FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992668049> ?p ?o ?g. }

• W1992668049 endingPage "24030" @default.
• W1992668049 startingPage "24023" @default.
• W1992668049 abstract "In humans, mutations in SOX9 result in a skeletal malformation syndrome, campomelic dysplasia (CD). The present study investigated two major classes of CD mutations: 1) point mutations in the high mobility group (HMG) domain and 2) truncations and frameshifts that alter the C terminus of the protein. We analyzed the effect of one novel mutation and three other point mutations in the HMG domain of SOX9 on the DNA binding and DNA bending properties of the protein. The F12L mutant HMG domain shows negligible DNA binding, the H65Y mutant shows minimal DNA binding, whereas the A19V mutant shows near wild type DNA binding and bends DNA normally. Interestingly, the P70R mutant has altered DNA binding specificity, but also bends DNA normally. The effects of the point mutations were interpreted using a molecular model of the SOX9 HMG domain. We analyzed the effects upon transcription of mutations resembling the truncation and frameshift mutations in CD patients, and found that progressive deletion of the C terminus causes progressive loss of transactivation. Maximal transactivation by SOX9 requires both the C-terminal domain rich in proline, glutamine, and serine and the adjacent domain composed entirely of proline, glutamine, and alanine. Thus, CD arises by mutations that interfere with DNA binding by SOX9 or truncate the C-terminal transactivation domain and thereby impede the ability of SOX9 to activate target genes during organ development. In humans, mutations in SOX9 result in a skeletal malformation syndrome, campomelic dysplasia (CD). The present study investigated two major classes of CD mutations: 1) point mutations in the high mobility group (HMG) domain and 2) truncations and frameshifts that alter the C terminus of the protein. We analyzed the effect of one novel mutation and three other point mutations in the HMG domain of SOX9 on the DNA binding and DNA bending properties of the protein. The F12L mutant HMG domain shows negligible DNA binding, the H65Y mutant shows minimal DNA binding, whereas the A19V mutant shows near wild type DNA binding and bends DNA normally. Interestingly, the P70R mutant has altered DNA binding specificity, but also bends DNA normally. The effects of the point mutations were interpreted using a molecular model of the SOX9 HMG domain. We analyzed the effects upon transcription of mutations resembling the truncation and frameshift mutations in CD patients, and found that progressive deletion of the C terminus causes progressive loss of transactivation. Maximal transactivation by SOX9 requires both the C-terminal domain rich in proline, glutamine, and serine and the adjacent domain composed entirely of proline, glutamine, and alanine. Thus, CD arises by mutations that interfere with DNA binding by SOX9 or truncate the C-terminal transactivation domain and thereby impede the ability of SOX9 to activate target genes during organ development. campomelic dysplasia chloramphenicol acetyltransferase electrophoretic mobility shift assay high mobility group isopropyl-1-thio-β-d-galactopyranoside polyacrylamide gel electrophoresis polymerase chain reaction single strand conformation polymorphism In humans, mutations in SOX9 cause campomelic dysplasia (CD),1 a skeletal malformation syndrome that is often associated with XY sex reversal (1Foster J.W. Dominguez Steglich M.A. Guioli S. Kwok G. Weller P.A. Stevanovic M. Weissenbach J. Mansour S. Young I.D. Goodfellow P.N. Brook J.D. Schafer A.J. Nature. 1994; 372: 525-530Crossref PubMed Scopus (1333) Google Scholar). Other tissues affected include kidney, heart, and brain, consistent with the expression pattern of Sox9 in developing mouse (2Ng L.J. Wheatley S. Muscat G.E. Conway Campbell J. Bowles J. Wright E. Bell D.M. Tam P.P. Cheah K.S. Koopman P. Dev. Biol. 1997; 183: 108-121Crossref PubMed Scopus (568) Google Scholar,3Zhao Q. Eberspaecher H. Lefebvre V. de Crombrugghe B. Dev. Dyn. 1997; 209: 377-386Crossref PubMed Scopus (441) Google Scholar). There are four major classes of mutations causing CD: 1) amino acid substitutions in the HMG domain (Fig. 1 A), 2) truncations or frameshifts that alter the C terminus of SOX9 (Fig.1 B), 3) mutations at splice