FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992607565> ?p ?o ?g. }

• W1992607565 endingPage "8619" @default.
• W1992607565 startingPage "8613" @default.
• W1992607565 abstract "The family of UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferases (ppGalNAcTs) is unique among glycosyltransferases, containing both catalytic and lectin domains that we have previously shown to be closely associated. Here we describe the x-ray crystal structures of human ppGalNAcT-2 (hT2) bound to the product UDP at 2.75 Å resolution and to UDP and an acceptor peptide substrate EA2 (PTTDSTTPAPTTK) at 1.64 Å resolution. The conformations of both UDP and residues Arg362–Ser372 vary greatly between the two structures. In the hT2-UDP-EA2 complex, residues Arg362–Ser373 comprise a loop that forms a lid over UDP, sealing it in the active site, whereas in the hT2-UDP complex this loop is folded back, exposing UDP to bulk solvent. EA2 binds in a shallow groove with threonine 7 positioned consistent with in vitro data showing it to be the preferred site of glycosylation. The relative orientations of the hT2 catalytic and lectin domains differ dramatically from that of murine ppGalNAcT-1 and also vary considerably between the two hT2 complexes. Indeed, in the hT2-UDP-EA2 complex essentially no contact is made between the catalytic and lectin domains except for the peptide bridge between them. Thus, the hT2 structures reveal an unexpected flexibility between the catalytic and lectin domains and suggest a new mechanism used by hT2 to capture glycosylated substrates. Kinetic analysis of hT2 lacking the lectin domain confirmed the importance of this domain in acting on glycopeptide but not peptide substrates. The structure of the hT2-UDP-EA2 complex also resolves long standing questions regarding ppGalNAcT acceptor substrate specificity. The family of UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferases (ppGalNAcTs) is unique among glycosyltransferases, containing both catalytic and lectin domains that we have previously shown to be closely associated. Here we describe the x-ray crystal structures of human ppGalNAcT-2 (hT2) bound to the product UDP at 2.75 Å resolution and to UDP and an acceptor peptide substrate EA2 (PTTDSTTPAPTTK) at 1.64 Å resolution. The conformations of both UDP and residues Arg362–Ser372 vary greatly between the two structures. In the hT2-UDP-EA2 complex, residues Arg362–Ser373 comprise a loop that forms a lid over UDP, sealing it in the active site, whereas in the hT2-UDP complex this loop is folded back, exposing UDP to bulk solvent. EA2 binds in a shallow groove with threonine 7 positioned consistent with in vitro data showing it to be the preferred site of glycosylation. The relative orientations of the hT2 catalytic and lectin domains differ dramatically from that of murine ppGalNAcT-1 and also vary considerably between the two hT2 complexes. Indeed, in the hT2-UDP-EA2 complex essentially no contact is made between the catalytic and lectin domains except for the peptide bridge between them. Thus, the hT2 structures reveal an unexpected flexibility between the catalytic and lectin domains and suggest a new mechanism used by hT2 to capture glycosylated substrates. Kinetic analysis of hT2 lacking the lectin domain confirmed the importance of this domain in acting on glycopeptide but not peptide substrates. The structure of the hT2-UDP-EA2 complex also resolves long standing questions regarding ppGalNAcT acceptor substrate specificity. The first committed step of carbohydrate addition to mucin-type glycoproteins is catalyzed by a family of UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferases (ppGalNAcTs), 2The abbreviations used are: GalNAc, N-acetylgalactosamine; UDP-GalNAc, uridine 5′-diphospho-N-acetylgalactosamine; ppGalNAcT, UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferase; hT2, human ppGalNAcT-2; mT1, murine ppGalNAcT-1; Muc, mucin; TEV, tobacco etch virus; β-ME, β-mercaptoethanol. 