FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992687906> ?p ?o ?g. }

• W1992687906 endingPage "27803" @default.
• W1992687906 startingPage "27796" @default.
• W1992687906 abstract "We have compared 70-kDa heat shock cognate protein (Hsc70) isolated from bovine brain with recombinant wild type protein and mutant E543K protein (previously studied as wild type in our laboratory). Wild type bovine and recombinant protein differ by posttranslational modification of lysine 561 but interact similarly with a short peptide (fluorescein-labeled FYQLALT) and with denatured staphylococcal nuclease-(Δ135–149). Mutation E543K results in 4.5-fold faster release of peptide and lower stability of complexes with staphylococcal nuclease-(Δ135–149). ATP hydrolysis rates of the wild type proteins are enhanced 6–10-fold by the addition of peptide. The E543K mutant has a peptide-stimulated hydrolytic rate similar to that of wild type protein but a higher unstimulated rate, yielding a mere 2-fold enhancement. All three versions of Hsc70 possess similar ATP-dependent conformational shifts, and all show potassium ion dependence. These data support the following model: (i) in the presence of K+, Mg2+, and ATP, the peptide binding domain inhibits the ATPase; (ii) binding of peptide relieves this inhibition; and (iii) the E543K mutation significantly attenuates the inhibition by the peptide binding domain and destabilizes Hsc70-peptide complexes. We have compared 70-kDa heat shock cognate protein (Hsc70) isolated from bovine brain with recombinant wild type protein and mutant E543K protein (previously studied as wild type in our laboratory). Wild type bovine and recombinant protein differ by posttranslational modification of lysine 561 but interact similarly with a short peptide (fluorescein-labeled FYQLALT) and with denatured staphylococcal nuclease-(Δ135–149). Mutation E543K results in 4.5-fold faster release of peptide and lower stability of complexes with staphylococcal nuclease-(Δ135–149). ATP hydrolysis rates of the wild type proteins are enhanced 6–10-fold by the addition of peptide. The E543K mutant has a peptide-stimulated hydrolytic rate similar to that of wild type protein but a higher unstimulated rate, yielding a mere 2-fold enhancement. All three versions of Hsc70 possess similar ATP-dependent conformational shifts, and all show potassium ion dependence. These data support the following model: (i) in the presence of K+, Mg2+, and ATP, the peptide binding domain inhibits the ATPase; (ii) binding of peptide relieves this inhibition; and (iii) the E543K mutation significantly attenuates the inhibition by the peptide binding domain and destabilizes Hsc70-peptide complexes. The 70-kDa heat shock-related proteins (Hsp70s) 1The abbreviations used are: Hsp70, 70-kDa heat shock-related protein; Hsc70, 70-kDa heat shock cognate protein; rHsc70, recombinant Hsc70; bHsc70, bovine brain Hsc70; MOPS, 4-morpholinepropanesulfonic acid; SNase, staphylococcal nuclease; HPLC, high pressure liquid chromatography; R g, radius of gyration. comprise a family of molecular chaperones that bind and release unstructured, hydrophobic segments of polypeptide in an ATP-dependent manner, thereby presumably suppressing intermolecular aggregation and intramolecular misfolding that might otherwise occur. The binding and release of peptide is regulated by nucleotide; with MgADP bound, Hsp70s form stable, long lived complexes with peptides with half-lives on the order of 103 to 104 s, whereas when MgATP binds, the peptide-Hsp70 complexes become more labile and peptide is released (1Braell W.A. Schlossman D.M. Schmid S.L. Rothman J.E. J. Cell Biol. 1984; 99: 734-741Crossref PubMed Scopus (94) Google Scholar, 2Flynn G.C. Chappell T.G. Rothman J.E. Science. 1989; 245: 385-390Crossref PubMed Scopus (580) Google Scholar, 3Sadis S. Hightower L.E. Biochemistry. 1992; 31: 9406-9412Crossref PubMed Scopus (116) Google Scholar, 4Greene L.E. Zinner R. Naficy S. Eisenberg E. J. Biol. Chem. 1995; 270: 2967-2973Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 5Takeda S. McKay D.B. Biochemistry. 1996; 35: 4636-4644Crossref PubMed Scopus (75) Google Scholar). The coupling between peptide binding/release and the ATPase cycle also manifests itself through peptide-dependent enhancement of the ATPase activity (1Braell W.A. Schlossman D.M. Schmid S.L. Rothman J.E. J. Cell Biol. 1984; 99: 734-741Crossref PubMed Scopus (94) Google Scholar, 2Flynn G.C. Chappell T.G. Rothman J.E. Science. 