junctions, and 4) chromosomal translocations, of which classes 1 and 2 are investigated here. Most CD patients are heterozygous for wild type and mutant alleles of SOX9. CD appears to result from haploinsufficiency; presumably, a critical dose of SOX9 is required to switch on the appropriate genes during development. The present study reports the identification in a CD patient of a novel amino acid substitution mutation (H65Y) in the HMG domain of SOX9. We report the effects of this and three other point mutations (F12L, A19V, and P70R) on the DNA binding and DNA bending activities of the HMG domain. SOX proteins represent a large class of transcription factors related to SRY, the testis-determining factor, through their HMG domains that bind and bend DNA in a sequence-specific manner. Expression of these proteins in defined cell types at specific stages of development appears to govern cell fate decisions. SOX9 activates expression of type II and type XI collagen in vivo (4Bell D.M. Leung K.K. Wheatley S.C. Ng L.J. Zhou S. Ling K.W. Sham M.H. Koopman P. Tam P.P. Cheah K.S. Nat. Genet. 1997; 16: 174-178Crossref PubMed Scopus (777) Google Scholar, 5Zhou G. Lefebvre V. Zhang Z.P. Eberspaecher H. de Crombrugghe B. J. Biol. Chem. 1998; 273: 14989-14997Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 6Bridgewater L.C. Lefebvre V. de Crombrugghe B. J. Biol. Chem. 1998; 273: 14998-15006Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar), consistent with a role in bone development. SOX proteins fall within a larger group of HMG domain proteins comprising two classes: 1) those that bind DNA without sequence specificity (such as HMG1, HMGD) and 2) those that bind DNA with sequence specificity (including the TCF1/LEF1 and SOX transcription factors). An amino acid sequence alignment of the SOX9 HMG domain with those of SRY and LEF1 is shown in Fig. 2. Although the three-dimensional structure of the SOX9 HMG domain is not known, the solution structures of the HMG domains of SRY (7Werner M.H. Huth J.R. Gronenborn A.M. Clore G.M. Cell. 1995; 81: 705-714Abstract Full Text PDF PubMed Scopus (433) Google Scholar) and LEF1 (8Love J.J. Li X. Case D.A. Giese K. Grosschedl R. Wright P.E. Nature. 1995; 376: 791-795Crossref PubMed Scopus (521) Google Scholar), in complex with DNA, have been determined by NMR. The fold of the two HMG domains is similar. The three α-helices of the each HMG domain come together in an L-shape in which the short arm is formed by helices 1 and 2 and the long arm by helix 3 and the N-terminal strand. The concave surface of the “L” contacts the minor groove of the DNA. We have constructed a model of the SOX9 HMG domain based on the solution structure of the SRY HMG domain and have used the model to make interpretations about the effects of point mutations within the HMG domain, on DNA binding. According to the model, three of the SOX9 point mutations studied here (F12L, H65Y, and P70R) occur in residues that lie on or near the DNA binding surface of the HMG domain, and might therefore be expected to affect DNA binding. The fourth mutation (A19V) affects a residue that is not on the DNA binding surface, but might be important in maintaining the structure of the protein. The determinants of transactivation by SOX9 have not been fully defined. Many of the mutations that result in CD are truncations or frameshifts that alter the C terminus of the protein. We hypothesized that these mutations disrupt the transactivation potential of the protein and we sought to define the limits of the transactivation domain of SOX9 by deletion analysis. At the C terminus of SOX9 lies the PQS-rich domain (Fig. 1 B; residues 386–509), a domain rich in proline, serine, and glutamine, which is required for transcriptional activation (9Sudbeck P. Schmitz M.L. Baeuerle P.A. Scherer G. Nat. Genet. 