FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992765157> ?p ?o ?g. }

• W1992765157 endingPage "30105" @default.
• W1992765157 startingPage "30099" @default.
• W1992765157 abstract "CtpA, a carboxyl-terminal processing protease, is a member of a novel family of endoproteases that includes a tail-specific protease from Escherichia coli. In oxygenic photosynthetic organisms, CtpA catalyzes C-terminal processing of the D1 protein of photosystem II, an essential event for the assembly of a manganese cluster and consequent light-mediated water oxidation. We introduced site-specific mutations at 14 conserved residues of CtpA in the cyanobacterium Synechocystis sp. PCC 6803 to examine their functional roles. Analysis of the photoautotrophic growth capabilities of these mutants, their ability to process precursor D1 protein and hence evolve oxygen, along with an estimation of the protease content in the mutants revealed that five of these residues are critical for in vivo activity of CtpA. Recent x-ray crystal structure analysis of CtpA from the eukaryotic algaScenedesmus obliquus (Liao, D.-I., Qian, J., Chisholm, D. A., Jordan, D. B. and Diner, B. A. (2000) Nat. Struct. Biol. 7, 749–753) has shown that the residues equivalent to Ser-313 and Lys-338, two of the five residues mentioned above, form the catalytic center of this enzyme. Our in vivo analysis demonstrates that the three other residues, Asp-253, Arg-255, and Glu-316, are also important determinants of the catalytic activity of CtpA. CtpA, a carboxyl-terminal processing protease, is a member of a novel family of endoproteases that includes a tail-specific protease from Escherichia coli. In oxygenic photosynthetic organisms, CtpA catalyzes C-terminal processing of the D1 protein of photosystem II, an essential event for the assembly of a manganese cluster and consequent light-mediated water oxidation. We introduced site-specific mutations at 14 conserved residues of CtpA in the cyanobacterium Synechocystis sp. PCC 6803 to examine their functional roles. Analysis of the photoautotrophic growth capabilities of these mutants, their ability to process precursor D1 protein and hence evolve oxygen, along with an estimation of the protease content in the mutants revealed that five of these residues are critical for in vivo activity of CtpA. Recent x-ray crystal structure analysis of CtpA from the eukaryotic algaScenedesmus obliquus (Liao, D.-I., Qian, J., Chisholm, D. A., Jordan, D. B. and Diner, B. A. (2000) Nat. Struct. Biol. 7, 749–753) has shown that the residues equivalent to Ser-313 and Lys-338, two of the five residues mentioned above, form the catalytic center of this enzyme. Our in vivo analysis demonstrates that the three other residues, Asp-253, Arg-255, and Glu-316, are also important determinants of the catalytic activity of CtpA. photosystem II precursor form of the D1 protein of PSII N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid polymerase chain reaction sodium dodecyl sulfate-polyacrylamide gel electrophoresis kilobase(s) During recent years, a new class of endoproteases with carboxyl-terminal processing activities has been described in various bacteria and organellar systems (1Keiler K.C. Sauer R.T. Barrett A.J. Rawlings N.D. Woessner J.F. Handbook of Proteolytic Enzymes. Academic Press, London1998: 460-461Google Scholar, 2Pakrasi H.B. Barrett A.J. Rawlings N.D. Woessner J.F. Handbook of Proteolytic Enzymes. Academic Press, London1998: 462-463Google Scholar, 3Satoh K. Barrett A.J. Rawlings N.D. Woessner J.F. Handbook of Proteolytic Enzymes. Academic Press, London1998: 463-464Google Scholar). The physiological functions of most of the members of this family of proteases are poorly understood. One notable exception is CtpA, a carboxyl-terminal processing protease found in cyanobacteria and chloroplasts (2Pakrasi H.B. Barrett A.J. Rawlings N.D. Woessner J.F. Handbook of Proteolytic Enzymes. Academic Press, London1998: 462-463Google Scholar, 3Satoh K. Barrett A.J. Rawlings N.D. Woessner J.F. Handbook of Proteolytic Enzymes. Academic Press, London1998: 463-464Google Scholar). In these photosynthetic organisms, photosystem II (PSII),1 a large membrane-bound pigment-protein complex (4Nanba O. Satoh K. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 109-112Crossref PubMed Google Scholar, 5Pakrasi H.B. Annu. Rev. Genet. 1995; 29: 755-776Crossref PubMed Scopus (72) Google Scholar, 6Zouni A. Witt H.T. Kern J. Fromme P. Krauss N. Saenger W. Orth P. Nature. 