1989; 245: 385-390Crossref PubMed Scopus (580) Google Scholar, 3Sadis S. Hightower L.E. Biochemistry. 1992; 31: 9406-9412Crossref PubMed Scopus (116) Google Scholar, 4Greene L.E. Zinner R. Naficy S. Eisenberg E. J. Biol. Chem. 1995; 270: 2967-2973Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 5Takeda S. McKay D.B. Biochemistry. 1996; 35: 4636-4644Crossref PubMed Scopus (75) Google Scholar, 6DeLuca-Flaherty C. McKay D.B. Parham P. Hill B.L. Cell. 1990; 62: 875-887Abstract Full Text PDF PubMed Scopus (133) Google Scholar, 7Wang C. Lee M.R. Biochem. J. 1993; 294: 69-77Crossref PubMed Scopus (27) Google Scholar, 8Blond-Elguindi S. Fourie A.M. Sambrook J.F. Gething M.J. J. Biol. Chem. 1993; 268: 12730-12735Abstract Full Text PDF PubMed Google Scholar, 9McCarty J.S. Buchberger A. Reinstein J. Bukau B. J. Mol. Biol. 1995; 249: 126-137Crossref PubMed Scopus (349) Google Scholar, 10Buchberger A. Valencia A. McMacken R. Sander C. Bukau B. EMBO J. 1994; 13: 1687-1695Crossref PubMed Scopus (112) Google Scholar, 11Kamath-Loeb A.S. Lu C.Z. Suh W.C. Lonetto M.A. Gross C.A. J. Biol. Chem. 1995; 270: 30051-30059Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 12Ziegelhoffer T. Lopez-Buesa P. Craig E.A. J. Biol. Chem. 1995; 270: 10412-10419Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). In addition to binding unstructured segments of polypeptide, Hsp70s self-aggregate into dimers and higher order oligomers (13Schmid S.L. Braell W.A. Rothman J.E. J. Biol. Chem. 1985; 260: 10057-10062Abstract Full Text PDF PubMed Google Scholar). Self-aggregation can be reversed by the addition of ATP or the addition of competing peptides and hence is thought to be similar to, and competitive with, the heterologous peptide binding activity of the proteins (8Blond-Elguindi S. Fourie A.M. Sambrook J.F. Gething M.J. J. Biol. Chem. 1993; 268: 12730-12735Abstract Full Text PDF PubMed Google Scholar). In certain contexts, some Hsp70s are posttranslationally modified; phosphorylation of threonine residues (14Freiden P.J. Gaut J.R. Hendershot L.M. EMBO J. 1992; 11: 63-70Crossref PubMed Scopus (152) Google Scholar, 15Gaut J.R. Hendershot L.M. J. Biol. Chem. 1993; 268: 12691-12698Abstract Full Text PDF PubMed Google Scholar, 16Hendershot L.M. Ting J. Lee A.S. Mol. Cell. Biol. 1988; 8: 4250-4256Crossref PubMed Scopus (162) Google Scholar, 17Leustek T. Toledo H. Brot N. Weissbach H. Arch. Biochem. Biophys. 1991; 289: 256-261Crossref PubMed Scopus (38) Google Scholar, 18Leustek T. Amir S.D. Toledo H. Brot N. Weissbach H. Cell. Mol. Biol. 1992; 38: 1-10PubMed Google Scholar, 19Loomis W. Wheeler S. Schmidt J. Mol. Cell. Biol. 1982; 2: 484-489Crossref PubMed Scopus (26) Google Scholar, 20Rieul C. Cortay J.C. Bleicher F. Cozzone A.J. Eur. J. Biochem. 1987; 168: 621-627Crossref PubMed Scopus (20) Google Scholar, 21McCarty J.S. Walker G.C. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9513-9517Crossref PubMed Scopus (177) Google Scholar, 22Panagiotidis C.A. Burkholder W.F. Gaitanaris G.A. Gragerov A. Gottesman M.E. Silverstein S.J. J. Biol. Chem. 1994; 269: 16643-16647Abstract Full Text PDF PubMed Google Scholar, 23Dalie B.L. Skaleris D.A. Kohle K. Weissbach H. Brot N. Biochem. Biophys. Res. Commun. 1990; 166: 1284-1292Crossref PubMed Scopus (12) Google Scholar), ADP-ribosylation (14Freiden P.J. Gaut J.R. Hendershot L.M. EMBO J. 1992; 11: 63-70Crossref PubMed Scopus (152) Google Scholar, 24Carlsson L. Lazarides E. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 4664-4668Crossref PubMed Scopus (81) Google Scholar), and methylation of lysine and arginine (25Wang C. Lin J.M. Lazarides E. Arch. Biochem. Biophys. 1992; 297: 169-175Crossref PubMed Scopus (27) Google Scholar) have been reported; however, the functional significance of these modifications is not known. The activities of Hsp70s reside in (at least) two functional and physically separable domains. The ATPase activity resides in the amino-terminal 380–400 residues (26Chappell T.G. Konforti B.B. Schmid S.L. Rothman J.E. J. Biol. Chem. 1987; 262: 746-751Abstract Full Text PDF PubMed Google Scholar), and the peptide binding activity resides in the carboxyl-terminal part of the molecule (27Gragerov A. Zeng L. Zhao X. Burkholder W. Gottesman M.E. J. Mol. Biol. 1994; 235: 848-854Crossref PubMed Scopus (212) Google Scholar). The structure of an ATPase fragment of bovine Hsc70 complexed with nucleotide has been solved, revealing a two-lobed molecule with nucleotide buried at the base of a deep cleft (28Flaherty K.M. DeLuca-Flaherty C. McKay D.B. Nature. 