1996; 13: 230-232Crossref PubMed Scopus (186) Google Scholar). Preceding this is the PQA domain (residues 339–379) that consists entirely of proline, glutamine, and alanine. We have investigated the effect of truncations of the C terminus of SOX9 (similar to C-terminal deletions seen in CD patients) on the transactivation activity of SOX9 and show that both the PQS-rich and PQA domains are required for maximal transcriptional activation. Patient 10 is the third child of consanguineous Pakistani parents (half first cousins). One older brother died of congenital heart disease; an older sister and younger brother are both well. At birth the proband had macrocephaly, micrognathia, depressed nasal bridge, short limbs, curved femora, small patellae, bilateral talipes equinovarus, normal male genitalia, and mild thoracic kyphosis. Tracheomalacia caused severe respiratory distress and necessitated tracheostomy with ventilation from birth. Radiological features included hypoplastic scapulae, widely spaced pubic symphysis, vertical, narrow iliac bones, bowed femora, straight tibiae, long fibulae, increased acetabular angle (hips not dislocated). Cytogenetic studies showed a normal male karyotype. Hospitalization was prolonged in infancy due to respiratory problems. The tracheostomy was eventually removed at 6 years of age but a gastrostomy remains, although the patient takes most food by mouth. At age 10 years, height is minus 6.5 S.D.; there is scoliosis, but limbs are short and largely straight; the patellae are malpositioned; and calf muscles have reduced bulk. The proband walked at age 4 years. He has moderate intellectual retardation and hearing impairment. He is a social and communicative child who reads simple text, but he has limited speech and prefers to use Makaton signs. The proband's father is phenotypically normal and has chromosome mosaicism for a clinically insignificant Y:15 rearrangement that translocates Yq heterochromatin on to 15p. The proband's mother has proportionate short stature, mild kyphoscoliosis, and a normal female karyotype. Before the molecular basis of the proband's campomelic dysplasia was discovered, the mother had a another pregnancy where recurrence of the condition was diagnosed by ultrasound and confirmed by radiographic examination of the fetus at 19 weeks' gestation. The other patients studied here have been reported elsewhere and are summarized in Table I.Table IMissense CD mutations analyzed in this studyPatientMutationKaryotype and genderSurvival timeReference242/87F12L46, XY, MA few days(13van de Wetering M. Oosterwegel M. Dooijes D. Clevers H. EMBO J. 1991; 10: 123-132Crossref PubMed Scopus (454) Google Scholar)2/82A19V46, XX, F12 days(13van de Wetering M. Oosterwegel M. Dooijes D. Clevers H. EMBO J. 1991; 10: 123-132Crossref PubMed Scopus (454) Google Scholar)10H65Y46, XY, MStill alive at 10 yearsThis studyTLP70R46, XY, inv(9) (p11q12), M1 month(26Meyer J. Sudbeck P. Held M. Wagner T. Schmitz M.L. Bricarelli F.D. Eggermont E. Friedrich U. Haas O.A. Kobelt A. Leroy J.G. Van Maldergem L. Michel E. Mitulla B. Pfeiffer R.A. Schinzel A. Schmidt H. Scherer G. Hum. Mol. Genet. 1997; 6: 91-98Crossref PubMed Scopus (165) Google Scholar) Open table in a new tab To screen for the H65Y mutation among the family of patient 10, a portion of the SOX9 open reading frame was amplified from genomic DNA from blood lymphocytes by PCR, using primers F and G, and analyzed by SSCP as described previously (10Kwok C. Weller P.A. Guioli S. Foster J.W. Mansour S. Zuffardi O. Punnett H.H. Dominguez Steglich M.A. Brook J.D. Young I.D. Am. J. Hum. Genet. 1995; 57: 1028-1036PubMed Google Scholar). Paternity and maternity of patient 10 were confirmed by DNA profiling using 12 fluorescently labeled PCR primer pairs that amplify microsatellite markers (heterozygosity >70%) located on human chromosome 8, as described previously (10Kwok C. Weller P.A. Guioli S. Foster J.W. Mansour S. Zuffardi O. Punnett H.H. Dominguez Steglich M.A. Brook J.D. Young I.D. Am. J. Hum. Genet. 1995; 57: 1028-1036PubMed Google Scholar). The parental haplotypes were concordant with those of the proband. DNA sequences encoding mutant SOX9 HMG domains bearing point mutations were produced by PCR, with the mutation incorporated into one of the primers, or by amplification of patient DNA. Forward and reverse primers also bore Nde I and Hin dIII sites, respectively, to allow the PCR products to be inserted between the Nde I and Hin dIII sites in pT7-7. The sequences of all mutants were verified by DNA sequencing. Deletion mutant SOX9(1–485) was produced by digestion of SOX9-pcDNA3 with Ppu MI and Bst XI, removal of single-stranded termini with mung bean nuclease, and religation with T4 DNA ligase. With the aim of producing a series of nested deletion mutants, a Ppu MI and Bst XI double digest of pcDNA3-SOX9 was treated with mung bean nuclease to remove single-stranded