FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992879612> ?p ?o ?g. }

• W1992879612 endingPage "2739" @default.
• W1992879612 startingPage "2732" @default.
• W1992879612 abstract "JKTBP proteins are related to a family of heterogeneous nuclear ribonucleoproteins (hnRNPs) that function in mRNA biogenesis and mRNA metabolism. JKTBP proteins constituted of isoforms 1, 2, and 1Δ6 are localized in the nucleus. We show that the dominant form JKTBP1 shuttles between the nucleus and the cytoplasm and interacts with mRNA. Immunofluorescence microscopy and immunoblotting of the subcellular fractions and overexpression of JKTBP tagged with green fluorescent protein indicated that JKTBP1 and JKTBP1Δ6, but not JKTBP2, accumulate in the cytoplasm upon polymerase II transcription inhibition. After release from inhibition, the return of accumulated cytoplasmic JKTBP to the nucleus was temperature-dependent. In heterokaryons, green fluorescent protein-tagged JKTBP1 and JKTBP1Δ6 migrated from the HeLa nucleus to the mouse nucleus, but JKTBP2 did not. Using various JKTBP deletion mutants, the 25-residue C-terminal tail was identified as a shuttling sequence like M9. It is conserved in the C-terminal tails of hnRNP D/AUF1 and type A/B hnRNP/ABBP-1. Analysis of its sequence-specific interacting protein indicated that JKTBP nuclear import is mediated by the receptor transportin 1/karyopherin β2. UV cross-linking revealed the increased occurrence of JKTBP1 directly interacting with poly(A)+ RNA in the cytoplasm following actinomycin D treatment. We discuss a role of JKTBP in mRNA nuclear export. JKTBP proteins are related to a family of heterogeneous nuclear ribonucleoproteins (hnRNPs) that function in mRNA biogenesis and mRNA metabolism. JKTBP proteins constituted of isoforms 1, 2, and 1Δ6 are localized in the nucleus. We show that the dominant form JKTBP1 shuttles between the nucleus and the cytoplasm and interacts with mRNA. Immunofluorescence microscopy and immunoblotting of the subcellular fractions and overexpression of JKTBP tagged with green fluorescent protein indicated that JKTBP1 and JKTBP1Δ6, but not JKTBP2, accumulate in the cytoplasm upon polymerase II transcription inhibition. After release from inhibition, the return of accumulated cytoplasmic JKTBP to the nucleus was temperature-dependent. In heterokaryons, green fluorescent protein-tagged JKTBP1 and JKTBP1Δ6 migrated from the HeLa nucleus to the mouse nucleus, but JKTBP2 did not. Using various JKTBP deletion mutants, the 25-residue C-terminal tail was identified as a shuttling sequence like M9. It is conserved in the C-terminal tails of hnRNP D/AUF1 and type A/B hnRNP/ABBP-1. Analysis of its sequence-specific interacting protein indicated that JKTBP nuclear import is mediated by the receptor transportin 1/karyopherin β2. UV cross-linking revealed the increased occurrence of JKTBP1 directly interacting with poly(A)+ RNA in the cytoplasm following actinomycin D treatment. We discuss a role of JKTBP in mRNA nuclear export. heterogeneous nuclear ribonucleoproteins transportin 1 nuclear localization signal 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole glutathione S-transferase 4′,6-diamidino-2-phenylindole enhanced green fluorescent protein green fluorescent protein Pre-mRNAs transcribed in the nucleus are processed by a variety of processes into mRNAs that are exported into the cytoplasm for translation. In these processes, including alternative splicing, mRNA nuclear export, translational regulation, and mRNA turnover, >20 different heterogeneous nuclear ribonucleoproteins (hnRNPs)1are associated with pre-mRNA and mRNA (1Dreyfuss G. Matunis M.J. Piñol-Roma S. Burd C.G. Annu. Rev. Biochem. 