FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992381189> ?p ?o ?g. }

• W1992381189 endingPage "19252" @default.
• W1992381189 startingPage "19248" @default.
• W1992381189 abstract "Cortactin, a substrate of pp60c- src and a potent filamentous actin binding and cross-linking protein, is abundant in circulating platelets. After stimulation of platelet aggregation with collagen, cortactin undergoes a dramatic increase in tyrosine phosphorylation followed by a rapid degradation. The cleavage of platelet cortactin was detected in lysates prepared using either Triton-containing buffer or SDS-sample buffer. However, the degradation of cortactin was not observed in platelets derived from a Glanzmann's patient, who lacked functional integrin αIIbβ3 (GPIIb-IIIa). In addition, the proteolysis of cortactin was abolished by treating platelets before but not after collagen stimulation with EGTA or calpeptin. Furthermore, recombinant cortactin was digested by μ-calpain in vitro in a dose-dependent manner, indicating that cortactin is a substrate for calpain. We also observed that the calpain-mediated digestion in vitro is dependent on the presence of a sequence containing a proline-rich region and multiple tyrosine residues that are phosphorylated by pp60c- src. Tyrosine phosphorylation by pp60c- src up-regulates the activity of calpain toward cortactin. Our data suggest that the calpain-mediated proteolysis of tyrosine-phosphorylated cortactin may provide a mechanism to remodel irreversibly the cytoskeleton in response to platelet agonists. Cortactin, a substrate of pp60c- src and a potent filamentous actin binding and cross-linking protein, is abundant in circulating platelets. After stimulation of platelet aggregation with collagen, cortactin undergoes a dramatic increase in tyrosine phosphorylation followed by a rapid degradation. The cleavage of platelet cortactin was detected in lysates prepared using either Triton-containing buffer or SDS-sample buffer. However, the degradation of cortactin was not observed in platelets derived from a Glanzmann's patient, who lacked functional integrin αIIbβ3 (GPIIb-IIIa). In addition, the proteolysis of cortactin was abolished by treating platelets before but not after collagen stimulation with EGTA or calpeptin. Furthermore, recombinant cortactin was digested by μ-calpain in vitro in a dose-dependent manner, indicating that cortactin is a substrate for calpain. We also observed that the calpain-mediated digestion in vitro is dependent on the presence of a sequence containing a proline-rich region and multiple tyrosine residues that are phosphorylated by pp60c- src. Tyrosine phosphorylation by pp60c- src up-regulates the activity of calpain toward cortactin. Our data suggest that the calpain-mediated proteolysis of tyrosine-phosphorylated cortactin may provide a mechanism to remodel irreversibly the cytoskeleton in response to platelet agonists. Cortactin, an F-actin 1The abbreviations used are: F-actin, filamentous actin; mAb, monoclonal antibody; PAGE, polyacrylamide gel electrophoresis; SH3, Src homology 3. binding and cross-linking protein (1Huang C. Ni Y. Gao Y. Wang T. Haudenschild C.C. Zhan X. J. Biol. Chem. 1997; 272: 13911-13915Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 12Wu H. Parsons J.T. J. Cell Biol. 1993; 120: 1417-1426Crossref PubMed Scopus (452) Google Scholar), is a major target for tyrosine phosphorylation in response to signaling mediated by fibroblast growth factor (2Zhan X. Hu X. Friesel R. Maciag T. J. Biol. Chem. 1993; 268: 9611-9620Abstract Full Text PDF PubMed Google Scholar), epidermal growth factor (3Maa M. Wilson L.K. Moyers J.S. Vines R.R. Parsons J.T. Parsons S.J. Oncogene. 1992; 7: 2429-2438PubMed Google Scholar), integrin activation (4Vuori K. Ruoslahti E. J. Biol. Chem. 1995; 270: 22259-22262Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar), bacteria-mediated phagocytosis (5Dehio C. Prevost M.C. Sansonetti P.J. EMBO J. 1995; 14: 2471-2482Crossref PubMed Scopus (163) Google Scholar), and v-src oncogene (6Wu H. Reynolds A.B. Kanner S.B. Vines R.R. Parsons J.T. Mol. Cell Biol. 1991; 11: 5113-5124Crossref PubMed Scopus (375) Google Scholar). Overexpression or amplification of the human cortactin gene (also called EMS1) is often associated with human malignancies (7Schuuring E.D. Verhoeven E. Litvinov S. Michalides R.J.A.M. Mol. Cell Biol. 1993; 13: 2891-2898Crossref PubMed Scopus (151) Google Scholar, 8Bringuier P.P. Tamimi Y. Schuuring E. Schalken J. Oncogene. 