2001; 409: 739-743Crossref PubMed Scopus (1776) Google Scholar), catalyzes light-induced oxidation of water to molecular oxygen, a critically important process in the biosphere. The life history of PSII is extremely interesting. As a direct consequence of its normal function, D1, one of the catalytic component proteins of PSII, is damaged and subsequently removed. A newly synthesized D1 protein with a carboxyl-terminal extension is then integrated into the PSII complex (7Zhang L. Paakkarinen V. van Wijk K.J. Aro E.M. J. Biol. Chem. 1999; 274: 16062-16067Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). The processing of the extension peptide on the precursor form of the D1 protein (pD1) is a prerequisite step for the formation of a tetramanganese cluster that is essential for the catalysis of the water oxidation reaction (8Diner B.A. Ries D.F. Cohen B.N. Metz J.G. J. Biol. Chem. 1988; 263: 8972-8980Abstract Full Text PDF PubMed Google Scholar, 9Bowyer J.R. Packer J.C.L. McCormack B.A. Whitelegge J.P. Robinson C. Taylor M.A. J. Biol. Chem. 1992; 267: 5424-5433Abstract Full Text PDF PubMed Google Scholar). In the cyanobacterium Synechocystis sp. PCC 6803 (hereafterSynechocystis 6803), the carboxyl-terminal extension in pD1 is 16 amino acids long (10Nixon P.J. Trost J.T. Diner B.A. Biochemistry. 1992; 31: 10859-10871Crossref PubMed Scopus (196) Google Scholar). We have recently shown that the presence of this extension is required for optimal photosynthetic performance ofSynechocystis 6803 cells (11Ivleva N.B. Shestakov S.V. Pakrasi H.B. Plant Physiol. 2000; 124: 1403-1411Crossref PubMed Scopus (32) Google Scholar). Mutants that lack catalytically active CtpA are unable to remove the carboxyl-terminal extension of the pD1 protein. As a consequence, they lack the ability to evolve oxygen, presumably because the carboxyl terminus of the mature D1 protein functions as a ligand for the formation of the manganese cluster in PSII (10Nixon P.J. Trost J.T. Diner B.A. Biochemistry. 1992; 31: 10859-10871Crossref PubMed Scopus (196) Google Scholar). The ctpA gene was initially identified by genetic complementation analysis of specific photosynthetic mutant strains of Synechocystis 6803 (12Shestakov S.V. Anbudurai P.R. Stanbekova G.E. Gadzhiev A. Lind L.K. Pakrasi H.B. J. Biol. Chem. 1994; 269: 19354-19359Abstract Full Text PDF PubMed Google Scholar,13Anbudurai P.R. Mor T.S. Ohad I. Shestakov S.V. Pakrasi H.B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8082-8086Crossref PubMed Scopus (142) Google Scholar). Later, the CtpA protease from spinach chloroplasts was identified through biochemical purification techniques (14Fujita S. Inagaki N. Yamamoto Y. Taguchi F. Matsumoto A. Satoh K. Plant Cell Physiol. 1995; 36: 1169-1177Google Scholar) followed by cloning and characterization of the plant nuclear gene encoding this enzyme (15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar). Our initial studies showed that the CtpA proteins from cyanobacteria and green plants share significant sequence similarities (15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar, 16Oelmüller R. Herrmann R.G. Pakrasi H.B. J. Biol. Chem. 1996; 271: 21848-21856Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). However, none of them exhibits sequence homology with other proteases with well defined reaction mechanisms. In addition, in vitro inhibitor studies have demonstrated that the CtpA enzyme cannot be classified as an aspartic, cysteine, serine, or metalloprotease (17Yamamoto Y. Inagaki N. Satoh K. J. Biol. Chem. 2001; 276: 7518-7525Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Based on sequence homologies, the CtpA protease was assigned to a newly emerging class of carboxyl-terminal processing proteases that also included the tail-specific protease Tsp from Escherichia coli (18Silber K.R. Keiler K.C. Sauer R.T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 295-299Crossref PubMed Scopus (162) Google Scholar, 19Keiler K.C. Waller P.R.H. Sauer R.T. Science. 1996; 271: 990-993Crossref PubMed Scopus (907) Google Scholar). The members of this family of proteases exhibit significant degrees of sequence homology in certain discrete regions of the proteins. These regions of conserved sequences can be classified broadly as two domains, namely 1 and 2 (domains A and B in Ref. 15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar), respectively. To understand the functional roles of various conserved amino acid residues and domains of the CtpA protein in its biological activity, we have, in this study, generated 23 targeted mutant strains by site-directed mutagenesis of Synechocystis 6803. Alanine scanning mutations were first introduced at each of 14 residues that are completely conserved among members of this protease family (15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar). Residues that were thus found to be critical for photoautotrophic growth were subsequently altered by conservative substitutions to gain an in-depth understanding of the catalytic activity of this protease. The mutants thus generated were analyzed for their ability of photoautotrophic growth. We also measured PSII-mediated oxygen evolution activity and the cellular CtpA protease content in these mutant strains. Finally, the half-lives of the pD1 protein in these mutants were determined by in vivo pulse-chase experiments. Our data indicated that replacements of 9 of the 14 selected residues did not affect the catalytic activity of CtpA but significantly decreased the cellular content of this protein. On the other hand, five residues were critically important for the in vivoprocessing of the pD1 protein in Synechocystis 6803 cells. All chemicals used were of reagent grade. Enzymes for recombinant DNA work were from New England Biolabs (Beverly, MA). Synechocystis 6803 wild type and mutant cells were grown at 30 °C under 50 µmol of photons m−2 s−1 of white light in BG11 medium (20Allen M.M. J. Phycol. 