2The abbreviations used are: GalNAc, N-acetylgalactosamine; UDP-GalNAc, uridine 5′-diphospho-N-acetylgalactosamine; ppGalNAcT, UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferase; hT2, human ppGalNAcT-2; mT1, murine ppGalNAcT-1; Muc, mucin; TEV, tobacco etch virus; β-ME, β-mercaptoethanol. yielding the Tn antigen (GalNac-α-1-O-Ser/Thr). This family is large (with ≈24 mammalian isoforms) and phylogenetically conserved with Drosophila expressing 14 isoforms, at least one of which is essential for development (1Ten Hagen K.G. Tran D.T. J. Biol. Chem. 2002; 277: 22616-22622Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 2Schwientek T. Bennett E.P. Flores C. Thacker J. Hollmann M. Reis C.A. Behrens J. Mandel U. Keck B. Schafer M.A. Haselmann K. Zubarev R. Roepstorff P. Burchell J.M. Taylor-Papadimitriou J. Hollingsworth M.A. Clausen H. J. Biol. Chem. 2002; 277: 22623-22638Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar), and Caenorhabditis elegans expressing 9 isoforms (3Hagen F.K. Nehrke K. J. Biol. Chem. 1998; 273: 8268-8277Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Subsequent elongation of the Tn structure yields an array of eight distinct “core” glycans that can be further modified by many of the glycosyltransferases resident in the Golgi. The embryonic lethality resulting from the knock-out of one of these core glycosyltransferases (the core 1 β1,3-galactosyltransferase) in mice underscores the biological importance of mucin-type glycans (4Xia L. Ju T. Westmuckett A. An G. Ivanciu L. McDaniel J.M. Lupu F. Cummings R.D. McEver R.P. J. Cell Biol. 2004; 164: 451-459Crossref PubMed Scopus (140) Google Scholar). The repertoire of O-glycans has been implicated in diverse biological processes including host defense (5Kawakubo M. Ito Y. Okimura Y. Kobayashi M. Sakura K. Kasama S. Fukuda M.N. Fukuda M. Katsuyama T. Nakayama J. Science. 2004; 305: 1003-1006Crossref PubMed Scopus (284) Google Scholar), lymphocyte homing (6Rosen S.D. Hwang S.T. Giblin P.A. Singer M.S. Biochem. Soc. Trans. 1997; 25: 428-433Crossref PubMed Scopus (27) Google Scholar), and tumor metastasis (7Borsig L. Wong R. Feramisco J. Nadeau D.R. Varki N.M. Varki A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3352-3357Crossref PubMed Scopus (584) Google Scholar), and the first example of a human disease (familial tumoral calcinosis) caused by the loss of function of a ppGalNAcT-T (ppGalNAcT-3) was recently reported (8Topaz O. Shurman D.L. Bergman R. Indelman M. Ratajczak P. Mizrachi M. Khamaysi Z. Behar D. Petronius D. Friedman V. Zelikovic I. Raimer S. Metzker A. Richard G. Sprecher E. Nat. Genet. 2004; 36: 579-581Crossref PubMed Scopus (456) Google Scholar). However, there appears to be functional redundancy among ppGalNAcT members because mice in which isoforms 4, 5, or 13 are ablated do not present with any obvious phenotype (9Ten Hagen K.G. Fritz T.A. Tabak L.A. Glycobiology. 2003; 13: 1-16Crossref PubMed Scopus (405) Google Scholar, 10Hennet T. Hagen F.K. Tabak L.A. Marth J.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12070-12074Crossref PubMed Scopus (225) Google Scholar, 11Zhang Y. Iwasaki H. Wang H. Kudo T. Kalka T.B. Hennet T. Kubota T. Cheng L. Inaba N. Gotoh M. Togayachi A. Guo J. Hisatomi H. Nakajima K. Nishihara S. Nakamura M. Marth J.D. Narimatsu H. J. Biol. Chem. 2003; 278: 573-584Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar), whereas mice in which ppGalNAcT-1 has been ablated are viable but show lymph node B-cell retention deficits (12Tenno M. Ohtsubo K. Hagen F. Tabak L.A. Marth J.D. Glycobiology. 2005; 15: 1238-1239Google Scholar).The primary structure of ppGalNAcTs is similar to other type II Golgi membrane glycosyltransferases, but the ppGalNAcTs are unique among glycosyltransferases in possessing a C-terminal, ricin-type lectin domain of ≈130 residues containing three putative carbohydrate-binding sites (13Hazes B. Protein Sci. 1996; 5: 1490-1501Crossref PubMed Scopus (179) Google Scholar). Biochemical analyses suggest that this domain functions in the transfer of GalNAc to glycopeptide but not peptide substrates (14Tenno M. Saeki A. Kezdy F.J. Elhammer A.P. Kurosaka A. J. Biol. Chem. 2002; 277: 47088-47096Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 15Hassan H. Reis C.A. Bennett E.P. Mirgorodskaya E. Roepstorff P. Hollingsworth M.A. Burchell J. Taylor-Papadimitriou J. Clausen H. J. Biol. Chem. 2000; 275: 38197-38205Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). We recently reported the first x-ray crystal structure of a ppGalNAcT, murine ppGalNAcT-1 (mT1). The