1990; 346: 623-628Crossref PubMed Scopus (833) Google Scholar). The structure of a peptide binding fragment of the Escherichia coli DnaK protein complexed to peptide has also been solved, revealing a subdomain of eight antiparallel β-strands, which form a peptide binding pocket, and a second, α-helical subdomain, one helix of which lies over the peptide binding pocket (29Zhu X. Zhao X. Burkholder W.F. Gragerov A. Ogata C.M. Gottesman M.E. Hendrickson W.A. Science. 1996; 272: 1606-1614Crossref PubMed Scopus (1064) Google Scholar). The level of amino acid similarity within the Hsp70 protein family (e.g. 47% sequence identity between E. coli DnaK and bovine Hsc70) is such that the tertiary fold and many of the intramolecular interactions seen in a three-dimensional structure of one member of the family can be extrapolated safely to other Hsp70s. Based on their structure of the DnaK peptide binding domain, Hendrickson and co-workers (29Zhu X. Zhao X. Burkholder W.F. Gragerov A. Ogata C.M. Gottesman M.E. Hendrickson W.A. Science. 1996; 272: 1606-1614Crossref PubMed Scopus (1064) Google Scholar) suggested that the helical subdomain acts as a “lid” over the peptide binding pocket and that release of polypeptides would be predicated on displacement of the helix lying over the peptide binding pocket. There are several salt bridges between the “lid” helix and the β-subdomain, suggesting that peptide binding and release is accompanied by formation and breaking of these salt bridges. If this model is correct, then disrupting one or more of these salt bridges should result in greater lability of protein-peptide complexes. In this work, we first characterize the differences between Hsc70 protein isolated from bovine brain and recombinant Hsc70 protein expressed in E. coli. We find that the bovine brain protein has at least one posttranslational modification in the peptide binding domain. Additionally, we find that the recombinant protein used in our earlier experiments differs in sequence at one position from the major fraction of bovine brain protein; residue 543 is glutamic acid in bovine protein and lysine in our original recombinant protein. This residue is expected to participate in one of the salt bridges between the “lid” helix and arginine 469 in the β-subdomain of the peptide binding domain; replacing glutamic acid with lysine would disrupt this salt bridge. We compare the activities (ATPase, peptide binding, and the coupling of the two) in recombinant Hsc70 differing at position 543 (lysine or glutamic acid) and further compare these with the activities of Hsc70 isolated from bovine brain. Comparison of bovine and recombinant protein having the same amino acid sequence allows delineation of the effect of the posttranslational modification on activities we measure, while comparison of recombinant proteins with glutamic acid versus lysine at position 543 allows us to test the model of peptide binding and release proposed by Hendrickson and co-workers (29Zhu X. Zhao X. Burkholder W.F. Gragerov A. Ogata C.M. Gottesman M.E. Hendrickson W.A. Science. 1996; 272: 1606-1614Crossref PubMed Scopus (1064) Google Scholar). A peptide with the sequence FYQLALT (hereafter referred to as “af1”; we thank Dr. Anne Fourie for suggesting the sequence (30Fourie A.M. Sambrook J.F. Gething M.J. J. Biol. Chem. 1994; 269: 30470-30478Abstract Full Text PDF PubMed Google Scholar)) was synthesized, purified, and labeled with fluorescein at the amino terminus using fluorescein isothiocyanate (Molecular Probes, Eugene, OR) as described previously (5Takeda S. McKay D.B. Biochemistry. 1996; 35: 4636-4644Crossref PubMed Scopus (75) Google Scholar). The fluoresceinated peptide is called faf1. ATP and ADP were purchased from Sigma and Boehringer Mannheim; [α-32P]ATP and [γ-32P]ATP were purchased from Amersham Corp. Plasmids for expression of Hsc70 and a 60-kDa truncation of Hsc70 (amino acids 1–554; referred to as the “60-kDa fragment”) with lysine at position 543 in E. coli have been described (31Wilbanks S.M. DeLuca-Flaherty C. McKay D.B. J. Biol. Chem. 1994; 269: 12893-12898Abstract Full Text PDF PubMed Google Scholar, 32Wilbanks S.M. Chen L. Tsuruta H. Hodgson K.O. McKay D.B. Biochemistry. 