1996; 12: 1747-1753PubMed Google Scholar). In v-Src-transformed cells, cortactin has been found to co-localize with Src oncoproteins within podosomes, membrane-substratum contact structures (6Wu H. Reynolds A.B. Kanner S.B. Vines R.R. Parsons J.T. Mol. Cell Biol. 1991; 11: 5113-5124Crossref PubMed Scopus (375) Google Scholar). Analysis of cortactin phosphorylation in cells lacking the c-src gene (9Thomas S.M. Soriano P. Imamoto A. Nature. 1995; 376: 267-271Crossref PubMed Scopus (304) Google Scholar) or following overexpression of c-Csk (10Nada S. Okada M. Aizawa S. Nakagawa H. Oncogene. 1994; 9: 3571-3578PubMed Google Scholar), a negative regulator for pp60c- src, has provided further compelling evidence that cortactin is an intrinsic substrate for pp60c- src. The protein sequence of cortactin is unique because it contains six and one-half 37-amino acid tandem repeats near the NH2terminus, and a Src homology 3 (SH3) domain at the carboxyl-terminal end. Between the repeat and the SH3 domain is an α-helix, a proline-rich region, and multiple tyrosine residues. The amino acid sequence of human cortactin within the repeat domain shares nearly 100% identity with the chicken and murine homologues and 70% with HS1, a cortactin-related gene product (11Kitamura D. Kaneko H. Miyagoe Y. Ariyasu T. Watanabe T. Nucleic Acids Res. 1989; 17: 9367-9379PubMed Google Scholar), indicating that the repeat domain plays a fundamental role for cortactin (12Wu H. Parsons J.T. J. Cell Biol. 1993; 120: 1417-1426Crossref PubMed Scopus (452) Google Scholar). Indeed, the repeat domain has been demonstrated as the binding site for F-actin (12Wu H. Parsons J.T. J. Cell Biol. 1993; 120: 1417-1426Crossref PubMed Scopus (452) Google Scholar). In contrast, the sequence between the α-helix and the SH3 domain exhibits less than 33% identity to HS1, but the function of this region has not yet been identified. We recently reported that there is abundant expression of cortactin in megakaryocytes and platelets (13Zhan X. Haudenschild C.C. Ni Y. Smith E. Huang C. Blood. 1997; 89: 457-464Crossref PubMed Google Scholar). While tyrosine phosphorylation of cortactin has been described as a major phenomenon in thrombin-stimulated platelets (14Wong S. Reynolds A.B. Papkoff J. Oncogene. 1992; 7: 2407-2415PubMed Google Scholar, 15Fox J.E.B. Lipfert L. Clark E.A. Reynolds C.C. Austin C.D. Brugge J.S. J. Biol. Chem. 1993; 268: 25973-25984Abstract Full Text PDF PubMed Google Scholar), the significance of the tyrosine phosphorylation is unknown. In the present study, we examined the fate of cortactin in platelets stimulated by collagen. We found that cortactin is degraded following tyrosine phosphorylation and that the protease responsible for the cortactin degradation is a calpain-related enzyme, which requires integrin αIIbβ3. Furthermore, we provide in vitro evidence that the sequence containing the proline-rich region and multiple tyrosine residues targeted by pp60c- src is required for the calpain-mediated cleavage. Finally, we demonstrated that tyrosine phosphorylation of cortactin by pp60c- src dramatically alters its susceptibility to calpain. These data suggest that tyrosine phosphorylation may play a role in the calpain-mediated proteolysis of cortactin. Monoclonal antibody (mAb) 4F11 was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Monoclonal antibody against phosphotyrosine (RC20) was from Transduction Laboratories (Lexington, KY). The polyclonal antibody against the C-terminal part of murine cortactin was derived from mice immunized with a recombinant protein corresponding to amino acids 323–546. Prostaglandin E1, phenylmethylsulfonyl fluoride, Triton X-100, EGTA, benzamidine, leupeptin, and aprotinin were from Sigma. SDS-PAGE markers were from Bio-Rad. Protein A-Sepharose was from Pharmacia Biotech Inc. Purified μ-calpain derived from pig erythrocytes was obtained from ICN (Costa