1993; 62: 289-321Crossref PubMed Scopus (1333) Google Scholar, 2Krecic A.M. Swanson M.S. Curr. Opin. Cell Biol. 1999; 11: 363-371Crossref PubMed Scopus (712) Google Scholar, 3Weighardt F. Biamonti G. Riva S. Bioessays. 1996; 18: 747-756Crossref PubMed Scopus (180) Google Scholar). hnRNPs are groups of proteins consisting of multiple RNA-binding domains, each containing conserved RNP-1 and RNP-2 or hnRNP K homology motifs, and of divergent amino- and carboxyl-terminal domains (1Dreyfuss G. Matunis M.J. Piñol-Roma S. Burd C.G. Annu. Rev. Biochem. 1993; 62: 289-321Crossref PubMed Scopus (1333) Google Scholar, 2Krecic A.M. Swanson M.S. Curr. Opin. Cell Biol. 1999; 11: 363-371Crossref PubMed Scopus (712) Google Scholar, 3Weighardt F. Biamonti G. Riva S. Bioessays. 1996; 18: 747-756Crossref PubMed Scopus (180) Google Scholar). Although they are primarily nuclear, hnRNPs A1, A2, D, E, I, and K shuttle between the nucleus and the cytoplasm, whereas hnRNPs C and U are always retained in the nucleus (4Piñol-Roma S. Dreyfuss G. Science. 1991; 253: 312-314Crossref PubMed Scopus (173) Google Scholar, 5Piñol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (737) Google Scholar, 6Michael W.M. Eder P.S. Dreyfuss G. EMBO J. 1997; 16: 3587-3598Crossref PubMed Scopus (326) Google Scholar). The nuclear localization of hnRNPs A1 and A2 bearing the M9 shuttling sequence is mediated by the import receptor transportin 1 (Trn-1) and is polymerase II transcription-dependent (7Siomi H. Dreyfuss G. J. Cell Biol. 1995; 129: 551-560Crossref PubMed Scopus (444) Google Scholar, 8Weighardt F. Biamonti G. Riva S. J. Cell Sci. 1995; 108: 545-555Crossref PubMed Google Scholar, 9Michael W.M. Choi M. Dreyfuss G. Cell. 1995; 83: 415-422Abstract Full Text PDF PubMed Scopus (470) Google Scholar, 10Pollard V.W. Michael W.M. Nakielny S. Siomi M.C. Wang F. Dreyfuss G. Cell. 1996; 86: 985-994Abstract Full Text Full Text PDF PubMed Scopus (578) Google Scholar, 11Siomi M.C. Eder P.S. Kataoka N. Wan L. Liu Q. Dreyfuss G. J. Cell Biol. 1997; 138: 1181-1192Crossref PubMed Scopus (204) Google Scholar, 12Vautier D. Chesne P. Cunha C. Calado A. Renard J.P. Carmo-Fonseca M. J. Cell Sci. 2001; 114: 1521-1531PubMed Google Scholar, 13Chook Y.M. Blobel G. Nature. 1999; 399: 230-237Crossref PubMed Scopus (291) Google Scholar). The nuclear localization of hnRNP C bearing a classical nuclear localization signal (NLS) is transcription-independent (14Nakielny S. Dreyfuss G. J. Cell Biol. 1996; 134: 1365-1373Crossref PubMed Scopus (175) Google Scholar, 15Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar). Differences in their subcellular movements are connected with their different roles in cells (2Krecic A.M. Swanson M.S. Curr. Opin. Cell Biol. 1999; 11: 363-371Crossref PubMed Scopus (712) Google Scholar, 3Weighardt F. Biamonti G. Riva S. Bioessays. 1996; 18: 747-756Crossref PubMed Scopus (180) Google Scholar, 15Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar,16Shyu A.B. Wilkinson M.F. Cell. 2000; 102: 135-138Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Cytoplasmic shuttling hnRNP A1 is strongly correlated with mRNA nuclear export, and nuclear persisting hnRNP C is associated with prevention of pre-mRNA from moving to the cytoplasm (5Piñol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (737) Google Scholar, 14Nakielny S. Dreyfuss G. J. Cell Biol. 1996; 134: 1365-1373Crossref PubMed Scopus (175) Google Scholar, 15Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (649) Google Scholar, 17Izaurralde E. Jarmolowski A. Beisel C. Mattaj I.W. Dreyfuss G. Fischer U. J. Cell Biol. 