1968; 4: 1-4Crossref PubMed Scopus (1021) Google Scholar). Liquid cultures were grown with vigorous bubbling with air. The medium used for the heterotrophic mutants was supplemented with 5 mm glucose. Solid medium was supplemented with 1.5% (w/v) agar, 0.3% (w/v) sodium thiosulfate, and 10 mm TES-KOH, pH 8.2. A ΔctpA mutant was used as the background strain to generate various site-specific mutations in the ctpA gene. The ΔctpA mutant strain was generated by transforming wild type Synechocystis 6803 cells with the recombinant plasmid pSL795. To construct the pSL795 plasmid, we used the pSL794 plasmid that has the ctpA gene along with its flanking regions as a 6-kb HindIII-BamHI fragment (12Shestakov S.V. Anbudurai P.R. Stanbekova G.E. Gadzhiev A. Lind L.K. Pakrasi H.B. J. Biol. Chem. 1994; 269: 19354-19359Abstract Full Text PDF PubMed Google Scholar) cloned in the pUC119 vector. A 1.5-kb EcoRI fragment containing an erythromycin-resistance cassette was inserted into pSL794 after the plasmid was digested with EcoRI, which replaced a 1.4-kb fragment containing the complete coding sequence of the ctpAgene by the cassette. The ΔctpA mutant was grown in the BG11 medium supplemented with 5 mm glucose and 3 µg ml−1 erythromycin. The CtpAk strain was used as a positive control in the current study. It was generated by transforming the ΔctpA mutant with the pSL958 plasmid (Fig. 1). The pSL958 plasmid has thectpA gene along with an upstream hypothetical open reading frame and downstream rbcL sequences cloned in pUC119. Furthermore, a 1.1-kb kanamycin-resistance cassette was inserted at anEcoRI site immediately downstream of the ctpAcoding sequence. Complete segregation was followed after transformation and confirmed by PCR. The growth of various cyanobacterial strains was monitored by measurements of light scattering at 730 nm on a DW 2000 spectrophotometer (SLM-Aminco Instruments, Urbana, IL). E. coli strain TG1 (supE hsdΔ5 thiΔ(lac-proAB) F′ (traD36proAB + laci q lacZΔM15)) used for the preparation of various plasmids was grown at 37 °C in Luria-Bertani medium (21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, New York1989Google Scholar). Site-specific mutations were generated using a PCR-based method described elsewhere (22Picard V. Ersdal-Badju E. Lu A. Bock S.C. Nucleic Acids Res. 1994; 22: 2587-2591Crossref PubMed Scopus (216) Google Scholar). Sequences of upstream and downstream primers are 5′-ATCCCTCGGTACGTTGAACC-3′ and 5′-TCACGAGGCAGACCTCAGCG-3′, respectively, and were used to amplify the entire coding sequence of the ctpA gene. Mutagenic primers are listed in Table I. After PCR mutagenesis, the products were digested with SfiI andMscI (Fig. 2). The resultant fragments were purified and ligated into pSL958 digested with the same pair of restriction enzymes. The presence of the desired mutations in the ctpA gene was confirmed by sequencing of the resultant plasmids on an automated sequencer, model 373S (Applied Biosystems, Foster City, CA) using an ABI PRISM dye-primer cycle sequencing kit. The generation of the desired mutants was achieved by transforming ΔctpA cells with individual plasmids using a previously described procedure (23Dzelzkalns V.A. Bogorad L. EMBO J. 1988; 7: 333-338Crossref PubMed Scopus (46) Google Scholar, 24Bartsevich V.V. Pakrasi H.B. EMBO J. 1995; 14: 1845-1853Crossref PubMed Scopus (110) Google Scholar).Table ISequences of mutagenic primersGGCTGCAACCCCATGCGCAAATTTTGGCGATCGACGGD149A(FspI)GAATTTACCCTGACTGCGCAGTTAATTTCCCTCAGTCR198A(FspI)GACGGTTATATCTTGGCGCTGCGTAACAACCCCGGTGGCD253A(HaeII)GGTTATATCTTGGATTTGGCCAACAACCCCGGTGGCTTACTCCR255A(MscI)CTTGGATTTGCGTAACGCGCCCGGTGGCTTACTCCAGGCN257A(HhaI)CAACCAGGGTACTGCTGCAGCCAGCGAAATTTTAGCCGGAGCS313A(PstI)GGTACTGCCAGTGCT GCAGAAATTTTAGCCGGAGCTTTGCS315A(PstI)CTGCCAGTGCCAGCGCTATTTTAGCCGGAGCTTTGCAGGE316A(Eco47III)CCGGAGCTTTGCAGGCCAATCAGCGGGCCACTCD324AGAGCTTTGCAGGATAATCAGGCCGCCACTCTAGTGGGR327AGGAAAAAACCTTTGGA GCGGGTTTGATTCAATCCTTGK338A(BsrBI)GGTAAGGGTTTGATTGCT AGCTTGTTTGAACTATCCGATGGQ342A(NheI)GCCGGCATTGCCGTCGCGGTGGCCAAATACGAAACCT356A(Bsh1236I)ACTGGGCATTATGCCT GCAGAAGTGGTGGAGCAACCCCD376A(PstI)GACGGTTATATCTTGGAATTGCGTAACAACCCCGGTGGCD253EGACGGTTATATCTTGAATTTGCGTAACAACCCCGGTGGCD253NGGTTATATCTTGGATTTGAAGAACAACCCCGGTGGCTTACTCCR255KGGTTATATCTTGGATTTGCACAACAACCCCGGTGGCTTACTCCR255HCAACCAGGGTACTGCCTGTGCCAGCGAAATTTTAGCCGGAGCS313CCTGCCAGTGCCAGCGACATTTTAGCCGGAGCTTTGCAGGE316DCTGCCAGTGCCAGCCAGATTTTAGCCGGAGCTTTGCAGGE316QGGAAAAAACCTTTGGTCACGGTTTGATTCAATCCTTGK338HGGAAAAAACCTTTGGTAGAGGTTTGATTCAATCCTTGK338RItalicized and underlined letters indicate substituted bases and target codons, respectively. Shown in parentheses are the sites for restriction enzymes that were introduced in the primers for easy screening of the respective mutants. Open table in a new tab Italicized and underlined letters indicate substituted bases and target codons, respectively. Shown in parentheses are the sites for restriction enzymes that were introduced in the primers for easy screening of the respective mutants. The rates of PSII-mediated oxygen evolution from intact Synechocystis 6803 cells were measured on a Clark-type oxygen electrode in the presence of 0.5 mm 2,6-dichloro-p-benzoquinone and 1 mm K3Fe(CN)6 as described previously (25Mannan R.M. Pakrasi H.B. Plant Physiol. 