Mesa, CA). Calpeptin was from Biomol (Plymouth Meeting, PA). Sodium orthovanadate was from Fisher. Type I tendon collagen was from Chrono-Log Co. (Havertown, PA). Human blood (500 ml) from healthy volunteers was collected into 70 ml of CPD solution, containing 1.84 mg of sodium citrate, 1.78 mg of dextrose, 209 mg of citric acid, and 155 mg of monobasic sodium phosphate. Platelet-rich plasma was obtained by centrifugation at 200 × g for 16 min at ambient temperature. Blood from a Glanzmann's patient (female) was kindly provided by Robert Abel (Christina Hospital, Wilmington, DE). Citric acid and prostaglandin E1 were added to platelet-rich plasma to final concentrations of 4 mm and 1 μg/ml, respectively. The platelet-rich plasma was then centrifuged at 700 × g for 10 min. The platelet pellet was resuspended in washing buffer (4.26 mmNaH2PO4, 7.46 mmNa2HPO4, pH 6.5, containing 5.5 mmdextrose, 128 mm NaCl, 4.77 mm sodium citrate, 2.35 mm citric acid, and 3.5 mg/ml of bovine serum albumin) and centrifuged at 700 × g for 10 min. The pellet was then resuspended in a modified Tyrode-Hepes buffer (10 mmHepes, pH 7.35, containing 136.7 mm NaCl, 5 mmglucose, 2.6 mm KCl, 13.8 mmNaHCO3, 1.0 mm MgCl2, 0.36 mm NaH2PO4, and 3.5 mg/ml bovine serum albumin) at 1 × 109 platelets/ml. Collagen at a final concentration of 2.5 μg/ml was added to the washed platelets (0.6 ml of 1 × 109cells/ml) in the presence of 1 mm CaCl2 in an aggregometer cuvette at 37 °C for the times indicated. Activated platelets were immediately lysed by adding 200 μl of 4 × Triton lysis buffer (200 mm Tris-HCl, pH 7.2, containing 4% Triton X-100, 20 mm EGTA, 40 μg/ml leupeptin, 40 μg/ml aprotinin, 4 mm phenylmethylsulfonyl fluoride, 4 mm benzamidine, and 4 mmNa3VO4). The lysates were centrifuged at 15,000 × g for 10 min. The pellet (insoluble fraction) was solubilized by adding an equal volume of 2 × SDS sample buffer (16Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207472) Google Scholar). The soluble fractions were subjected to immunoprecipitation by mAb 4F11 (2.5 μg/ml) as described previously (2Zhan X. Hu X. Friesel R. Maciag T. J. Biol. Chem. 1993; 268: 9611-9620Abstract Full Text PDF PubMed Google Scholar). The immunoprecipitates were washed once with 1 × Triton-lysis buffer, resuspended in 2 × SDS sample buffer, and analyzed by immunoblotting analysis with either mAb 4F11 or RC20 as described previously (2Zhan X. Hu X. Friesel R. Maciag T. J. Biol. Chem. 1993; 268: 9611-9620Abstract Full Text PDF PubMed Google Scholar). Stirred platelets (0.4 ml of 1 × 109 cells/ml) were stimulated with collagen at 37 °C and lysed by adding an equal volume of 2 × SDS sample buffer including 10 mm EGTA and 20 μm calpeptin. The platelet proteins were separated by SDS-PAGE, and cortactin was detected by immunoblot analysis. To prepare GST-cortactin, a DNA fragment of 182 bp was generated by polymerase chain reaction. The oligonucleotide ACTCGTGGATCCTGGAAAGCCTCTGCA was used as the 5′ primer and contained a BamHI site; the oligonucleotide CTTGAGCGTCTGGTGTT was used as the 3′ primer and contained an Xmn1 site. The amplified fragment was ligated with a DNA fragment derived from the digestion of a cDNA clone encoding the murine cortactin (2Zhan X. Hu X. Friesel R. Maciag T. J. Biol. Chem. 1993; 268: 9611-9620Abstract Full Text PDF PubMed Google Scholar) with Xmn1 andEcoRI, and the ligated product was then cloned intoBamHI and EcoRI sites of PGEX-2T (Pharmacia). The cortactin variant CortΔ496–546 was prepared as follows. A DNA fragment of 370 base pairs was prepared by polymerase chain reaction. The oligonucleotide CGAGAGAGCTCAGCGGATGGCC was used as the 5′ primer and contained a SacI site; the oligonucleotide ACTGCAGAATTCTAGATGGCTGTGATGCC was used as the 3′ primer and contained an EcoRI site and a stop codon. The amplified fragment was cloned into a DNA fragment derived from the digestion of GST-cortactin with SacI and EcoRI. CortΔ375–546was prepared in the same way as CortΔ496–546 except that the oligonucleotide CGAGAGAGCTCAGTAACGGATCGCCAAAGAA was used as the 5′ primer and contained a stop codon and a SacI site. All polymerase chain reaction-generated fragments were confirmed by DNA sequencing. Cortactin