1995; 34: 12095-12106Crossref PubMed Scopus (92) Google Scholar). In those publications, the proteins are assumed (erroneously) to be wild type, but they are now referred to as mutant recombinant Hsc70 (rHsc70 E543K) and mutant truncation (60-kDa fragment E543K). As summarized below, the discovery of an apparent mutation (E543K) in the original cDNA clone (33DeLuca-Flaherty C. McKay D.B. Nucleic Acids Res. 1990; 18: 5569Crossref PubMed Scopus (35) Google Scholar) made it necessary to construct a wild type coding sequence by oligonucleotide-directed mutagenesis. The Hsc70 coding sequence was excised from the pT7–7 expression construct as anNdeI-SalI fragment and inserted into the polycloning site of pRSETA (Invitrogen), cut with NdeI andXhoI. The resulting plasmid (pRSET-Hsc70-E543K) was used as the starting point for subcloning expression plasmids for wild type rHsc70 and its 60-kDa truncation (both with glutamic acid at position 543). To subclone the full-length wild type coding sequence, a fragment of the cloned Hsc70 E543K sequence was amplified by PCR using one primer complementary to the polylinker region following the stop codon and a second, mutagenic primer spanning codon 543 and the singleEcoRI site a few base pairs 5′ of codon 543. Both pRSET-Hsc70-E543K and the PCR product were digested withEcoRI, and the fragment was inserted into the plasmid, replacing the 3′ ∼330 base pairs of the coding sequence. To subclone the 60-kDa wild type coding sequence, this same region was excised as an EcoRI-HindIII fragment and replaced with a synthetic fragment introducing glutamic acid at codon 543 and a stop codon after codon 554, both underlined in the top strand oligonucleotide, AATTCGCTTGAATCCTACGCCTTCAACATGAAAGCTACTGTTGAGTA (bottom strand oligonucleotide: AGCTTACTCAACAGTAGCTTTCATGTTGAAGGCGTAGGATTCAAGCG). Both subclones were confirmed by sequencing between the EcoRI site and the 3′-polylinker. Recombinant wild type and E543K mutant rHsc70 were expressed in E. coli using the plasmids described above and purified to >95% homogeneity as described previously (32Wilbanks S.M. Chen L. Tsuruta H. Hodgson K.O. McKay D.B. Biochemistry. 1995; 34: 12095-12106Crossref PubMed Scopus (92) Google Scholar) with the following modifications. Cells were lysed by incubation at 4 °C with lysozyme (final concentration of 0.3 mg/ml) in 50 mm Tris (pH 7.5), 200 mm NaCl, 5% glycerol (v/v), 1 mm dithiothreitol, 1 mmphenylmethanesulfonyl fluoride and by subsequent sonication. Cell debris was removed by centrifugation for 1 h at 15,000 ×g. Supernatant was dialyzed extensively against 20 mm MOPS, 4 mmMg(CH3COO)2, and 0.1 mm EDTA, the pH was adjusted to 7.0 with Tris, and the supernatant was loaded onto a Q-Sepharose (Pharmacia Biotech AB, Uppsala, Sweden) column. Recombinant Hsc70 was eluted with a gradient of 0–1 m KCl and dialyzed extensively against 25 mm HEPES (pH 7.0), 75 mmKCl, and 5 mm EDTA. After the addition of Mg(CH3COO)2 to a final concentration of 10 mm, the protein was subsequently purified on ATP-agarose (Sigma) followed by chromatofocusing over Mono-P (Pharmacia). Finally, gel filtration on a Superdex-75 column (Pharmacia) was used to separate monomeric protein from multimers. Final buffer conditions, established on Superdex-75, were 40 mm HEPES, 150 mm KCl, and 4.5 mm MgCl2, adjusted to pH 7.0 with KOH. The 60-kDa fragment of Hsc70 was purified following a similar protocol. Bovine brain Hsc70 (bHsc70) was purified from fresh brains as described (34Braun J. Wilbanks S.M. Scheller R.H. J. Biol. Chem. 1996; 271: 25989-25993Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). Three peaks of bHsc70 are separated on Mono-P during the purification. Unless noted otherwise, the third and largest peak (presumably with the lowest pI) was used for these studies. In comparative studies, we have found no functional differences between proteins from the three different Mono-P peaks. When required, proteins were rendered nucleotide-free using methods described previously (35Ha J.-H. McKay D.B. Biochemistry. 