1997; 137: 27-35Crossref PubMed Scopus (204) Google Scholar). We previously isolated JKTBP cDNAs by DNA affinity screening of human myeloid leukemia cDNA libraries using acis-element (JKT41) in intron 9 of the human myeloperoxidase gene (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar, 19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). JKTBP proteins are composed of two RNA-binding domains arranged tandemly and a glycine- and tyrosine-rich carboxyl-terminal domain and are more closely related to hnRNP D/AUF1 and type A/B hnRNP/ABBP-1 and more distantly related to hnRNPs A1 and A2 (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar, 19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). There are three isoforms of JKTBP, 1 and 2 (major forms) and 1Δ6 (a minor form), which are abundant in HeLa and HL-60 cells and in tissues, especially in brains and testes (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar, 19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar, 20Akagi T. Kamei D. Tsuchiya N. Nishina Y. Horiguchi H. Matsui M. Kamma H. Yamada M. Gene (Amst.). 2000; 245: 267-273Crossref PubMed Scopus (19) Google Scholar). JKTBP is abundant in nuclei, but its nuclear localization pathway is not yet known (20Akagi T. Kamei D. Tsuchiya N. Nishina Y. Horiguchi H. Matsui M. Kamma H. Yamada M. Gene (Amst.). 2000; 245: 267-273Crossref PubMed Scopus (19) Google Scholar). Recombinant JKTBP binds preferentially to poly(A) and poly(G) (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar) and supposedly to an AU-rich element of the 3′-untranslated region of mRNA (21Doi A. Shiosaka T. Takaoka Y. Yanagisawa K. Fujita S. Biochim. Biophys. Acta. 1998; 1396: 51-56Crossref PubMed Scopus (10) Google Scholar). This study reports that the predominant isoform JKTBP1 shuttles between the nucleus and the cytoplasm in a pathway consisting of a 25-residue shuttling sequence and Trn-1 and of the interaction of the cytoplasmic shuttling JKTBP with mRNA. HeLa cells were grown in RPMI 1640 medium at 37 °C as described (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar). Balb/c 3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% calf bovine serum (Dainippon Pharmaceutical) and 50 units/ml penicillin and 50 μg/ml streptomycin (Invitrogen). For inhibition of transcription and protein synthesis, HeLa cells were cultured with 5 μg/ml actinomycin D (Sigma) or 100 μm5,6-dichloro-1-β-d-ribofuranosylbenzimidazole (DRB; Calbiochem) for 3 h in the presence of 20 μg/ml cycloheximide (Sigma) (5Piñol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (737) Google Scholar). Approximately 104 HeLa cells were seeded on 15-mm glass coverslips and grown for 1 day. The cells were then fixed with 4% paraformaldehyde in Mg2+- and Ca2+-free phosphate-buffered saline at 4 °C for 30 min. The cells were incubated with 0.5% Triton X-100 for 3 min. After preincubation with Mg2+- and Ca2+-free phosphate-buffered saline containing 2% bovine serum albumin, 2% normal goat serum, and 0.1% Triton X-100, the cells were incubated with 4000-fold diluted rabbit anti-GST-JKTBP1 serum in the same buffer overnight at 4 °C (19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). The cells were incubated with 200-fold diluted goat anti-rabbit IgG (H + L)-biotin conjugate (Wako Pure Chemicals) in the same buffer and with 500-fold diluted streptavidin-Cy3 conjugate (Sigma) for 30 min at room temperature for each step. The nucleus was stained with 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI; Sigma) in Mg2+- and Ca2+-free phosphate-buffered saline. HeLa subcellular fractions were prepared as described (22Hel Z. Skamene