and its variants were expressed inEscherichia coli as glutathione S-transferase fusion proteins and purified by affinity chromatography using glutathione-Sepharose as described previously (17Zhan X. Plourde C. Hu X. Friesel R. Maciag T. J. Biol. Chem. 1994; 269: 20221-20224Abstract Full Text PDF PubMed Google Scholar). The purified glutathione S-transferase fusion proteins were further digested with thrombin, and the glutathioneS-transferase-free proteins were purified using glutathione-Sepharose and DEAE-Sepharose (1Huang C. Ni Y. Gao Y. Wang T. Haudenschild C.C. Zhan X. J. Biol. Chem. 1997; 272: 13911-13915Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). Purified recombinant cortactin (3.6 μg) was incubated with μ-calpain for 90 min at different concentrations in 40 μl of reaction buffer (50 mm Tris-HCl, pH 7.36, containing 134 mm KCl, 1 mm MgCl2, 75 μm EGTA, and 75 μm CaCl2). The reaction was terminated by adding an equal volume of 2 × SDS sample buffer, and the proteins were separated by a gradient SDS-PAGE gel (4–20%, w/v). The digested proteins were visualized by either Coomassie Blue staining or immunoblotting with mAb 4F11 or a polyclonal antibody directed against a peptide encoding the amino acid sequence from the α-helix to the SH3 domain. To evaluate the role of cortactin in platelet aggregation, we examined tyrosine phosphorylation of cortactin in collagen-stimulated platelets. Activated platelets were lysed using a Triton X-100-containing buffer. The soluble fractions were subjected to immunoprecipitation with 4F11, a mAb recognizing the repeat domain of cortactin (6Wu H. Reynolds A.B. Kanner S.B. Vines R.R. Parsons J.T. Mol. Cell Biol. 1991; 11: 5113-5124Crossref PubMed Scopus (375) Google Scholar). The pellets were solubilized in SDS sample buffer. Proteins in both fractions were immunoblotted using either a polyclonal antibody against cortactin or a mAb against phosphotyrosine. As shown in Fig.1 A, stimulation of stirred platelets with collagen caused a dramatic increase in the level of tyrosine phosphorylation of cortactin after 15 s and a maximum phosphorylation at 45 s, which was concomitant with platelet aggregation (data not shown). However, the level of phosphorylated cortactin declined slightly after 1 min of stimulation, and this coincided with a decrease in the level of cortactin in the soluble fraction (Fig. 1 B). We examined the possibility that a reduced amount of cortactin in the soluble fraction in response to collagen could be a consequence of the cytoskeletal translocation that has been described previously in thrombin-stimulated platelets (15Fox J.E.B. Lipfert L. Clark E.A. Reynolds C.C. Austin C.D. Brugge J.S. J. Biol. Chem. 1993; 268: 25973-25984Abstract Full Text PDF PubMed Google Scholar, 18Ozawa K. Kashiwada K. Takahashi M. Sobue K. Exp. Cell Res. 1995; 221: 197-204Crossref PubMed Scopus (41) Google Scholar). Immunoblot analysis of cortactin in the insoluble fraction demonstrated that the stimulation of platelets with collagen enhanced tyrosine phosphorylation of multiple proteins including those that migrated at the positions for cortactin (Fig. 1 C). However, the amount of cortactin associated with the insoluble fraction was only transiently increased during the period from 30 to 45 s and diminished afterward (Fig.1 D), suggesting that platelet cortactin, in either the soluble or insoluble fractions, was degraded after collagen stimulation. The degradation of cortactin appears not caused by a nonspecific proteolysis because pp60c- src associated with the pellets was not degraded under the same conditions even after a prolonged stimulation (Fig. 1 D). To confirm that the apparent degradation of cortactin was not the result of a protease released during the Triton-mediated lysis, we analyzed cortactin in platelet lysates that were prepared by direct lysis in SDS-sample buffer. The results from these experiments were compared with the pattern of cortactin degradation prepared in Triton X-100 buffer. As shown in Fig. 2 A, significant amount of degraded cortactin was detected in the SDS-lysed whole platelets after collagen stimulation, although the extent of the degradation, especially at early phases of