1994; 33: 14625-14635Crossref PubMed Scopus (68) Google Scholar) with the following modification. After charcoal treatment, proteins were dialyzed against 40 mmHEPES, 150 mm KCl, and 4.5 mmMgCl2, adjusted to pH 7.0 with KOH. For comparison of the effect of K+ with that of Na+ on ATPase kinetics, some of native proteins were dialyzed against 40 mm HEPES, 150 mm NaCl, and 4.5 mmMgCl2, adjusted to pH 7.0 with NaOH. To allow complete proteolytic digestion, samples of bHsc70 and rHsc70 E543K were reduced and alkylated. Reduction was done in 6 m guanidinium hydrochloride, 1 mm EDTA, 0.25 m Tris-HCl, pH 8.5, with 50 μg of dithiothreitol for 2 h at room temperature. Free sulfhydryl groups were then alkylated in the same solution by adding 1 μl of neat 4-vinylpyridine and incubating for an additional 2 h. Samples were desalted by gel filtration on a Fast Desalting column, using a Pharmacia SMART system. Proteolytic digestion was done in 0.1 m Tris-HCl, pH 9.2, with Achromobacter lyticus protease I (Lys-C-specific endoprotease, WAKO Chemicals, Dallas, TX) at an approximate substrate:enzyme ratio of 300:1. Samples were incubated overnight at 30 °C, the reaction was stopped by acidification with trifluoroacetic acid, and peptides were isolated by narrow bore reverse phase liquid chromatography on a μRPC C2/C18 SC 2.1/10 column, using a SMART system. The samples were eluted with a linear gradient of acetonitrile in 0.06% trifluoroacetic acid at a flow rate of 100 μl/min, and peptide fractions were collected automatically. Selected peptides were subjected to automated Edman degradation with a PE-Applied Biosystems model 494 sequencer, following the manufacturer's instructions. One peptide that contained an unidentified amino acid residue was analyzed on a Kratos IV matrix-assisted laser desorption/ionization time of flight mass spectrometer. Kinetic experiments were carried out either in KCl buffer (40 mm HEPES, 150 mm KCl, 4.5 mmMgCl2, and 50 μg/ml bovine serum albumin, adjusted to pH 7.0 with KOH) or in NaCl buffer, which is identical to the KCl buffer except that K+ is replaced with Na+. Rate constants of single turnover ATP hydrolysis, Pirelease, and ADP release were measured for both rHsc70 and bHsc70 at 25 °C, both in the presence and in the absence of peptide faf1, using methods described previously (5Takeda S. McKay D.B. Biochemistry. 1996; 35: 4636-4644Crossref PubMed Scopus (75) Google Scholar, 35Ha J.-H. McKay D.B. Biochemistry. 1994; 33: 14625-14635Crossref PubMed Scopus (68) Google Scholar). To investigate the effect of peptide binding on ATPase kinetics, Hsc70 was preincubated with faf1 at 25 °C for 100 min prior to experiments. For measurement of ATP hydrolysis rates under single turnover conditions, the final concentration of [α-32P]ATP was 10 nm, and that of protein ranged from 2.3 to 9.1 μm for bHsc70 and from 2.0 to 8.0 μm for rHsc70. The dependence of the ATP hydrolytic rate on [faf1] was determined at 2.3 μmnative Hsc70, 10 nm [α-32P]ATP, and faf1 ranging from 0 to 200 μm. To determine the rate of ADP dissociation, a complex between ADP and Hsc70 was formed by incubating 2.8 μm protein with 2.1 μm of [α-32P]ATP (71 Ci/mmol) at 25 °C for 3 h (bHsc70) or 1.5 h (rHsc70) to allow essentially complete hydrolysis to ADP prior to measurements. Experiments were then started by the addition of unlabeled ADP to a final concentration of 1 mm, and the decrease of protein-bound radioactivity was measured by filter binding. The rate constant of the steady state ATPase activity of bHsc70 was determined at final protein concentrations of 2.1 μm with ATP concentrations from 55 to 215 μm. The effect of faf1 on steady state ATPase activity was measured at 2.1 μm bHsc70, 108 μm ATP, and faf1 ranging 0 to 200 μm. A detailed description of the methods of data analysis has been published previously (35Ha J.-H. McKay D.B. Biochemistry. 1994; 33: 14625-14635Crossref PubMed Scopus (68) Google Scholar). Measurements of apparent equilibrium binding constants for faf1-Hsc70 complexes by HPLC gel filtration and peptide dissociation rates by fluorescence were done using methods described previously (5Takeda S. McKay D.B. Biochemistry. 