structure revealed that the catalytic and lectin domains are closely associated, sharing ≈645 Å2/domain of interaction surface area. The structure also provided a molecular understanding for the conservation of many of the residues of the ppGalNAcTs. The mT1 crystal structure contained a bound manganese ion essential for activity but did not contain either the donor UDP-GalNAc or an acceptor substrate. To determine the molecular details of substrate binding, we have now solved the x-ray crystal structures of human ppGalNAcT-2 (hT2) bound to both UDP and to UDP and an acceptor peptide substrate EA2 (PTTDSTTPAPTTK). These structures suggest that the association of ppGalNAcTs catalytic and lectin domains can be dynamic and also reveal the molecular basis of substrate recognition by the ppGalNAcTs.EXPERIMENTAL PROCEDURESThe annealed primers 5′-AATTCGATGCGCATCATCATCATCATCATGAAAACTTGTACTTTCAATCTGA and 5′-CGCGTCAGATTGAAAGTACAAGTTTTCATGATGATGATGATGATGCGCATC encoding 6 histidine residues followed by a tobacco etch virus (TEV) protease cleavage site were cloned into the EcoRI/MluI sites of the plasmid pKN55 (16Fritz T.A. Hurley J.H. Trinh L.B. Shiloach J. Tabak L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 15307-15312Crossref PubMed Scopus (123) Google Scholar) to create the plasmid pKN55-N6His-TEV. Residues 75–571 of hT2 encoding a portion of the stem region and the entire catalytic and lectin domains were PCR-amplified from RNA isolated from HL-60 cells (ATCC) using a NucleoSpin (BD Biosciences) kit. PCR amplification was done using a Superscript III one-step reverse transcription-PCR kit (Stratagene) and the primers 5′-ACCACGGCTTGAAAGTACGGTGGCCAGACTTT and 5′-ACCACCGGTCTACTGCTGCAGGTTGAGCGTGAA. The PCR product was cloned between the MluI/AgeI sites of pKN55-N6His-TEV. The catalytic domain of hT2 (residues 75–440) was PCR-amplified using the primers 5′-ACCACGGCTTGAAAGTACGGTGGCCAGACTTT and 5′-ACCACCGGTCTATGGAACCCTTAACTCTGGATAGAC and cloned between the MluI/AgeI sites of pKN55-N6His-TEV. The plasmids were linearized and electroporated into Pichia pastoris strain SMD1168 to create stable transformants as previously described (16Fritz T.A. Hurley J.H. Trinh L.B. Shiloach J. Tabak L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 15307-15312Crossref PubMed Scopus (123) Google Scholar).Pichia transformants were grown at 30 °C in rich medium (2% peptone, 1% yeast extract, 1% casamino acids, 1% yeast nitrogen base, 1% glycerol) to an A600 = 2–4. The cells were centrifuged, resuspended in 1/10 the volume of the same medium in which 2% methanol was substituted for glycerol, and induced for 16 h at 20 °C. The cells were removed by centrifugation, and the supernatant was adjusted to 10 mm β-mercaptoethanol (β-ME) and 5 mm EDTA. The supernatant was concentrated and diafiltered ≈4000-fold against 20 mm NaPO4 (pH 7.5–8) and 0.1–0.2 m NaCl (diafiltration buffer) using a Millipore tangential flow membrane with a 10-kDa molecular mass cut-off. The sample was concentrated and applied to a 5-ml HiTrap chelate column (GE Biosciences) and eluted using a 5-column volume gradient of 0–500 mm imidazole in diafiltration buffer. For some purifications, the column was washed with diafiltration buffer containing 25 mm imidazole and eluted with a linear gradient of 25–500 mm imidazole in diafiltration buffer. The product fractions were pooled and incubated with an equimolar amount of TEV protease at 4 °C overnight in 50 mm NaPO4 (pH 8), 25 mm imidazole, 0.2 m NaCl, and 10 mm β-ME (cleavage buffer). The sample was centrifuged and passed over a nickel-nitrilotriacetic acid resin (New England Biolabs) in cleavage buffer to remove the six-histidine peptide and TEV protease, and hT2 was dialyzed against 2 mm Tris (pH 8), 0.5 mm EDTA, and 10 mm β-ME at 4 °C.Crystals were grown by hanging drop vapor diffusion at room temperature. Ternary complex (hT2-UDP-EA2-Mn2+) crystal growth was initiated by mixing 0.5–1 μl of protein solution containing 5.8 mg/ml hT2, 2 mm Tris (pH 8.0), 0.5 mm EDTA, 10 mm β-ME, 10 mm UDP, 10 mm MnCl2,and5mm EA2 with an equal volume of precipitant solution containing 23–25% polyethylene glycol 1000, 100 mm Hepes (pH 7.0). Binary complex (hT2-UDP-Mn2+) crystal growth was initiated by mixing 0.5–1 μl of protein solution containing 