termini, and then with exonuclease III. Only mutant SOX9(1–410) was isolated in this manner, and it appears to have resulted fortuitously from exonuclease digestion by mung bean nuclease past the single-stranded overhang, removing 347 nucleotides upstream of the Bst XI site. Other deletion mutants were created by digestion with restriction endonucleases and religation. Mutant SOX9(1–248) was produced by removal of a Apa I restriction fragment from pcDNA3-SOX9. This deletion closely mimics a CD mutation that results from a missense mutation at codon 251. Removal of a Sfi I-EcoRV restriction fragment produced deletion mutant SOX9(1–437), which closely mimics a CD mutation resulting from a missense mutation at codon 440. Mutant SOX9(1–454) was produced by removal of sequences between the most 5′Rsa I site of SOX9 and the Eco RV site in the multiple cloning site of pcDNA3. Mutant SOX9(1–465) was produced by removal of sequences between the most 5′Bst UI site in SOX9 and the same Eco RV site. SOX9(ΔPQA) was produced by removal of a Pml I and Pvu II restriction fragment from SOX9. The plasmids (pT7-7-SOX9 box) were transformed into Escherichia coli BL21 and expression of the SOX9 HMG domain was induced by IPTG and soluble protein extracts prepared (11Smith D.B. Methods Mol. Cell. Biol. 1993; 4: 220-229Google Scholar). The HMG domains were expressed in E. coli at a level of approximately 15–45 mg/liter. The HMG domain used in this study extends from residue Asn101 to Asn184 of full-length SOX9, with the addition of a Met residue at the N terminus. Full-length SOX9 was produced in vitro by coupled transcription and translation of SOX9 (wild type and deletion mutants) in pcDNA3, using a TNT kit (Promega), with incorporation of [35S]methionine. Oligonucleotide probes were synthesized on an Applied Biosystems 394 DNA/RNA synthesizer. The sequences of the upper strands are given below. S9WT sequence is GGGTTAACAG AACAATGG AATCTGGTAGA. The high affinity SOX9 binding site is shown in bold. It comprises the high affinity SOX binding site (SOXCON) flanked by four residues that enhance binding of SOX9 (underlined) (12Mertin S. McDowall S.G. Harley V.R. Nucleic Acids Res. 1999; 27: 1359-1364Crossref PubMed Scopus (183) Google Scholar). SOXCORE sequence is GGGTTAACGC AACAAT CTAATCTGGTAGA. The high affinity SOX binding site is shown in bold. The four flanking residues (underlined) are those that are least preferred for binding of SOX9 in vitro (12Mertin S. McDowall S.G. Harley V.R. Nucleic Acids Res. 1999; 27: 1359-1364Crossref PubMed Scopus (183) Google Scholar). Col2c1 sequence is GGGCCCCTCTCCC ACAATG CCCCCCTGTC; Col2c2 sequence is GGGTCG A GA AAAG CCC CATT CA T GAGAGC. Col2c1 and Col2c2 are SOX-binding sequences from the Col2a1 enhancer that are required for chondrocyte-specific expression.In vivo, SOX proteins appear to tolerate considerable sequence variation in their binding sites. The sites conform loosely to the HMG consensus binding site (A/T)(A/T)CAA(A/T)G. The residues that correspond to this consensus are shown in bold. To prepare probes, complementary oligonucleotides were annealed and radiolabeled by end-filling with Superscript reverse transcriptase in the presence of [α-32P]dCTP and purified on Biogel-P4 spin columns.E. coli cell lysates containing SOX9 HMG domain were mixed with 32P-labeled probe (0.25 nm) in a total volume of 16 μl of binding buffer (13van de Wetering M. Oosterwegel M. Dooijes D. Clevers H. EMBO J. 1991; 10: 123-132Crossref PubMed Scopus (454) Google Scholar) and kept on ice for 15 min before electrophoresis. Protein-DNA complexes were resolved from free DNA on non-denaturing 6% polyacrylamide gels (40:1 (w/w) acrylamide:bisacrylamide) in 0.5× TBE for 3.5 h at 10 V/cm. Prior to sample loading, the gel was prerun for 2 h at 150V. Shifted and free probe were quantitated by PhosphorImager analysis. Pairs of oligonucleotides were annealed to give linkers bearing SOXCON (upper strand: TCGACTGAT AACAAT GCGCTCT; lower strand: CTAGAGAGCGCATTGTTATCAG) or S9WT (upper strand: TCGACTGAT AGAACAATGG GCGCTCT; lower strand: CTAGAGAGCGCCCATTGTTCTATCAG). The binding sites are shown in bold. pBEND2-SOXCON and pBEND2-S9WT were created by insertion of these linkers between the Xba I and Sal I sites of pBEND2 (14Kim J. Zwieb C. Wu C. Adhya S. Gene (Amst.). 