1993; 103: 971-977Crossref PubMed Scopus (60) Google Scholar). Samples in BG11 medium were adjusted to a final chlorophyll concentration of 5 µg ml−1 (26Lichtenthaler H.K. Methods Enzymol. 1987; 148: 350-382Crossref Scopus (9424) Google Scholar). For the expression of the mature form of the CtpA protein in E. coli, a translation initiation codon incorporated into an NdeI recognition site was introduced into the ctpA gene by PCR. The PCR products were digested with NdeI and EcoRI and cloned into the pET21a vector (Novagen, Madison, WI) digested with the same pair of restriction enzymes. The resultant plasmid (pSL962) was transformed into the E. coli strain BL21(DE3). After induction, the recombinant overexpressed protein was purified by SDS-PAGE (27Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar) and used to raise anti-CtpA antisera in a rabbit. Anti-D1 antisera used during this study were kind gift from Prof. M. Ikeuchi (University of Tokyo). Proteins obtained from sonicated Synechocystis 6803 cells were fractionated by SDS-PAGE and blotted onto nitrocellulose membranes. Detection of the CtpA and D1 proteins by Western blotting analysis was carried out using an enhanced chemiluminescence system (ECL, Amersham Pharmacia Biotech Ltd., Little Chalfont, Buckinghamshire, UK). The relative amounts of CtpA was estimated using the Intelligent Quantifier software (BioImage, Ann Arbor, MI). Cyanobacterial cells (5 × 108) were collected by centrifugation at 3,000 × g for 5 min. The resultant pellet was washed twice with BG11 and resuspended in 100 µl of BG11. Five µl ofl-[35S]methionine (37 TBq/mmol, 370 MBq/ml,Amersham Pharmacia Biotech) were added into the suspension, and the cells were incubated for 5 min at 30 °C under 90 µE m−2 s−1 of heat-absorbed incandescent light. After this pulse period, chloramphenicol (200 µg ml−1) was added to the cells, which were then incubated for various chase periods. Twenty µl of sample were collected after each chase period, and cells were washed once with a lysis buffer containing 20 mm HEPES-KOH pH 7.5, 10 mm NaCl, 5 mm MgCl2, 1 mm EDTA, and 1 mm p-4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (p-ABSF) and resuspended into 20 µl of the same buffer. The cells were then disrupted in a small glass homogenizer with glass beads (≤106 µm, Sigma). Two hundred µl of sample buffer for SDS-PAGE were added to the homogenate. The resultant mixture was centrifuged at 20,000 × g for 10 min at 25 °C, the supernatant was fractionated by SDS-PAGE, and the labeled D1 protein was visualized by fluorography. The half-life of the precursor form of the D1 protein in each mutant was estimated by analyzing the resultant fluorographs using the Intelligent Quantifier software (BioImage). The protein encoded by the ctpA gene inSynechocystis 6803 has 427 amino acids. To evaluate the contributions of different residues to the in vivo activity of CtpA, we chose 14 amino acid residues that are absolutely conserved among different members of this protease family and are, hence, expected to be important for their catalytic activities (Fig.3 b) (15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar). Among these residues, 10 are localized in two highly conserved domains, named 1 and 2 (domains A and B in Ref. 15Inagaki N. Yamamoto Y. Mori H. Satoh K. Plant Mol. Biol. 1996; 30: 39-50Crossref PubMed Scopus (40) Google Scholar), respectively. The extent of conservation of these domains among different members of the family are shown in Fig. 3 b. Site-directed mutagenesis was employed to introduce specific substitutions at each of these 14 residues in the CtpA protein of Synechocystis 6803. Initially, we introduced alanine at each of these positions. Sites thus determined to be important for the in vivo enzymatic activity of CtpA were further subjected to semiconservative substitutions. We have previously determined that in the absence of CtpA activity, Synechocystis 6803 cells can not grow photoautotrophically (13Anbudurai P.R. Mor T.S. Ohad I. Shestakov S.V. Pakrasi H.B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8082-8086Crossref PubMed Scopus (142) Google Scholar). The photoautotrophic capabilities of the 14 different alanine substitution mutants are shown in TableII. Using anti-CtpA antisera in Western blot analysis, we determined that the amount