5.8 mg/ml hT2, 2 mm Tris (pH 8.0), 0.5 mm EDTA, 10 mm β-ME, 10 mm UDP, 10 mm MnCl2, and 5 mm EA2 with an equal volume of precipitant solution containing 7–10% polyethylene glycol 6000, 100 mm Hepes (pH 7.0). Although EA2 was included in the crystallization solution, no electron density for the peptide was observed in the crystal structure. The crystals were grown over 0.3 ml of precipitant solution in 48-well plates, appeared in 3–4 days, and were transferred briefly (30–60 s) to a mother liqueur solution lacking protein but containing 10% glycerol before flash cooling in a 95–100 K N2 stream or liquid propane.Diffraction intensities from single binary complex crystals were collected using 1.0° oscillations on an in-house Raxis-IV detector and a rotating anode generator (Rigaku/MSC) or at SER-CAT beamline 22ID at the Advanced Photon Source. Diffraction intensities from single ternary complex crystals were collected using 0.5° oscillations on the in-house Raxis-IV detector. Intensities from 560 (ternary complex in-house) or 110 (binary complex Advanced Photon Source) or 90 (binary complex in-house) frames were integrated and scaled using the programs DENZO/SCALEPACK (17Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref Scopus (38355) Google Scholar). The hT2 binary complex crystal structure was solved by molecular replacement using the program Phaser (18Storoni L.C. McCoy A.J. Read R.J. Acta Crystallogr. Sect. D Biol. Crystallogr. 2004; 60: 432-438Crossref PubMed Scopus (1090) Google Scholar) and a search model prepared from separate catalytic (residues 95–427) and lectin (residues 428–548) domains of the mT1 crystal structure (Protein Data Bank code 1XHB) in which nonconserved residues were changed to alanine. Model building was done using XtalView (19McRee D.E. J. Struct. Biol. 1999; 125: 156-165Crossref PubMed Scopus (2019) Google Scholar). A partial model (74% complete) of the hT2 binary complex was built and refined against a 3.2 Å data set using several rounds of torsional simulated annealing in CNS (20Brünger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D Biol. Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16929) Google Scholar) before changing to a higher resolution (2.75 Å) data set. The two noncrystallographic symmetry-related monomers of the hT2 binary complex were kept identical until the final rounds of energy minimization and B-factor refinement. The hT2 ternary complex structure was solved by molecular replacement using the program Phaser and a search model of separate catalytic and lectin domains of the hT2 binary complex structure without UDP. Domain contact areas were calculated, and Figs. 1, 2, 3 were created using the program CCP4MG (21Collaborative Computation Project N. Acta Crystallogr. Sect. D Biol. Crystallogr. 1994; 50: 760-763Crossref PubMed Scopus (19703) Google Scholar). Protein sequence alignments were created using ClustalX (22Chenna R. Sugawara H. Koike T. Lopez R. Gibson T.J. Higgins D.G. Thompson J.D. Nucleic Acids Res. 2003; 31: 3497-3500Crossref PubMed Scopus (4013) Google Scholar) and edited using Seaview (23Galtier N. Gouy M. Gautier C. Comput. Appl. Biosci. 1996; 12: 543-548PubMed Google Scholar). The structures were aligned using LSQMAN (24Kleywegt G.J. Acta Crystallogr. Sect. D Biol. Crystallogr. 1999; 55: 1878-1884Crossref PubMed Scopus (133) Google Scholar) and optimized using the “improve” option. Fig. 4 was created using PyMol.FIGURE 2Binding of UDP in the binary (A) and ternary (B) complexes. The main chain of residues of the flexible loop (Arg362–Ser373) is shown by the yellow ribbon, whereas the gray ribbon represents the main chain residues that have unwound from an adjacent α-helix (orange). Hydrogen bonds are shown by the blue dashed lines. The side chains of residues Thr6 and Thr7 of EA2 are shown in green in B. Simulated annealing omit electron density maps (salmon mesh) surrounding UDP and the Mn2+ ion were calculated with ligands omitted and are shown contoured at 2.5 σ.