1989; 85: 15-23Crossref PubMed Scopus (321) Google Scholar). Seven circularly permuted probes bearing the binding sites were isolated by digestion of these plasmids with Bam HI (A), Rsa I (B), Stu I (C), Eco RV (D), Spe I (E), Nhe I (F), or Eco RI and Sal I (G) and excision of the bands after agarose gel electrophoresis. The probes were then treated with shrimp alkaline phosphatase and labeled with [γ-32P]ATP using T4 polynucleotide kinase. Probes (0.2–0.8 ng) were mixed with extract containing 180 ng of wild type or 600 ng of A19V or P70R mutant SOX9 HMG domain in binding buffer (13van de Wetering M. Oosterwegel M. Dooijes D. Clevers H. EMBO J. 1991; 10: 123-132Crossref PubMed Scopus (454) Google Scholar), in a total volume of 16 μl, and kept for 15 min on ice. Products were resolved by electrophoresis through 6.5% polyacrylamide non-denaturing gels (40:1 (w/w) acrylamide:bisacrylamide) as described above. Bend parameters were calculated as described previously (15Thompson J.F. Landy A. Nucleic Acids Res. 1988; 16: 9687-9705Crossref PubMed Scopus (549) Google Scholar). Homology modeling by Modeller (16Sali A. Blundell T.L. J. Mol. Biol. 1993; 234: 779-815Crossref PubMed Scopus (10636) Google Scholar) was used to generate model structures of SOX9 and the P70R mutant, using the NMR structure of human SRY (PDB code 1HRY; Ref. 7Werner M.H. Huth J.R. Gronenborn A.M. Clore G.M. Cell. 1995; 81: 705-714Abstract Full Text PDF PubMed Scopus (433) Google Scholar) as template. The models were subjected to iterative molecular dynamics refinement using in-built simulated annealing protocols, to improve the structural quality as computed by PROCHECK (17Laskowski R.A. McArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar). GRASP (18Nicholls A. Honig B.J. J. Comput. Chem. 1991; 12: 434-445Crossref Scopus (1171) Google Scholar) was used to map residue contributions to the molecular surface. MOLSCRIPT was used to create the C-α traces. COS-7 cells were cultured as a monolayer in RPMI 1640, supplemented with 1% (v/v) penicillin/streptomycin, 1% l-glutamine, and 10% (v/v) fetal calf serum, at 37 °C under 5% CO2. COS-7 cells were transfected by DEAE-dextran-assisted electroporation (19Gauss G.H. Lieber M.R. Nucleic Acids Res. 1992; 20: 6739-6740Crossref PubMed Scopus (43) Google Scholar). Transactivation by SOX9 was measured in transfection assays, using the reporter plasmid, pS10E1b CAT, in which the CAT gene is under the control of the E1b promoter, downstream of 10 SOX core binding sites (AACAAT). Cells (1 × 106) in log growth phase were transfected with 1 μg of pS10E1b CAT, 26 ng of pcDNA3 or pcDNA3-SOX9 (wild type or deletion mutant), and 20 ng of pCMV-lac, in a volume of 600 μl of RPMI 1640 containing 10 μg/ml DEAE-dextran. Pulse conditions were 960 microfarads and 250 mV using a Gene Pulser apparatus (Bio-Rad). Cells from each transfection were seeded into two flasks after addition of 6 ml of RPMI, and grown for 48 h before being harvested. Protein concentrations, in cell lysates, were determined by Bradford assay. CAT expression was determined by enzyme-linked immunosorbent assay, using a CAT enzyme-linked immunosorbent assay kit (Roche Molecular Biochemicals). To correct for varying transfection efficiencies, β-galactosidase levels were assayed and CAT levels were normalized for β-galactosidase expression. β-Galactosidase expression was assayed using the β-galactosidase enzyme assay system (Promega). In a screen of the SOX9 open reading frame from CD patients (13van de Wetering M. Oosterwegel M. Dooijes D. Clevers H. EMBO J. 1991; 10: 123-132Crossref PubMed Scopus (454) Google Scholar), we identified a novel missense mutation (H65Y; CAC → TAC) in the SOX9 HMG domain from one patient. Curiously, the father of this patient appears phenotypically normal, but carries the H65Y mutation in his blood lymphocytes (and presumably germ cells). In contrast, the mother has a kyphoscoliosis and does not appear to carry the mutation (Fig.3). These findings raised the possibility that the mutation inherited from the father was a rare polymorphism that was not responsible for the CD phenotype and that another mutation, inherited from the mother, was responsible for the CD phenotype. Using SSCP, we screened for the polymorphism in the DNA from 62 phenotypically normal individuals of Pakistani descent, and failed to find another instance of the polymorphism. The wild type and mutant