of CtpA in wild typeSynechocystis 6803 cells is 0.0026% of its total cellular protein content (data not shown). Thus, CtpA is a relatively minor protein in these cells, consistent with its regulatory role in the biogenesis of PSII. We determined the cellular CtpA content (Fig.4 and Table II) and the status of the D1 protein (Table II) in the alanine substitution mutants. First, the CtpA content of the CtpAk control strain was 53% of that of the wild type strain. In the CtpAk strain, a kanamycin-resistance cassette was introduced at an EcoRI site immediately downstream of the ctpA coding sequence, which might have decreased the stability of the corresponding transcript and/or efficiency of its translation. However, this control strain had normal PSII-mediated oxygen evolution activity as well as a pD1 half-life that was comparable with that in the wild type cells (Table III).Table IIGrowth property, CtpA protease content, and the status of the D1 protein in mutant strains with alanine substitutions at fourteen selected residues of the CtpA proteinStrainPhotoautotrophic growthCtpA ContentStatus of D1 protein2-aM, mature form of D1; P, precursor form of D1. Results shown are those from a representative experiment.%Wild-type+187MCtpAk+100MΔctpA−0PD149A+5MR198A+2MD253A−36PR255A−66PN257A+33MS313A−118PS315A+72ME316A−96PD324A+35MR327A+33MK338A−88PQ342A+33MT356A+36MD376A+14MThe CtpAk positive control strain was generated by transforming the ΔctpA strain with pSL958 (Fig. 1). The ΔctpA strain served as a negative control in these studies.2-a M, mature form of D1; P, precursor form of D1. Results shown are those from a representative experiment. Open table in a new tab Table IIIPhotoautotrophic growth, doubling time, CtpA content, PSII-mediated oxygen evolution rate, and half-life of pD1 of mutant strains with semiconservative allelic replacements at five critical residues of the CtpA proteinStrainPhotoautotrophic growthDoubling time3-aNG, no growth.CtpA contentRate of O2 evolutionpD1 half-life3-bnd, not determined because pD1 remains unprocessed (Fig. 5).h%%minWild type+10.5187100<5ctpAk+12.2100100<5ΔctpA−NG00>90D253E+20.51056815D253N+22.81024130R255K+34.513327∼90R255H−NG780ndS313C+18.21098210E316D+24.8993260E316Q−NG530ndK338H−NG660ndK338R−NG930ndResults shown are those from a representative experiment.3-a NG, no growth.3-b nd, not determined because pD1 remains unprocessed (Fig. 5). Open table in a new tab The CtpAk positive control strain was generated by transforming the ΔctpA strain with pSL958 (Fig. 1). The ΔctpA strain served as a negative control in these studies. Results shown are those from a representative experiment. As shown in Fig. 4 and Table II, alanine substitution of each of nine residues, namely Asp-149, Arg-198, Asn-257, Ser-315, Asp-324, Arg-327, Gln-342, Thr-356, and Asp-376 reduced the cellular content of CtpA significantly. However, all of these mutant strains could grow photoautotrophically, and they accumulated the D1 protein in its mature form. It is noteworthy that the CtpA contents of both the A149A and the R198A mutants were less than 5% of the normal amount. Evidently, the presence of very small amounts of functional CtpA enzyme was sufficient to process the pD1 protein in Synechocystis 6803 cells. Clearly, none of these nine residues is essential for the catalytic activity of the CtpA protease. In contrast, alanine substitution of each of the remaining five residues resulted in the loss of photoautotrophic growth of the corresponding mutant strains. All of these five mutants accumulated the D1 protein in its precursor form, although a significant amount of the CtpA protease was present in each of them. These five residues are localized in the highly conserved domains 1 and 2 of the CtpA protein (Fig. 3 a). Among these residues, Ser-313 and Lys-338 correspond to two active site residues (Ser-430 and Lys-455, respectively) of the Tsp protease from E. coli, previously identified by Keiler and Sauer (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). Our data indicated that the amino acid residues Asp-253, Arg-255, Ser-313, Glu-316, and Lys-338 are critically important for the in vivo pD1 processing function of the CtpA protease. The above five critical residues were further subjected to conservative replacement mutagenesis. The acidic residue Asp-253 was changed to Glu, another acidic residue, or to Asn, the corresponding amido group-bearing residue. Similarly, Glu-316 was replaced by either Asp or Gln. The two basic residues Arg-255 and Lys-338 were each replaced by two other (potentially) basic residues. Finally, Ser-313 was substituted by cysteine, because in some proteases cysteine can replace the active site serine with retention of proteolytic activity (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). It is noteworthy that wild type Synechocystis 6803 CtpA does not have any cysteine residue. We determined the photoautotrophic growth competence, doubling time, CtpA content, status of the D1 protein (mature