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Hydrogen bonds and hydrophobic interactions mediating binding between hT2 and EA2. EA2 is shown as a stylized drawing with yellow carbon atoms, and the individual residues Ser5–Lys13 are labeled in red. Hydrogen bonds are shown by the blue dashed lines along with their corresponding lengths in Ångstroms. Hydrophobic interactions are shown by the red “eyelashes.” Water molecules are shown as red spheres. The diagram was created by editing the output from the program Ligplot (47Wallace A.C. Laskowski R.A. Thornton J.M. Protein Eng. 1995; 8: 127-134Crossref PubMed Scopus (4250) Google Scholar).View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4Stereo view of EA2 binding to hT2. The transparent surface of hT2 is colored cyan, except for the surface of flexible loop residues Arg362–Ser372, which is colored yellow. A ribbon diagram of residues Arg362–Ser373 is shown in yellow. EA2 is shown with white carbons, and individual residues are indicated by white letter/number combinations. The side chains of hT2 residues interacting with EA2 are indicated by the black letter/number combinations. The five water molecules in the putative GalNAc binding pocket are shown as red spheres, only two of which are indicated for purposes of clarity. Two additional water molecules bound to shallow pockets in the EA2 cleft are also shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Glycopeptides were synthesized by Anaspec, and enzyme activity was measured as previously described (25Hagen F.K. Ten Hagen K.G. Beres T.M. Balys M.M. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1997; 272: 13843-13848Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). The reactions were initiated by adding 0.05 pmol of enzyme, and incubation times were such that not more than 10% of the limiting substrate was converted to product. EA2 and Muc5Ac-3,13 were varied from 46.8 μm to 3 mm with UDP-Gal-NAc at 157.3 μm (0.06 μCi/mmol). Muc5Ac and Muc5Ac-3 were varied from 3 μm to 200 μm, and Muc5Ac-13 was between 7.8 μm and 1.0 mm with UDP-GalNAc at 165 μm (0.12 μCi/mmol). For UDP-GalNAc Km determinations, concentrations were varied from 10.4 μm to 207.3 μm with Muc5Ac at 300 μm. Pseudo first order kinetic constants were determined by nonlinear regression fitting to the Michaelis-Menten equation using the program GraphPad, and the initial velocities were determined from duplicate measurements.RESULTSOverall Protein Fold—Binary complex crystals (hT2-UDP-Mn2+) contained two molecules in the asymmetric unit, and electron density was observed for all residues except Thr90–Asn102/Lys103, Ala476, Gly477, and Gln571. Because the monomers are structurally similar (root mean square deviation = 0.39 Å) and each contains UDP and Mn2+, only details for the A monomer are described. Ternary complex crystals (hT2-UDP-EA2-Mn2+) contained a single monomer in the asymmetric unit, and electron density was observed for all residues except Leu569–Gln571. Phi/psi angles of three residues in each complex (Lys192A, Lys323A and Lys323B for the binary complex and Lys323, Val330, and Met493 for the ternary complex) were in disallowed regions of the Ramachandran plot, but because electron density for each residue was well defined, these angles were unchanged. The crystallographic data are shown in Table 1.TABLE 1Crystallographic data and refinement statisticshT2-UDPhT2-UDP-EA2Data collectionSpace groupP41212P61Unit cell (Å)aStatistics shown in parentheses are for the highest resolution shella = b = 153.23 c = 110.14a = b = 69.34 c = 169.12Resolution (Å)2.75 (2.92–2.75)1.64 (1.74–1.64)Unique reflections34265 (5192)55904 (8825)Completeness (%)98.8 (96.1)99.4 (99.5)Rmerge (%)bRmerge = Σ|I(k) – 〈I(k) 〉|/ΣI(k)11.3 (67.5)5.5 (28.4)Molecules/asymmetric unit21Refinement statisticsResolution range49.1–2.7524.5–1.64R (%)cR = Σ|Fobs – kFcalc|/Σ|Fobs|22.517.8Rfree (%)dRfree is the R value calculated for a randomly selected 5% of the data not used for refinement28.320.6Root mean square deviationsBond length (Å)0.0080.004Bond angle (°)1.41.3Average B factor (Å2)42.617.9No. of protein atoms77203959No. of solvent atoms0495a Statistics shown in parentheses are for the highest resolution shellb Rmerge = Σ|I(k) – 〈I(k) 〉|/ΣI(k)c R = Σ|Fobs – kFcalc|/Σ|Fobs|d Rfree is the R value calculated for a randomly selected 5% of the data not used for refinement Open table in a new tab The catalytic domains of mT1 and hT2 are structurally similar (Fig. 1). The average root mean square deviation between corresponding Cα carbons