HMG domains were expressed in E. coli upon induction with IPTG. The proteins were soluble and stably expressed as judged by SDS-PAGE (Fig.4). The affinities of wild type and mutant HMG domains for DNA probes S9WT, SOXCORE, and two sequences from the Col2a1 enhancer, Col2c1 and Col2c2, were compared by EMSA (Fig. 5). The probe, S9WT, bears the high affinity SOX9-binding site selected in vitro (AG AACAAT GG). This sequence includes the high affinity binding site defined for other SOX proteins ((A/T)(A/T)CAA(A/T), shown in bold and termed SOXCON here; Ref. 20Harley V.R. Lovell Badge R. Goodfellow P.N. Nucleic Acids Res. 1994; 22: 1500-1501Crossref PubMed Scopus (335) Google Scholar, 21Kanai Y. Kanai Azuma M. Noce T. Saido T.C. Shiroishi T. Hayashi Y. Yazaki K. J. Cell Biol. 1996; 133: 667-681Crossref PubMed Scopus (189) Google Scholar, 22Denny P. Swift S. Connor F. Ashworth A. EMBO J. 1992; 11: 3705-3712Crossref PubMed Scopus (237) Google Scholar), flanked on either end by two residues preferred by SOX9 (12Mertin S. McDowall S.G. Harley V.R. Nucleic Acids Res. 1999; 27: 1359-1364Crossref PubMed Scopus (183) Google Scholar). SOXCORE bears the sequenceGC AACAAT CT, in which the four flanking residues of S9WT are mutated to those selected by SOX9 at lowest frequency in these positions (underlined). The wild type SOX9 HMG domain bound S9WT (relative binding 100%) more strongly than the other probes. Binding of SOXCORE, was about 8-fold lower. These results are consistent with our previous finding that the 5′-AG and 3′-GG in S9WT enhance binding of SOX9 (12Mertin S. McDowall S.G. Harley V.R. Nucleic Acids Res. 1999; 27: 1359-1364Crossref PubMed Scopus (183) Google Scholar). Interestingly, binding of the wild type HMG domain to Col2c1 and Col2c2 was about 5- and 3-fold lower than to S9WT. Note that Col2c1 has a single HMG binding site, which includes the 3′-flanking G in S9WT, whereas Col2c2 has two sites, one of which includes the 3′-flanking G and the other of which includes both 3′-flanking G nucleotides in S9WT. Presumably only one of the two sites on Col2c2 can be occupied at a time, as only a single shifted band is seen, even with high concentrations of SOX9 HMG domain.Figure 5EMSA of mutant and wild type (wt) SOX9 HMG domains binding to probes S9WT and SOXCORE (A); Col2c12 and Col2c2 (B). The positions of free DNA and DNA-HMG domain complex are indicated. Concentrations of mutant and wild type proteins in binding reactions were varied to determine the range over which DNA binding (amount of probe shifted) varied linearly with protein concentration. Where possible, concentrations of protein in binding reactions were within this range. The SOX binding sites in each probe are given, with residues corresponding to S9WT shown in bold. Note that Col2c2 has two binding sites in opposite orientations as indicated by the arrows. “Relative binding” refers to the amount of probe shifted per unit of HMG domain in the reaction, relative to the amount of S9WT probe shifted by the wild type SOX9 HMG domain, which is set at 100. Undetectable binding (−) is equivalent to relative binding <0.01.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Binding of the F12L mutant to any of the four probes was not detectable (relative binding <0.01%), suggesting that Phe12 is essential for DNA binding. The H65Y mutant showed barely detectable binding to S9WT, Col2c1, and Col2c2 (relative binding of 0.07%, 0.01%, and 0.01%, respectively), and undetectable binding to SOXCORE. Thus the H65Y mutation has a drastic effect on sequence-specific DNA binding. Binding of the A19V mutant to each of the four probes was only 3–5-fold lower than wild type, suggesting that Ala19 is not essential for DNA binding and that the A19V mutation does not drastically disrupt the structure of the HMG domain. Interestingly, the P70R mutant showed altered DNA binding specificity compared with the wild type HMG domain. As stated above, binding of the wild type HMG domain to S9WT was about 8-fold higher than to SOXCORE. In comparison, whereas binding of the P70R mutant HMG domain to S9WT was only 7-fold lower than the wild type HMG domain, its binding to SOXCORE was undetectable (<0.01% relative binding). Thus, the four residues in S9WT that flank the core SOX consensus site appear to be essential for binding of the P70R mutant to DNA, whereas they enhance binding