or the precursor form), and the rates of PSII-mediated oxygen evolution from the resultant 9 mutant strains (Table III and Fig. 5). Both D253E and D253N mutations allowed photoautotrophic growth, although at reduced rates. In contrast, the E316D mutant could grow photoautotrophically, whereas the E316Q mutant could not. In addition, the latter mutant strain did not exhibit any PSII activity and accumulated only the precursor form of D1 (Fig. 5). These results indicated that the presence of a negatively charged residue at position 316 is essential for the catalytic activity of CtpA. Similarly, the R255K mutant, but not the R255H mutant, could grow photoautotrophically. It is possible that the His residue at this position may remain in its uncharged form, suggesting that the presence of a positively charged residue at position 255 is necessary for CtpA activity. In contrast, both K338R and K338H mutants had no PSII activity and could not grow photoautotrophically. Thus, Lys-338 is an essential residue for CtpA activity. Finally, the S313C mutant exhibited photoautotrophic growth properties and significant PSII-mediated O2 evolution activity, indicating that a Cys can functionally replace the Ser at the 313 position. Radioactive pulse-chase analysis was performed to determine the half-life of the pD1 protein as an estimate of the in vivo activity of CtpA in various mutants (Fig. 6 and TableIII). All of the non-photoautotrophic alanine substitution mutants had stable pD1 protein. We could not detect any CtpA-dependent processing activity in any of these mutants (data not shown). In the wild type and the ctpAk control strains, the pD1 protein was rapidly converted to its mature form. As described above, five of the nine mutants with conservative replacements could grow autotrophically (Table III). The in vivo half-life of pD1 ranged between 10 and nearly 90 min in these mutant strains. In particular, the E316D and the R255K mutants had unusually slow D1 processing activities. It is noteworthy that the oxygen evolution activities and the rates of photoautotrophic growth of these five mutants correlated well with the activities of their CtpA protease, indicating that the processing of D1 is a rate-limiting step during photosynthetic growth of these mutants. In contrast, the other four mutants in this group did not have any CtpA activity, and in these cells, the pD1 protein was stably accumulated (Fig. 5). In the family of carboxyl-terminal processing proteases, CtpA is the only member with a defined and essential physiological activity. The high specific activity of this endoprotease is a critical determinant during the assembly of functionally competent PSII complexes. In this study, we employed site-directed mutagenesis to generate a series of targeted replacement mutants to identify critical residues for in vivo catalysis by the CtpA enzyme. Alanine-scanning mutagenesis of 14 selected conserved residues revealed that nine mutants, D149A, R198A, N257A, S315A, D324A, R327A, Q342A, T356A, and D376A, could grow photoautotrophically (Table II). In addition, the D1 protein in these mutants was present in its processed form, indicating that these residues do not significantly contribute to the catalytic activity of CtpA. It is noteworthy that with a single exception (S315A), these mutants had significantly reduced cellular content of CtpA (varying between 2 and 36%). We speculate that a plausible role of these eight conserved residues is maintaining the stable structure of the protease in vivo. In contrast, the remaining five residues, namely Asp-253, Arg-255, Ser-313, Glu-316, and Lys-338, are critical determinants for the catalytic activity of CtpA. Alanine substitution of these residues severely disrupted the activity of the CtpA protease. As a consequence, these mutants had unprocessed pD1 protein, lost their oxygen evolution activity, and could not grow photoautotrophically (Table II). All of these five residues are localized in either of the two conserved domains, 1 and 2, of the CtpA protein (Fig. 3 a). Another well studied carboxyl-terminal processing protease is the Tsp enzyme from E. coli. In particular, Keiler and Sauer (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar) have conducted a detailed in vitro study on a series of Tsp allelic replacement mutants to identify the amino acid residues in the active site of this enzyme. They have concluded that catalysis of the Tsp protease is based on a Ser-Lys dyad mechanism, first described for bacterial signal peptidase, an amino-terminal processing enzyme (29Paetzel M. Dalbey R.E. Trends Biochem. Sci. 1997; 22: 28-31Abstract Full Text PDF PubMed Scopus (129) Google Scholar,30Paetzel M. Dalbey R.E. Strynadka N.C. Nature. 