of the catalytic domains varies from 0.94 (hT2 binary/ternary complexes) to 1.13 Å (hT2 binary complex/mT1). Electron density for an additional 39 (ternary complex) or 42 (binary complex) residues compared with the mT1 structure was observed at the N termini of the hT2 structures. These amino acids form two short helices connected by a random coil (Fig. 1). Electron density for all residues of the random coil (Gly88–Asn105) is observed in the ternary complex but is absent for residues Thr90–Asn102/Lys103 of the binary complex. In the hT2-UDP-EA2 complex, this random coil is stabilized by a hydrogen bond from the main chain oxygen atom of Asn102 to the side chain of Arg362. The association of these helices and the random coil with the remainder of the catalytic domain is further stabilized primarily through association with an adjacent α-helix (Arg149–Lys162). These interactions include hydrogen bonds between the side chain of highly conserved Ser109 and the side chains of residues Ser150 (highly conserved) and invariant Arg154. A stretch of amino acids (Arg347–Thr358) could not be built for mT1 because of a lack of electron density (16Fritz T.A. Hurley J.H. Trinh L.B. Shiloach J. Tabak L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 15307-15312Crossref PubMed Scopus (123) Google Scholar). However, electron density for all of the corresponding hT2 residues (Arg362–Ser373) was seen in both binary and ternary hT2 complexes but differs greatly (Fig. 1). Several amino acids within this flexible loop mediate UDP binding as discussed below.As expected from the mT1 structure, the lectin domain of each of the hT2 structures forms a β-trefoil fold, but the orientation of this domain relative to the catalytic domain in the two hT2 structures differs from that of mT1 and from each other (Fig. 1). The catalytic and lectin domains of mT1 form a close association in which ≈645 Å2 of each domain is buried. This interaction is substantially reduced to ≈325 Å2/domain in the hT2 binary complex and the two domains of the hT2 ternary complex do not associate except for the amino acids connecting them. In fact, residues Gln443–Ala446, which form the first strand of a β-sheet in the lectin domain of the hT2-UDP complex, unfold from this sheet in the hT2-UDP-EA2 structure and extend the peptide tether linking the catalytic and lectin domains.UDP Binding—The binding of UDP differs dramatically between the binary and ternary complexes (Fig. 2). Compared with the ternary complex, UDP is inverted in the binary complex with the ribose group shifted out of its ternary complex pocket to face bulk solvent. Indeed, UDP is a product of the reaction catalyzed by hT2, and its observed conformation in the binary complex is consistent with UDP leaving the active site following catalysis. Residues Arg362–Ser373 of a flexible loop fold out of the way to accommodate this orientation, and the C terminus of the loop is lengthened beyond Ser373 by several amino acids (Gly374–Ala378) that unwind from an adjacent α-helix (Fig. 2A). Residues within the loop move by as much as 25.7 Å in the ternary complex to position Arg362,His365, and Tyr367 to interaction with UDP. Two residues (Val330 and Trp331) of a shorter mobile loop also move in to complete the seal over UDP. Similar conformational changes occurring in corresponding loops of other glycosyltransferases have been described (26Qasba P.K. Ramakrishnan B. Boeggeman E. Trends Biochem. Sci. 2005; 30: 53-62Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar). The ribose 2′ hydroxyl hydrogen bonds to Arg362 and invariant Glu147 via a water molecule, and the ribose 3′ hydroxyl forms a direct hydrogen bond to Ser225 (the X of the DXH motif). The 3′ hydroxyl is also positioned within hydrogen bonding distance of the peptide oxygen of Thr143 and the amide nitrogen of Ser225, which could assume hydrogen bonding duties in ppGalNAcT isoforms in which this serine is replaced by alanine (Table 2). In contrast, there is no obvious substitute for the loss of the hydrogen bond between Thr143 and the O2 of the uridine ring in isoforms in which this threonine is replaced by the hydrophobic residues valine, isoleucine, alanine, or proline (Table 2).TABLE 2The UDP-binding residues of active ppGalNAcT isoforms are