1996; 35: 4636-4644Crossref PubMed Scopus (75) Google Scholar). Formation of complexes between Hsc70 and a deletion mutant of staphylococcal nuclease that is denatured in the absence of substrate or inhibitor (SNase-(Δ136–149)) was monitored by gel filtration. Mixtures including 2 μm Hsc70, 50 μm SNase-(Δ136–149), 0.15 m KCl, 3 mm MgCl2, 10 mm MOPS titrated to pH 7.0 with KOH, 1 mm nucleotide (ADP or ATP) in a final volume of 30 λ were incubated for 60 min at 37 °C and then injected into a Supelco 3000XL gel filtration column that was preequilibrated with 0.15 m KCl, 3 mmMgCl2, 50 mm phosphate titrated to pH 7.0 with KOH. The flow rate of the column was 1 ml min−1. Protein was detected by its absorbance at 215 nm. Small angle x-ray scattering data were measured on beamline 4-2 of the Stanford Synchrotron Radiation Laboratory with the resident camera and one-dimensional position-sensitive proportional counter (BioLogic, Grenoble, France) as described previously (32Wilbanks S.M. Chen L. Tsuruta H. Hodgson K.O. McKay D.B. Biochemistry. 1995; 34: 12095-12106Crossref PubMed Scopus (92) Google Scholar). Sample cell temperature was controlled at 20 °C, and solutions contained 40 mmHEPES, 150 mm KCl, 4.5 mm MgCl2, 5 mm β-mercaptoethanol, and 0.5 mm nucleotide, pH 7.0. Protein concentration was 2–7 mg/ml. To avoid x-ray damage, exposure to the beam was limited to 20 min for each sample. Radii of gyration (R g values) were computed in the Guinier approximation using the ANOM program suite (36SSRL/SLAC user manual, Stanford Synchrotron Radiation Laboratory, Stanford, CARice, M., and Wakatsuki, S. (19XX) SSRL/SLAC user manual, Stanford Synchrotron Radiation Laboratory, Stanford, CA.Google Scholar), and pair distribution functions were computed using the GNOM program suite (37Semenyuk A.V. Svergun D.I. J. Appl. Crystallogr. 1991; 24: 537-540Crossref Scopus (574) Google Scholar) as published previously (32Wilbanks S.M. Chen L. Tsuruta H. Hodgson K.O. McKay D.B. Biochemistry. 1995; 34: 12095-12106Crossref PubMed Scopus (92) Google Scholar), except as noted. Both bovine brain and recombinant (expressed inE. coli) Hsc70 proteins were purified on anion exchange, ATP-agarose, Mono P, and gel filtration columns sequentially. bHsc70 behaves in a manner similar to recombinant protein on anion exchange and ATP-agarose columns. The proteins were typically >95% pure after elution from ATP-agarose. On a chromatofocusing column (Mono P), the major peak of our original (now known to be mutant E543K) recombinant Hsc70 eluted at pH 5.5. However, bHsc70 eluted as three peaks at more acidic pH, approximately 5.2 (∼10% of total Hsc70), 5.0 (∼30%), and 4.8 (∼60%). Upon gel filtration, the major peak of our original recombinant Hsc70 eluted predominantly as a monomer, with ∼4% dimer. The addition of MgATP to oligomeric material did not induce dissociation to monomers. In contrast, bHsc70 behaved differently on gel filtration; approximately half of the protein eluted from Superdex 75 as monomer, and the remainder eluted as dimer and higher order oligomers. Removing nucleotide from native bHsc70 with charcoal did not affect the proportion of the monomer versus oligomers, but oligomeric material dissociated into monomer when incubated with MgATP. To find the source of the differences in behavior of bHsc70 and the original recombinant Hsc70, we carried out peptide mapping experiments as described under “Materials and Methods.” After digestion with LysC protease, the product peptides were separated by HPLC (Fig.1). There are four obvious peaks that differ between the two HPLC profiles. Amino acid sequencing of these peaks gave the following sequences: peak 1, LQGXINDEDK whereX is a modified amino acid; peak 2, INDEDK; peak 3, NSLESYAFNMK; and peak 4, SYAFNMK. Notably, the carboxyl-terminal amino acid of each peptide is lysine, the residue at which the protease cleaves, demonstrating that each peptide was sequenced through its carboxyl terminus. Peptide 1 from bHsc70 matches residues 558–567 of the published cDNA-derived protein sequence (33DeLuca-Flaherty C. McKay D.B. Nucleic Acids Res. 1990; 18: 5569Crossref PubMed Scopus (35) Google Scholar), except for one unknown residue (X). Residue X was tentatively identified through mass spectrometry of the peptide. Subtraction of the predicted mass of the nine known residues from the mass of peptide 1 gave a mass of 171 Da for unknown residue X. This residue of bHsc70 occupies the position of Lys561 in the cDNA-derived sequence (residue mass, 128 Da). The mass difference of 43 Da is consistent with acetylation, carbamylation, or trimethylation of the lysine residue. Each of these modifications would block cleavage by LysC protease. Since trimethylation of one lysine residue per Hsc70 chain has been reported (25Wang C. Lin J.M. Lazarides E. Arch. Biochem. Biophys. 