stimulation (30 and 45 s), appeared to be less than that of Triton-lysed platelets. However, the degradation patterns in both lysates are similar (Fig.2 B). Calpain is a family of calcium-dependent cysteine proteases that are abundantly present in platelets and are activated during platelet aggregation (19Croall D.E. DeMartino G.N. Physiol. Rev. 1991; 71: 813-847Crossref PubMed Scopus (781) Google Scholar,20Fox J.E. Taylor R.G. Taffarel M. Boyles J.K. Goll D.E. J. Cell Biol. 1993; 120: 1501-1507Crossref PubMed Scopus (134) Google Scholar). As shown in Fig. 3 A, EGTA treatment of platelets significantly inhibited the degradation of cortactin as compared with untreated platelets. Furthermore, treatment with calpeptin, a specific membrane-permeable peptide-derivative inhibitor for calpain (21Tsujinaka T. Kajiwara Y. Kambayashi J. Sakon M. Higuchi N. Tanaka T. Mori T. Biochem. Biophys. Res. Commun. 1988; 153: 1201-1208Crossref PubMed Scopus (206) Google Scholar), resulted in the same reduction of cortactin degradation (Fig. 3 B, part a). However, when a lysis buffer containing either EGTA or calpeptin was used to lyse activated platelets, no significant inhibition of cortactin degradation was observed (Fig. 3 B, parts b and c). This result further confirms that the degradation of cortactin primarily occurs prior to platelet lysis. In platelets, the influx of calcium can be regulated by the activation of αIIbβ3 (22Fujimoto T. Fujimura K. Kuramoto A. J. Biol. Chem. 1991; 266: 16370-16375Abstract Full Text PDF PubMed Google Scholar, 23Rybak M.E. Renzulli L.A. Bruns M.J. Cahaly D.P. Blood. 1988; 72: 714-720Crossref PubMed Google Scholar), a major integrin on the surface of platelets. To evaluate the role of αIIbβ3 in the proteolysis of cortactin, we examined tyrosine phosphorylation of cortactin in platelets from a Glanzmann's patient. As shown in Fig. 4, normal platelets exhibited a 60% reduction in the amount of intact cortactin after 3 min of collagen stimulation. In contrast, no significant reduction was found with the Glanzmann's platelets, suggesting that the degradation of cortactin requires αIIbβ3 under identical conditions. Interestingly, the induction of tyrosine phosphorylation of cortactin in response to collagen in the Glanzmann's platelets was not impaired (Fig. 4), implying that tyrosine phosphorylation of cortactin is a process independent of αIIbβ3. Purified μ-calpain (calpain-I) digests recombinant murine cortactin in vitro in a dose-dependent manner (Fig. 5 A). At a concentration of 6.2 μg/ml of calpain, approximately 90% of the cortactin proteins were digested to multiple fragments. Interestingly, many of the digested fragments were reactive to mAb 4F11, which specifically recognizes the repeat domain of cortactin (12Wu H. Parsons J.T. J. Cell Biol. 1993; 120: 1417-1426Crossref PubMed Scopus (452) Google Scholar), but not to an antibody directed against the region between the repeat and the carboxyl terminus (Fig. 6 A). This implies that the sequence in this region may be more susceptible to calpain. To verify this, we analyzed two cortactin variants, CortΔ496–546, which lacks the SH3 domain, and CortΔ375–546, which lacks the sequence from the proline-rich region to the carboxyl terminus (Fig. 6 B,upper part). As with the wild-type cortactin, the mutant CortΔ496–546 was efficiently digested by calpain (Fig.6 B, lower part). In contrast, little digestion of the mutant CortΔ375–546 was detected under the same conditions, indicating that the sequence of amino acids 375–496, which contains the proline-rich region and multiple tyrosine residues, may be involved in the calpain-mediated proteolysis.Figure 6Calpain-mediated digestion requires the presence of a sequence containing the proline-rich region and multiple tyrosine residues. A, cortactin was incubated for 90 min in either the absence (lane 1) or presence (lane 2) of 1.5 μg/ml μ-calpain. The digested proteins were immunoblotted with mAb 4F11 (a) or a polyclonal antibody against amino acids 323–546 (b). B, upper part, schematic presentation of cortactin and cortactin mutants. The areas for the repeat (Repeat), the α-helix (Helix), the proline-rich region (P), and tyrosine residues targeted by pp60c- src (Y) are indicated;lower part, cortactin and its mutants were digested with μ-calpain, and the resultant fragments were analyzed by immunoblotting with mAb 4F11.