of the wild type SOX9 HMG domain only moderately. This suggests that the P70R mutant is missing some of the key contacts that contribute to binding to the core SOX consensus site. Finally, we found binding of the P70R mutant to the Col2c1 and Col2c2 probes to be barely detectable. The presence of at least one of the flanking residues of S9WT in the binding sites on these probes is presumably responsible for the small amount of binding observed. Some point mutations in the HMG domain of SRY in patients with XY gonadal dysgenesis alter the DNA bending properties of the protein (23Pontiggia A. Rimini R. Harley V.R. Goodfellow P.N. Lovell Badge R. Bianchi M.E. EMBO J. 1994; 13: 6115-6124Crossref PubMed Scopus (258) Google Scholar). Therefore, we determined the bend angles induced upon binding of the wild type and mutant HMG domains to S9WT and SOXCON, using a circular permutation assay. The bend angle induced upon binding of the wild type HMG domain to S9WT was 71 ± 0.4°. The A19V and P70R mutants bent this probe similarly (Fig.6 A). The bend angle induced upon binding of the wild type HMG domain to SOXCON was 78 ± 0.6° (Fig. 6 B). This is similar to the angle induced upon binding of the SRY HMG domain to SOXCON (results not shown). The A19V mutant bent the SOXCON probe similarly (Fig. 6 B). Thus, the A19V and P70R mutations do not appear to alter the DNA bending properties of SOX9. To investigate further the function of specific amino acid residues in the SOX9 HMG domain, we built a model of the structure of the HMG domain of SOX9, based on the known solution structure of the HMG domain of SRY in complex with DNA. The SRY and SOX9 HMG domains differ at 39 of the 77 amino acids in the SRY structure. The homology model of the SOX9 HMG domain fits closely to the structure of the SRY HMG domain; 72 of the 77 C-α carbons have been aligned (root mean square deviation = 0.72 Å; Fig.7 A). The DNA binding surfaces of the SRY and SOX9 HMG domains are depicted in Fig. 8 (A and B). Of the four mutated residues of SOX9 studied here, Phe12 (cyan), His65(magenta), and Pro70 (yellow) are located on or near the DNA binding surface in similar positions to the homologous residues in SRY. Ala19 of SOX9 is not part of the DNA binding surface; it faces away from the DNA, into the solvent. In the SOX9 model, as in the SRY structure, the side chain of Phe12 interacts with the base of T12. Pro70lies at the end of helix 3 of both SRY and SOX9 HMG domains and is likely to be important in determining the orientation of the C-terminal tail that includes residues Lys73 (blue) and Tyr74 (green). These residues are thought to be instrumental in DNA binding and bending by SRY, and the present model of the SOX9 HMG domain suggests that their positions on the DNA binding surface are conserved in the SOX9 HMG domain. Inspection of the model of the SOX9 HMG domain allows us to speculate on how the SOX9 mutations studied here affect DNA binding. The F12L mutation affects a key aromatic contact between the HMG domain and the DNA; in the F12L mutant, the Leu12 side chain is unlikely to interact with the bases in the same way that Phe12 does in the wild type HMG domain. In the A19V mutant, the larger hydrophobic side chain of Val19 is likely to be stabilized by interaction with Phe12, Tyr15, and Tyr43. These interactions could alter the interaction of Phe12 with the DNA. His65 of SOX9 lies in a hollow on the DNA binding surface, with most of its side chain accessible to solvent, away from the DNA binding surface. Replacement of thi" @default.
• W1992668049 created "2016-06-24" @default.
• W1992668049 creator A5032248814 @default.
• W1992668049 creator A5037476890 @default.
• W1992668049 creator A5043653516 @default.
• W1992668049 creator A5046399954 @default.
• W1992668049 creator A5046594168 @default.
• W1992668049 creator A5058409750 @default.
• W1992668049 creator A5060536781 @default.
• W1992668049 creator A5080016198 @default.
• W1992668049 date "1999-08-01" @default.
• W1992668049 modified "2023-10-14" @default.
• W1992668049 title "Functional and Structural Studies of Wild Type SOX9 and Mutations Causing Campomelic Dysplasia" @default.
• W1992668049 cites W1521657513 @default.
• W1992668049 cites W184563540 @default.
• W1992668049 cites W1955427151 @default.
• W1992668049 cites W1973295687 @default.
• W1992668049 cites W1973763076 @default.
