 hasConceptScore W1991877881C104317684 @default.

• next