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Amino acids 375–496 contain multiple tyrosine residues that can be targeted for phosphorylation by pp60c- src. 2J. Qiu and X. Zhan, manuscript in preparation. Thus, we performed a calpain digestion of cortactin phosphorylated by pp60c- src. Fig. 7 shows that most phosphorylated cortactin proteins were digested nearly completely within 2 min. In contrast, significant amounts of nonphosphorylated cortactin remained even after 20 min of digestion under the same conditions. However, when partially digested phosphorylated cortactin was analyzed by SDS-PAGE and compared with nonphosphorylated cortactin, we did not observe any significant difference in the two patterns (Fig.7). Therefore, it is likely that tyrosine phosphorylation enhances the efficiency of calpain-mediated digestion without altering its cleavage sites. It is unclear whether platelet calpain-mediated proteolysis occurs during lysis of cells or within aggregated platelets (24Wencel-Drake J.D. Okita J.R. Annis D.S. Kunicki T.J. Arterioscler. Thromb. 1991; 11: 882-891Crossref PubMed Scopus (25) Google Scholar, 25Elce J.S. Sigmund L. Fox M.J. Biochem. J. 1989; 261: 1039-1042Crossref PubMed Scopus (14) Google Scholar). Our data indicate that the proteolysis of cortactin occurs within activated platelets. We detected the degradation of cortactin in whole platelets prepared by direct lysis in a SDS-sample buffer (Figs. 2 and 4). In addition, the calpain inhibitors EGTA and calpeptin block the degradation when they are applied before but not after platelet activation. Finally, it appears that the calpain-mediated proteolysis of cortactin is not the result of a nonspecific proteolysis, because pp60c- src, another substrate for calpain (26Oda A. Druker B.J. Ariyoshi H. Smith M. Salzman E.W. J. Biol. Chem. 1993; 268: 12603-12608Abstract Full Text PDF PubMed Google Scholar), was not degraded under the same conditions that allow cortactin proteolysis (Fig. 1 D). However, it should be pointed out that the degree of the proteolysis of cortactin in activated platelets appears to vary depending on the method of lysing platelets. There is more extensive degradation found in Triton-lysed platelets than in SDS sample buffer (Fig. 2). This may be due to the fact that the soluble cortactin becomes more vulnerable to calpain released after lysis. In agreement with other reports (15Fox J.E.B. Lipfert L. Clark E.A. Reynolds C.C. Austin C.D. Brugge J.S. J. Biol. Chem. 1993; 268: 25973-25984Abstract Full Text PDF PubMed Google Scholar, 18Ozawa K. Kashiwada K. Takahashi M. Sobue K. Exp. Cell Res. 1995; 221: 197-204Crossref PubMed Scopus (41) Google Scholar), we observed that cortactin undergoes a transient translocation into the Triton-insoluble fraction between 30 and 45 s after collagen stimulation (Fig.1 D); however, the role of the translocation in this proteolysis of cortactin is not clear. While cortactin is a potent F-actin binding and cross-linking protein, the presence of F-actin does not apparently change the efficiency of the proteolysis of cortactinin vitro (data not shown). Furthermore, a cortactin mutant able to bind to F-actin but lacking the sequence from the proline-rich region to the carboxyl terminus is not efficiently digested by calpain (Fig. 6 B). Hence, it is unlikely that the F-actin binding is a rate-limiting step for the calpain digestion. Many cytoskeleton-associated proteins have been reported to be substrates for calpain. These include actin-binding proteins (27Fox J.E.B. Goll D.E. Reynolds C.C. Phillips D.R. J. Biol. Chem. 1985; 260: 1060-1066Abstract Full Text PDF PubMed Google Scholar), vitronectin (28Seiffert D. J. Biol. Chem. 1996; 271: 11170-11176Abstract Full Text Full Text PDF PubMed Scopus (9) Google Scholar), protein-phosphotyrosine phosphatase 1B (29Frangioni J.V. Oda A. Smith M. Salzman E.W. Neel B.G. EMBO J. 1993; 12: 4843-4856Crossref PubMed Scopus (283) Google Scholar), integrin β3 subunit (30Du X. Saido T.C. Tsubuki S. Indig F.E. Williams M.J. Ginsberg M.H. J. Biol. Chem. 1995; 270: 26146-26151Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar), talin (27Fox J.E.B. Goll D.E. Reynolds C.C. Phillips D.R. J. Biol. Chem. 1985; 260: 1060-1066Abstract Full Text PDF PubMed Google Scholar), spectrin (31Fox J.E.B. Reynolds C.C. Morrow J.S. Phillips D.R. Blood. 