highly conserved Residues (hT2 numbering) were chosen based on the hT2-UDP-EA2 complex. Those with a gray background show a greater than 50% identity for that position. Isoforms include human, mouse, and/or rat (designated with a capital T followed by a single number), Drosophila (pGANT), C. elegans (Gly), and Toxoplasma gondii (Tg). Open table in a new tab Despite the large differences in the loop residue positions and UDP orientation, the conformation of several residues that hydrogen bond to the uridine ring and the phosphate moieties of UDP is substantially unaltered between the binary and ternary complexes (Fig. 2). These residues include Thr143, Asp176, and Arg201, which bind the uridine ring, and Asp224 and His226 of the DXH motif and His359, which bind the phosphate groups via coordination with the Mn2+ ion. Several residues of mT1 corresponding to those of hT2 mediating UDP binding have been mutated, and the activity of enzymes carrying these mutations have been described (27Hagen F.K. Hazes B. Raffo R. deSa D. Tabak L.A. J. Biol. Chem. 1999; 274: 6797-6803Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Adjacent to UDP is a cavity occupied by five water molecules (see Fig. 4) presumed to be the GalNAc-binding pocket based upon similarly located pockets shown to be the sites of sugar binding for other retaining glycosyltransferases (28Boix E. Zhang Y. Swaminathan G.J. Brew K. Acharya K.R. J. Biol. Chem. 2002; 277: 28310-28318Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 29Persson K. Ly H.D. Dieckelmann M. Wakarchuk W.W. Withers S.G. Strynadka N.C. Nat. Struct. Biol. 2001; 8: 166-175Crossref PubMed Scopus (311) Google Scholar, 30Pedersen L.C. Dong J. Taniguchi F. Kitagawa H. Krahn J.M. Pedersen L.G. Sugahara K. Negishi M. J. Biol. Chem. 2003; 278: 14420-14428Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). This pocket is lined by invariant (Arg208 and Glu334) and highly conserved (Trp331 and Asn335) residues.EA2 Binding—A schematic diagram of EA2 binding indicating the hydrogen bonds and hydrophobic interactions it forms with hT2 is shown in Fig. 3. Electron density for the first 4 residues of EA2 was absent so only residues Ser5–Lys13 are shown. EA2 binds in an extended conformation with each amino acid except Lys13, assuming phi/psi angles favored by β-strands. The binding of acceptor substrates in an extended conformation was previously hypothesized based upon secondary structure predictions of residues flanking potential glycosylation sites (31Elhammer A.P. Poorman R.A. Brown E. Maggiora L.L. Hoogerheide J.G. Kezdy F.J. J. Biol. Chem. 1993; 268: 10029-10038Abstract Full Text PDF PubMed Google Scholar). The side chain hydroxyl of Thr7, shown to be the preferred residue of initial glycosylation of EA2 by hT2 and several other isoforms (32Pratt M.R. Hang H.C. Ten Hagen K.G. Rarick J. Gerken T.A. Tabak L.A. Bertozzi C.R. Chem. Biol. 2004; 11: 1009-1016Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar), forms a strong hydrogen bond with a β-phosphate oxygen of UDP and is ideally located to be the GalNAc acceptor. Analysis of EA2 binding shows that the majority of hydrogen bonds between hT2 and EA2 occur between EA2 residues Ser5–Pro8, whereas hydrophobic interactions dominate the binding of residues Ala9–Lys13.EA2 binds in a shallow cleft on the surface of hT2 that broadens toward the C-terminal end of EA2 and narrows toward the N terminus of EA2 (Fig. 4). Residues Pro8–Lys13 of EA2 bin" @default.
• W1992607565 created "2016-06-24" @default.
• W1992607565 creator A5010180903 @default.
• W1992607565 creator A5050961039 @default.
• W1992607565 creator A5081388054 @default.
• W1992607565 date "2006-03-01" @default.
• W1992607565 modified "2023-10-07" @default.
• W1992607565 title "Dynamic Association between the Catalytic and Lectin Domains of Human UDP-GalNAc:Polypeptide α-N-Acetylgalactosaminyltransferase-2" @default.
• W1992607565 cites W1494626566 @default.
• W1992607565 cites W1539796472 @default.
• W1992607565 cites W1541406481 @default.
• W1992607565 cites W1578270753 @default.
• W1992607565 cites W1862479421 @default.
• W1992607565 cites W1870828328 @default.
• W1992607565 cites W1963819227 @default.
• W1992607565 cites W1968960032 @default.
• W1992607565 cites W1970677182 @default.