1992; 297: 169-175Crossref PubMed Scopus (27) Google Scholar), it seems likely that residue 561 of bHsc70 is trimethyl-lysine. Cleavage at unmodified Lys561 in original recombinant Hsc70 yielded peptide 2, which matches the carboxyl-terminal six residues of peptide 1. Peptide 4 spans residues 544–550 of the original recombinant Hsc70. The production of this peptide by LysC protease identifies lysine at position 543, in agreement with the cDNA-derived sequence. Peptide 3 covers the same sequence as peptide 4, sharing the carboxyl terminus but including an additional four amino acids at the amino terminus. The longer peptide arises from the occurrence of glutamic acid at position 543 in bHsc70 in contrast to lysine at this position in original recombinant Hsc70. Apart from this difference, peptide 3 from bHsc70 corresponds with residues 540–550 of the cDNA-derived sequence. Alignment of >50 amino acid sequences for eukaryotic cytosolic and endoplasmic reticulum Hsp70-related proteins (Swiss-Prot release 34.0, April, 1996) reveals complete conservation of glutamic acid at position 543 in a segment of polypeptide that otherwise shows only modest conservation. Among organellar and bacterial Hsp70 proteins, aspartic and glutamic acid predominate in this position. The recent crystal structure of the peptide binding domain of E. coli DnaK protein shows that this residue participates in a salt bridge to an arginine (29Zhu X. Zhao X. Burkholder W.F. Gragerov A. Ogata C.M. Gottesman M.E. Hendrickson W.A. Science. 1996; 272: 1606-1614Crossref PubMed Scopus (1064) Google Scholar). This suggests that the difference we observe at position 543 is most likely a cloning artifact, although it is possible that the original bovine brain cDNA clone represents a minor isoform of Hsc70. Regardless of the basis of the difference, our original recombinant material has an E543K amino acid difference relative to the major fraction of bHsc70 purified from bovine brain. Hence, we now consider the original recombinant Hsc70 to be an E543K mutant protein (rHsc70 E543K), and we henceforth refer to recombinant Hsc70 with glutamic acid at position 543 as rHsc70. Since these experiments revealed two differences between bHsc70 and our original rHsc70 E543K, we have carried out a series of experiments characterizing bHsc70 and wild type rHsc70. Comparison of these wild type proteins shows whether any differences in activity resulted from posttranslational modification of Lys561 (and possibly of other residues not yet identified as modified). Comparison of these results with our earlier characterization of rHsc70 E543K shows differences in activities due to the mutation at position 543. In the presence of MgADP, bHsc70 displays a mixture of monomer, dimer, and higher order oligomer on gel filtration, with ∼70–80% of the protein monomeric, in agreement with earlier reports of Schmid and co-workers (13Schmid S.L. Braell W.A. Rothman J.E. J. Biol. Chem. 1985; 260: 10057-10062Abstract Full Text PDF PubMed Google Scholar). Wild type rHsc70 displays a similar mixture of oligomers; typically ∼50% of the protein is monomeric. For both proteins, incubation with MgATP results in dissociation of the oligomers, and essentially 100% monomeric protein is found on gel filtration. In contrast, incubation of rHsc70 E543K with MgATP did not result in dissociation of oligomeric species. The deletion mutant SNase-(Δ136–149) is unfolded in the absence of inhibitor or substrate and was used as a representative denatured protein. When 2 μm wild type bHsc70 or rHsc70 was incubated with 50 μm SNase-(Δ136–149) in the presence of MgADP, as described under “Materials and Methods,” complexes between the nuclease and Hsc70 were de" @default.
• W1992687906 created "2016-06-24" @default.
• W1992687906 creator A5013212096 @default.
• W1992687906 creator A5014680362 @default.
• W1992687906 creator A5032534504 @default.
• W1992687906 creator A5046631941 @default.
• W1992687906 creator A5053398061 @default.
• W1992687906 creator A5054466729 @default.
• W1992687906 creator A5063531874 @default.
• W1992687906 creator A5064931533 @default.
• W1992687906 creator A5081248562 @default.
• W1992687906 date "1997-10-01" @default.
• W1992687906 modified "2023-10-10" @default.
• W1992687906 title "Destabilization of Peptide Binding and Interdomain Communication by an E543K Mutation in the Bovine 70-kDa Heat Shock Cognate Protein, a Molecular Chaperone" @default.