1998; 396: 186-190Crossref PubMed Scopus (2) Google Scholar). Clearly, Ser-313 and Lys-338, two critical residues in CtpA inSynechocystis 6803 (Fig. 3 a), are functionally homologous with the two active site residues, Ser-430 and Lys-455, of the Tsp protease (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). In addition, both Tsp (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar) and CtpA (Table III) proteases can function when their respective active site Ser residues are replaced by Cys. Our studies also indicated that Lys-338 is an essential residue in CtpA, because all three of the K338A, K338R, and K338H mutants had no CtpA activity. Based only on these data, one may conclude that the catalytic activity of the CtpA protease is based on the Ser-Lys dyad mechanism and hence is similar to that of the Tsp protease as well as the signal peptidase. In this scenario, Ser-313 and Lys-338 in CtpA might act as a nucleophile and a general base, respectively. Our data also demonstrate that the Asp-253 and Arg-255 residues in the conserved domain 1 were important for the in vivo activity of CtpA. A possible explanation for the absence of D1 processing activity in the D253A mutant is its reduced CtpA content (36% of control, Table II). However, mutants such as D149A and R198A, with 5% or less of control CtpA content (Table II), have processed D1 protein. A more reasonable conclusion is that the Asp-253 residue contributes directly to the catalytic activity of CtpA. A similar reasoning is also applicable to the Arg-255 residue. Recent x-ray structural data of the CtpA protein from the eukaryotic alga Scenedesmus obliquus(31Liao D.-I. Qian J. Chisholm D.A. Jordan D.B. Diner B.A. Nat. Struct. Biol. 2000; 7: 749-753Crossref PubMed Scopus (113) Google Scholar) indicate that both the Asp-253 and Arg-255 residues are distant from the catalytic center of CtpA. Interestingly, Liao et al. (31Liao D.-I. Qian J. Chisholm D.A. Jordan D.B. Diner B.A. Nat. Struct. Biol. 2000; 7: 749-753Crossref PubMed Scopus (113) Google Scholar) have suggested that the main chain amide of Gly-318 inScenedesmus (the equivalent of Gly-260 ofSynechocystis 6803 CtpA, Fig. 3 b) contributes to the stabilization of a tetrahedral intermediate. We suggest that Asp-253 and Arg-255, two nearby charged residues, indirectly influence such a stabilization process, presumably an important step during the processing reaction catalyzed by CtpA. An unexpected and exciting finding in the current study is that Glu-316 is also critically important for CtpA activity. In particular, the replacement of Glu-316 with Gln, an uncharged residue with a similar size, abolishes the enzyme activity, whereas replacement of the same residue with Asp still maintains activity although at a reduced level (Fig. 5 and Table III). These data strongly suggest that the negative charge on Glu-316 is directly involved in the catalytic function of CtpA and stand in sharp contrast with the accepted Ser-Lys dyad mechanism of the related enzyme Tsp (28Keiler K.C. Sauer R.T. J. Biol. Chem. 1995; 270: 28864-28869Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). In this context, it is noteworthy that in the reported structure of ScenedesmusCtpA, the carboxyl group of Glu-375 (the equivalent of Glu-316 inSynechocystis CtpA) is in close proximity to both of the catalytic residues, Ser and Lys. As pointed out by Liao et al. (31Liao D.-I. Qian J. Chisholm D.A. Jordan D.B. Diner B.A. Nat. Struct. Biol. 2000; 7: 749-753Crossref PubMed Scopus (113) Google Scholar), in the resting state of the Scenedesmusenzyme, the carboxylate side chain of the Glu-375 residue forms hydrogen bonds with the main chain nitrogens of Gly-396 and Lys-397 and cannot directly interact with the ε-amino group of Lys-397. Although it is possible that the negative charge on this glutamate residue indirectly influences the proposed Ser-Lys dyad activity of the CtpA enzyme, our data also raise the possibility of a Ser-Lys-Glu triad mechanism that may be revealed when the structure of the CtpA enzyme with bound substrate (or substrate analog) is examined at a future time. In any case, further studies are needed to clarify the role of this glutamate residue in CtpA and its close relatives. In summary, we have developed a simple method to identify amino acid residues that are important for the in vivo activity of the CtpA protease in the cyanobacterium Synechocystis 6803. Current ongoing studies in our laboratories are focused on exploiting this system for a more detailed understanding of the catalytic mechanism of the CtpA enzyme. We thank Dr. V. V. Bartsevich for generating the ΔctpA Synechocystis 6803 mutant strain T795 and Prof. M. Ikeuchi for the antisera against the D1 protein." @default.
• W1992765157 created "2016-06-24" @default.
• W1992765157 creator A5054673253 @default.
• W1992765157 creator A5069043493 @default.
• W1992765157 creator A5069675476 @default.
• W1992765157 creator A5089441880 @default.
• W1992765157 date "2001-08-01" @default.
• W1992765157 modified "2023-09-30" @default.
• W1992765157 title "Amino Acid Residues That Are Critical for in VivoCatalytic Activity of CtpA, the Carboxyl-terminal Processing Protease for the D1 Protein of Photosystem II" @default.
• W1992765157 cites W116253160 @default.