• W1992668049 cites W1984397663 @default.
• W1992668049 cites W1985736574 @default.
• W1992668049 cites W1986191025 @default.
• W1992668049 cites W1994657636 @default.
• W1992668049 cites W2001857107 @default.
• W1992668049 cites W2011352154 @default.
• W1992668049 cites W2012110945 @default.
• W1992668049 cites W2013246689 @default.
• W1992668049 cites W2016236490 @default.
• W1992668049 cites W2019114462 @default.
• W1992668049 cites W2025404099 @default.
• W1992668049 cites W2033355083 @default.
• W1992668049 cites W2037122000 @default.
• W1992668049 cites W2049157134 @default.
• W1992668049 cites W2065283382 @default.
• W1992668049 cites W2082155787 @default.
• W1992668049 cites W2088120545 @default.
• W1992668049 cites W2098982430 @default.
• W1992668049 cites W2114513729 @default.
• W1992668049 cites W2127116852 @default.
• W1992668049 cites W31788419 @default.
• W1992668049 doi "https://doi.org/10.1074/jbc.274.34.24023" @default.
• W1992668049 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10446171" @default.
• W1992668049 hasPublicationYear "1999" @default.
• W1992668049 type Work @default.
• W1992668049 sameAs 1992668049 @default.
• W1992668049 citedByCount "110" @default.
• W1992668049 countsByYear W19926680492012 @default.
• W1992668049 countsByYear W19926680492013 @default.
• W1992668049 countsByYear W19926680492014 @default.
• W1992668049 countsByYear W19926680492015 @default.
• W1992668049 countsByYear W19926680492016 @default.
• W1992668049 countsByYear W19926680492018 @default.
• W1992668049 countsByYear W19926680492019 @default.
• W1992668049 countsByYear W19926680492020 @default.
• W1992668049 countsByYear W19926680492021 @default.
• W1992668049 countsByYear W19926680492022 @default.
• W1992668049 countsByYear W19926680492023 @default.
• W1992668049 crossrefType "journal-article" @default.
• W1992668049 hasAuthorship W1992668049A5032248814 @default.
• W1992668049 hasAuthorship W1992668049A5037476890 @default.
• W1992668049 hasAuthorship W1992668049A5043653516 @default.
• W1992668049 hasAuthorship W1992668049A5046399954 @default.
• W1992668049 hasAuthorship W1992668049A5046594168 @default.
• W1992668049 hasAuthorship W1992668049A5058409750 @default.
• W1992668049 hasAuthorship W1992668049A5060536781 @default.
• W1992668049 hasAuthorship W1992668049A5080016198 @default.
• W1992668049 hasBestOaLocation W19926680491 @default.
• W1992668049 hasConcept C104317684 @default.
• W1992668049 hasConcept C2778486617 @default.
• W1992668049 hasConcept C501734568 @default.
• W1992668049 hasConcept C54355233 @default.
• W1992668049 hasConcept C86339819 @default.
• W1992668049 hasConcept C86803240 @default.
• W1992668049 hasConceptScore W1992668049C104317684 @default.
• W1992668049 hasConceptScore W1992668049C2778486617 @default.
• W1992668049 hasConceptScore W1992668049C501734568 @default.
• W1992668049 hasConceptScore W1992668049C54355233 @default.
• W1992668049 hasConceptScore W1992668049C86339819 @default.
• W1992668049 hasConceptScore W1992668049C86803240 @default.
• W1992668049 hasIssue "34" @default.
• W1992668049 hasLocation W19926680491 @default.
• W1992668049 hasOpenAccess W1992668049 @default.
• W1992668049 hasPrimaryLocation W19926680491 @default.
• W1992668049 hasRelatedWork W1828691184 @default.
• W1992668049 hasRelatedWork W1903732681 @default.
• W1992668049 hasRelatedWork W1991523530 @default.
• W1992668049 hasRelatedWork W2002128513 @default.
• W1992668049 hasRelatedWork W2020824267 @default.
• W1992668049 hasRelatedWork W2031436818 @default.
• W1992668049 hasRelatedWork W2057739827 @default.
• W1992668049 hasRelatedWork W2075354549 @default.
• W1992668049 hasRelatedWork W2119103177 @default.
• W1992668049 hasRelatedWork W2092874662 @default.
• W1992668049 hasVolume "274" @default.
• W1992668049 isParatext "false" @default.
• W1992668049 isRetracted "false" @default.
• W1992668049 magId "1992668049" @default.
• W1992668049 workType "article" @default.