1987; 69: 537-545Crossref PubMed Google Scholar), and protein kinase C (32Melloni E. Pontremoli S. Michetti M. Sacco O. Sparatore B. Horecker B.L. J. Biol. Chem. 1986; 261: 4101-4105Abstract Full Text PDF PubMed Google Scholar). As with many of those substrates, proteolysis of cortactin appears to be dependent on αIIbβ3because it does not occur in Glanzmann's platelets lacking functional αIIbβ3 (Fig. 4). We have found, however, that the absence of αIIbβ3 does not affect collagen-induced tyrosine phosphorylation of cortactin. Our finding is in agreement with a previous report, which also showed increased tyrosine phosphorylation in thrombin-treated platelets derived from Glanzmann's patients (15Fox J.E.B. Lipfert L. Clark E.A. Reynolds C.C. Austin C.D. Brugge J.S. J. Biol. Chem. 1993; 268: 25973-25984Abstract Full Text PDF PubMed Google Scholar). Furthermore, tyrosine phosphorylation of cortactin can be detected after 15 s of stimulation (Fig.1 A). This is prior to platelet aggregation, which occurs 30–45 s after stimulation. Thus, tyrosine phosphorylation of cortactin is kinetically correlated with the activation of pp60c- src, which occurs in the early phase prior to the activation of αIIbβ3 during platelet stimulation (33Clark E.A. Brugge J.S. Mol. Cell Biol. 1993; 13: 1863-1871Crossref PubMed Scopus (198) Google Scholar). These data indicate that the Src-mediated tyrosine phosphorylation of cortactin could be involved in the calpain-mediated digestion. The importance of Src in the digestion of cortactin is further highlighted by our findings that the digestion of recombinant cortactin by μ-calpain is dependent on the presence of a sequence containing multiple tyrosine residues targeted by pp60c- src (Fig. 6), and the efficiency of the digestion of cortactin in vitro is dramatically increased by pp60c- src (Fig. 7). Calpain-digested cortactin in vitro has significantly less F-actin cross-linking activity (data not shown). Interestingly, the F-actin cross-linking activity can be also down-regulated by tyrosine phosphorylation without degradation (1Huang C. Ni Y. Gao Y. Wang T. Haudenschild C.C. Zhan X. J. Biol. Chem. 1997; 272: 13911-13915Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). These dual mechanisms regulating cortactin may be required to ensure the irreversible shape change associated with activated platelets. It is also noteworthy that both mechanisms involve the same structural region between the proline-rich motif and the SH3 domain. This may suggest the importance of this region in the regulation of cortactin function. Since calpain and cortactin are widely expressed in many mammalian cells, future studies using a structure-function approach should reveal the significance of calpain-mediated cleavage of cortactin in cellular cytoskeletal reorganization. We thank Graham Jamieson and Allan Mufson for critical reading of the manuscript and Diana Norman for expert secretarial support." @default.
• W1992381189 created "2016-06-24" @default.
• W1992381189 creator A5016198611 @default.
• W1992381189 creator A5051164101 @default.
• W1992381189 creator A5062777059 @default.
• W1992381189 creator A5063745592 @default.
• W1992381189 creator A5073651132 @default.
• W1992381189 creator A5081299508 @default.
• W1992381189 date "1997-08-01" @default.
• W1992381189 modified "2023-09-27" @default.
• W1992381189 title "Proteolysis of Platelet Cortactin by Calpain" @default.
• W1992381189 cites W1482508730 @default.
• W1992381189 cites W1487264337 @default.
• W1992381189 cites W1490194809 @default.
• W1992381189 cites W1492306774 @default.
• W1992381189 cites W1517089997 @default.
• W1992381189 cites W1526067645 @default.
• W1992381189 cites W1548272930 @default.
• W1992381189 cites W1615050047 @default.
• W1992381189 cites W1629000899 @default.
• W1992381189 cites W1644644009 @default.
• W1992381189 cites W1963588589 @default.