• W1992607565 cites W1973050454 @default.
• W1992607565 cites W1995017064 @default.
• W1992607565 cites W1997263031 @default.
• W1992607565 cites W2001641653 @default.
• W1992607565 cites W2003610628 @default.
• W1992607565 cites W2010473234 @default.
• W1992607565 cites W2011530175 @default.
• W1992607565 cites W2012675371 @default.
• W1992607565 cites W2016765195 @default.
• W1992607565 cites W2017020122 @default.
• W1992607565 cites W2023045668 @default.
• W1992607565 cites W2023627112 @default.
• W1992607565 cites W2029711985 @default.
• W1992607565 cites W2039358798 @default.
• W1992607565 cites W2059720930 @default.
• W1992607565 cites W2060529002 @default.
• W1992607565 cites W2061373561 @default.
• W1992607565 cites W2067027025 @default.
• W1992607565 cites W2079641631 @default.
• W1992607565 cites W2081912151 @default.
• W1992607565 cites W2082715212 @default.
• W1992607565 cites W2089645418 @default.
• W1992607565 cites W2090094301 @default.
• W1992607565 cites W2095724872 @default.
• W1992607565 cites W2103744743 @default.
• W1992607565 cites W2111128608 @default.
• W1992607565 cites W2135839939 @default.
• W1992607565 cites W2136133297 @default.
• W1992607565 cites W2138605813 @default.
• W1992607565 cites W2144099185 @default.
• W1992607565 cites W2145248579 @default.
• W1992607565 cites W2145573106 @default.
• W1992607565 cites W2159384610 @default.
• W1992607565 cites W2159542619 @default.
• W1992607565 cites W2166720212 @default.
• W1992607565 cites W2313841426 @default.
• W1992607565 cites W4250362717 @default.
• W1992607565 doi "https://doi.org/10.1074/jbc.m513590200" @default.
• W1992607565 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16434399" @default.
• W1992607565 hasPublicationYear "2006" @default.
• W1992607565 type Work @default.
• W1992607565 sameAs 1992607565 @default.
• W1992607565 citedByCount "140" @default.
• W1992607565 countsByYear W19926075652012 @default.
• W1992607565 countsByYear W19926075652013 @default.
• W1992607565 countsByYear W19926075652014 @default.
• W1992607565 countsByYear W19926075652015 @default.
• W1992607565 countsByYear W19926075652016 @default.
• W1992607565 countsByYear W19926075652017 @default.
• W1992607565 countsByYear W19926075652018 @default.
• W1992607565 countsByYear W19926075652019 @default.
• W1992607565 countsByYear W19926075652020 @default.
• W1992607565 countsByYear W19926075652021 @default.
• W1992607565 countsByYear W19926075652022 @default.
• W1992607565 countsByYear W19926075652023 @default.
• W1992607565 crossrefType "journal-article" @default.
• W1992607565 hasAuthorship W1992607565A5010180903 @default.
• W1992607565 hasAuthorship W1992607565A5050961039 @default.
• W1992607565 hasAuthorship W1992607565A5081388054 @default.
• W1992607565 hasBestOaLocation W19926075651 @default.
• W1992607565 hasConcept C161790260 @default.
• W1992607565 hasConcept C185592680 @default.
• W1992607565 hasConcept C2780758401 @default.
• W1992607565 hasConcept C55493867 @default.
• W1992607565 hasConceptScore W1992607565C161790260 @default.
• W1992607565 hasConceptScore W1992607565C185592680 @default.
• W1992607565 hasConceptScore W1992607565C2780758401 @default.
• W1992607565 hasConceptScore W1992607565C55493867 @default.
• W1992607565 hasIssue "13" @default.
• W1992607565 hasLocation W19926075651 @default.
• W1992607565 hasOpenAccess W1992607565 @default.
• W1992607565 hasPrimaryLocation W19926075651 @default.
• W1992607565 hasRelatedWork W1531601525 @default.
• W1992607565 hasRelatedWork W2319480705 @default.
• W1992607565 hasRelatedWork W2384464875 @default.
• W1992607565 hasRelatedWork W2398689458 @default.
• W1992607565 hasRelatedWork W2606230654 @default.
• W1992607565 hasRelatedWork W2607424097 @default.
• W1992607565 hasRelatedWork W2748952813 @default.
• W1992607565 hasRelatedWork W2899084033 @default.
• W1992607565 hasRelatedWork W2948807893 @default.

• next