• W1992765157 cites W1533138158 @default.
• W1992765157 cites W1533581019 @default.
• W1992765157 cites W1544949122 @default.
• W1992765157 cites W1961714136 @default.
• W1992765157 cites W1971701354 @default.
• W1992765157 cites W1974088209 @default.
• W1992765157 cites W1981443609 @default.
• W1992765157 cites W2003546739 @default.
• W1992765157 cites W2008786038 @default.
• W1992765157 cites W2014043594 @default.
• W1992765157 cites W2020679715 @default.
• W1992765157 cites W2026473446 @default.
• W1992765157 cites W2043370748 @default.
• W1992765157 cites W2045295491 @default.
• W1992765157 cites W2053362861 @default.
• W1992765157 cites W2071826159 @default.
• W1992765157 cites W2080680491 @default.
• W1992765157 cites W2084140927 @default.
• W1992765157 cites W2100837269 @default.
• W1992765157 cites W2108181866 @default.
• W1992765157 cites W2158031578 @default.
• W1992765157 cites W2180831060 @default.
• W1992765157 cites W2327437104 @default.
• W1992765157 cites W33855024 @default.
• W1992765157 cites W45895803 @default.
• W1992765157 doi "https://doi.org/10.1074/jbc.m102600200" @default.
• W1992765157 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11408480" @default.
• W1992765157 hasPublicationYear "2001" @default.
• W1992765157 type Work @default.
• W1992765157 sameAs 1992765157 @default.
• W1992765157 citedByCount "27" @default.
• W1992765157 countsByYear W19927651572012 @default.
• W1992765157 countsByYear W19927651572013 @default.
• W1992765157 countsByYear W19927651572014 @default.
• W1992765157 countsByYear W19927651572015 @default.
• W1992765157 countsByYear W19927651572016 @default.
• W1992765157 countsByYear W19927651572021 @default.
• W1992765157 countsByYear W19927651572022 @default.
• W1992765157 crossrefType "journal-article" @default.
• W1992765157 hasAuthorship W1992765157A5054673253 @default.
• W1992765157 hasAuthorship W1992765157A5069043493 @default.
• W1992765157 hasAuthorship W1992765157A5069675476 @default.
• W1992765157 hasAuthorship W1992765157A5089441880 @default.
• W1992765157 hasBestOaLocation W19927651571 @default.
• W1992765157 hasConcept C104317684 @default.
• W1992765157 hasConcept C154828652 @default.
• W1992765157 hasConcept C167625842 @default.
• W1992765157 hasConcept C181199279 @default.
• W1992765157 hasConcept C183688256 @default.
• W1992765157 hasConcept C185592680 @default.
• W1992765157 hasConcept C2776714187 @default.
• W1992765157 hasConcept C2779664074 @default.
• W1992765157 hasConcept C2994376932 @default.
• W1992765157 hasConcept C41008148 @default.
• W1992765157 hasConcept C515207424 @default.
• W1992765157 hasConcept C55493867 @default.
• W1992765157 hasConcept C71240020 @default.
• W1992765157 hasConcept C76155785 @default.
• W1992765157 hasConcept C80298142 @default.
• W1992765157 hasConceptScore W1992765157C104317684 @default.
• W1992765157 hasConceptScore W1992765157C154828652 @default.
• W1992765157 hasConceptScore W1992765157C167625842 @default.
• W1992765157 hasConceptScore W1992765157C181199279 @default.
• W1992765157 hasConceptScore W1992765157C183688256 @default.
• W1992765157 hasConceptScore W1992765157C185592680 @default.
• W1992765157 hasConceptScore W1992765157C2776714187 @default.
• W1992765157 hasConceptScore W1992765157C2779664074 @default.
• W1992765157 hasConceptScore W1992765157C2994376932 @default.
• W1992765157 hasConceptScore W1992765157C41008148 @default.
• W1992765157 hasConceptScore W1992765157C515207424 @default.
• W1992765157 hasConceptScore W1992765157C55493867 @default.
• W1992765157 hasConceptScore W1992765157C71240020 @default.
• W1992765157 hasConceptScore W1992765157C76155785 @default.
• W1992765157 hasConceptScore W1992765157C80298142 @default.
• W1992765157 hasIssue "32" @default.
• W1992765157 hasLocation W19927651571 @default.
• W1992765157 hasOpenAccess W1992765157 @default.
• W1992765157 hasPrimaryLocation W19927651571 @default.
• W1992765157 hasRelatedWork W1503334333 @default.
• W1992765157 hasRelatedWork W1644178486 @default.
• W1992765157 hasRelatedWork W2004312381 @default.
• W1992765157 hasRelatedWork W2009492938 @default.
• W1992765157 hasRelatedWork W2142376461 @default.
• W1992765157 hasRelatedWork W2418594535 @default.
• W1992765157 hasRelatedWork W2484549767 @default.
• W1992765157 hasRelatedWork W2491451478 @default.
• W1992765157 hasRelatedWork W42846034 @default.
• W1992765157 hasRelatedWork W47810773 @default.

• next