• W1992381189 cites W1965860054 @default.
• W1992381189 cites W1999673185 @default.
• W1992381189 cites W2009582035 @default.
• W1992381189 cites W2045139373 @default.
• W1992381189 cites W2061229454 @default.
• W1992381189 cites W2061288879 @default.
• W1992381189 cites W2086613393 @default.
• W1992381189 cites W2100837269 @default.
• W1992381189 cites W2144098180 @default.
• W1992381189 cites W2267906346 @default.
• W1992381189 cites W2295565150 @default.
• W1992381189 cites W2406924013 @default.
• W1992381189 cites W2412876073 @default.
• W1992381189 cites W297127588 @default.
• W1992381189 doi "https://doi.org/10.1074/jbc.272.31.19248" @default.
• W1992381189 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9235918" @default.
• W1992381189 hasPublicationYear "1997" @default.
• W1992381189 type Work @default.
• W1992381189 sameAs 1992381189 @default.
• W1992381189 citedByCount "68" @default.
• W1992381189 countsByYear W19923811892012 @default.
• W1992381189 countsByYear W19923811892013 @default.
• W1992381189 countsByYear W19923811892014 @default.
• W1992381189 countsByYear W19923811892015 @default.
• W1992381189 countsByYear W19923811892016 @default.
• W1992381189 countsByYear W19923811892022 @default.
• W1992381189 crossrefType "journal-article" @default.
• W1992381189 hasAuthorship W1992381189A5016198611 @default.
• W1992381189 hasAuthorship W1992381189A5051164101 @default.
• W1992381189 hasAuthorship W1992381189A5062777059 @default.
• W1992381189 hasAuthorship W1992381189A5063745592 @default.
• W1992381189 hasAuthorship W1992381189A5073651132 @default.
• W1992381189 hasAuthorship W1992381189A5081299508 @default.
• W1992381189 hasBestOaLocation W19923811891 @default.
• W1992381189 hasConcept C142669718 @default.
• W1992381189 hasConcept C1491633281 @default.
• W1992381189 hasConcept C181199279 @default.
• W1992381189 hasConcept C185592680 @default.
• W1992381189 hasConcept C203014093 @default.
• W1992381189 hasConcept C2776000893 @default.
• W1992381189 hasConcept C2781307694 @default.
• W1992381189 hasConcept C55493867 @default.
• W1992381189 hasConcept C56928146 @default.
• W1992381189 hasConcept C86803240 @default.
• W1992381189 hasConcept C89560881 @default.
• W1992381189 hasConcept C95444343 @default.
• W1992381189 hasConceptScore W1992381189C142669718 @default.
• W1992381189 hasConceptScore W1992381189C1491633281 @default.
• W1992381189 hasConceptScore W1992381189C181199279 @default.
• W1992381189 hasConceptScore W1992381189C185592680 @default.
• W1992381189 hasConceptScore W1992381189C203014093 @default.
• W1992381189 hasConceptScore W1992381189C2776000893 @default.
• W1992381189 hasConceptScore W1992381189C2781307694 @default.
• W1992381189 hasConceptScore W1992381189C55493867 @default.
• W1992381189 hasConceptScore W1992381189C56928146 @default.
• W1992381189 hasConceptScore W1992381189C86803240 @default.
• W1992381189 hasConceptScore W1992381189C89560881 @default.
• W1992381189 hasConceptScore W1992381189C95444343 @default.
• W1992381189 hasIssue "31" @default.
• W1992381189 hasLocation W19923811891 @default.
• W1992381189 hasOpenAccess W1992381189 @default.
• W1992381189 hasPrimaryLocation W19923811891 @default.
• W1992381189 hasRelatedWork W1971997211 @default.
• W1992381189 hasRelatedWork W1991719291 @default.
• W1992381189 hasRelatedWork W1992381189 @default.
• W1992381189 hasRelatedWork W2023339576 @default.
• W1992381189 hasRelatedWork W2068429423 @default.
• W1992381189 hasRelatedWork W2081287886 @default.
• W1992381189 hasRelatedWork W2127736392 @default.
• W1992381189 hasRelatedWork W2143691041 @default.
• W1992381189 hasRelatedWork W2169865172 @default.
• W1992381189 hasRelatedWork W2419296309 @default.
• W1992381189 hasVolume "272" @default.
• W1992381189 isParatext "false" @default.
• W1992381189 isRetracted "false" @default.
• W1992381189 magId "1992381189" @default.

• next