• W1992687906 cites W1479915402 @default.
• W1992687906 cites W1483123501 @default.
• W1992687906 cites W1520714027 @default.
• W1992687906 cites W1547430213 @default.
• W1992687906 cites W1548299326 @default.
• W1992687906 cites W1576248431 @default.
• W1992687906 cites W1586954919 @default.
• W1992687906 cites W1593791512 @default.
• W1992687906 cites W17493816 @default.
• W1992687906 cites W1968155837 @default.
• W1992687906 cites W1968465569 @default.
• W1992687906 cites W1974036723 @default.
• W1992687906 cites W1976784468 @default.
• W1992687906 cites W1977357027 @default.
• W1992687906 cites W1981241246 @default.
• W1992687906 cites W1981326517 @default.
• W1992687906 cites W1992191979 @default.
• W1992687906 cites W1994562111 @default.
• W1992687906 cites W2003278197 @default.
• W1992687906 cites W2009867441 @default.
• W1992687906 cites W2022026383 @default.
• W1992687906 cites W2026998495 @default.
• W1992687906 cites W2028440767 @default.
• W1992687906 cites W2032515211 @default.
• W1992687906 cites W2032536046 @default.
• W1992687906 cites W2034943952 @default.
• W1992687906 cites W2060864422 @default.
• W1992687906 cites W2076945013 @default.
• W1992687906 cites W2080935921 @default.
• W1992687906 cites W2086922403 @default.
• W1992687906 cites W2087417156 @default.
• W1992687906 cites W2090463053 @default.
• W1992687906 cites W2092198909 @default.
• W1992687906 cites W2133924946 @default.
• W1992687906 cites W25256194 @default.
• W1992687906 cites W82016731 @default.
• W1992687906 doi "https://doi.org/10.1074/jbc.272.44.27796" @default.
• W1992687906 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9346924" @default.
• W1992687906 hasPublicationYear "1997" @default.
• W1992687906 type Work @default.
• W1992687906 sameAs 1992687906 @default.
• W1992687906 citedByCount "29" @default.
• W1992687906 countsByYear W19926879062015 @default.
• W1992687906 countsByYear W19926879062018 @default.
• W1992687906 countsByYear W19926879062019 @default.
• W1992687906 countsByYear W19926879062022 @default.
• W1992687906 crossrefType "journal-article" @default.
• W1992687906 hasAuthorship W1992687906A5013212096 @default.
• W1992687906 hasAuthorship W1992687906A5014680362 @default.
• W1992687906 hasAuthorship W1992687906A5032534504 @default.
• W1992687906 hasAuthorship W1992687906A5046631941 @default.
• W1992687906 hasAuthorship W1992687906A5053398061 @default.
• W1992687906 hasAuthorship W1992687906A5054466729 @default.
• W1992687906 hasAuthorship W1992687906A5063531874 @default.
• W1992687906 hasAuthorship W1992687906A5064931533 @default.
• W1992687906 hasAuthorship W1992687906A5081248562 @default.
• W1992687906 hasBestOaLocation W19926879061 @default.
• W1992687906 hasConcept C104317684 @default.
• W1992687906 hasConcept C142724271 @default.
• W1992687906 hasConcept C153911025 @default.
• W1992687906 hasConcept C185592680 @default.
• W1992687906 hasConcept C205260736 @default.
• W1992687906 hasConcept C2775962898 @default.
• W1992687906 hasConcept C2779281246 @default.
• W1992687906 hasConcept C501734568 @default.
• W1992687906 hasConcept C54355233 @default.
• W1992687906 hasConcept C55493867 @default.
• W1992687906 hasConcept C68991219 @default.
• W1992687906 hasConcept C71924100 @default.
• W1992687906 hasConcept C86803240 @default.
• W1992687906 hasConcept C95444343 @default.
• W1992687906 hasConceptScore W1992687906C104317684 @default.
• W1992687906 hasConceptScore W1992687906C142724271 @default.
• W1992687906 hasConceptScore W1992687906C153911025 @default.
• W1992687906 hasConceptScore W1992687906C185592680 @default.
• W1992687906 hasConceptScore W1992687906C205260736 @default.
• W1992687906 hasConceptScore W1992687906C2775962898 @default.
• W1992687906 hasConceptScore W1992687906C2779281246 @default.
• W1992687906 hasConceptScore W1992687906C501734568 @default.
• W1992687906 hasConceptScore W1992687906C54355233 @default.
• W1992687906 hasConceptScore W1992687906C55493867 @default.
• W1992687906 hasConceptScore W1992687906C68991219 @default.
• W1992687906 hasConceptScore W1992687906C71924100 @default.
• W1992687906 hasConceptScore W1992687906C86803240 @default.

• next