E. Radzioch D. Mol. Cell. Biol. 1996; 16: 5579-5590Crossref PubMed Scopus (46) Google Scholar). Cells were harvested, washed, and suspended in buffer A (20 mm Tris-HCl (pH 7.6), 5 mmMgCl2, 1.5 mm KCl, 1 mmphenylmethanesulfonyl fluoride (Sigma), 2 mmdithiothreitol, and 0.1% Nonidet P-40). The cells were disrupted in a Dounce homogenizer by 20 strokes using a type A pestle. The homogenate was centrifuged at 760 × g at 4 °C for 3 min. The supernatant fluid was used as the cytoplasmic fraction. The pellet was resuspended in buffer B (20 mm Tris-HCl (pH 7.6), 5 mm MgCl2, 1.5 mm KCl, 75 mm NaCl, 175 mm sucrose, 1 mmphenylmethanesulfonyl fluoride, 2 mm dithiothreitol, and 0.5% Nonidet P-40) and sonicated in a Model UR-20P Handy Sonic (Tomy Seiko) at the maximum scale three times for 10-s periods. The resultant supernatant was used as the nuclear fraction. Proteins were resolved on SDS-10% polyacrylamide gel (23Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207018) Google Scholar) and electroblotted onto nitrocellulose membranes (BA85, Schleicher & Schüll). The membranes were incubated with 5000-fold diluted rabbit anti-GST-JKTBP1 serum at 4 °C overnight (19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). Bound IgG was detected using 20,000-fold diluted goat anti-rabbit IgG (H + L)-horseradish peroxidase conjugate (Bio-Rad). Signals were developed using the ECL system (PerkinElmer Life Sciences). The blots were reprobed successfully with 1000-fold diluted anti-hnRNP A1 monoclonal antibody 4B10 and anti-hnRNP C monoclonal antibody 4F4 (4Piñol-Roma S. Dreyfuss G. Science. 1991; 253: 312-314Crossref PubMed Scopus (173) Google Scholar). Bound IgG was detected using 2500-fold diluted sheep anti-mouse Ig-horseradish peroxidase conjugate (Amersham Biosciences, Inc.). Signal intensity was measured in a Max Fluor-S MultiImager (Bio-Rad). A pair of primers was designed for the 5′-end of the coding sequence of JKTBP1 (23 nucleotides, ATG GAG GAT ATG AAC GAG TAC AG) and the 3′-untranslated region sequence (TCA ATG TCG TCC TGC AAG ATG) linked with aSmaI linker at their 5′-ends. With the Titan One-tube reverse transcription-PCR system (Roche Molecular Biochemicals), the reaction mixture (50 μl) containing 500 ng of HL-60 total RNA and 0.4 μm primers was incubated at 50 °C for 30 min and then processed by PCR in 35 cycles. After agarose gel electrophoresis of the PCR product, the minor band DNA (810 bp) was further amplified with the same pair of primers and 5% dimethyl sulfoxide, cloned into pBluescript SK(−), and then sequenced. The sequence determined was identical to JKTBP1 except for deletion of nucleotides 773–943. The cDNA clone that compared with the JKTBP genomic sequence was identified as a variant lacking exon 6 and called JKTBP1Δ6 (19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). The JKTBP whole coding regions of pGEX-4T-JKTBP2, pGEX-4T-JKTBP1, and pGEX-4T-JKTBP1Δ6 were subcloned into the pEGFP-C vector (CLONTECH) (19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). The carboxyl-terminal deletion mutants JKTBP-(227–341), JKTBP-(227–398), and JKTBP-(226–408) were prepared by PCR with pJKTBP as a template and a pair of primers that were designed for the amino- and carboxyl-terminal 5–7-amino acid sequences with an EcoRI linker attached at their 5′-ends. Numbering of amino acid residues was adopted from JKTBP2 (see Fig. 3). The amino-terminal deletion mutants JKTBP-(226–420), JKTBP-(323–420), JKTBP-(396–420), and JKTBP-(398–420) were prepared by PCR with pJKTBP as a template and a pair of primers that were designed for the amino-terminal 5–6-amino acid sequences with an EcoRI linker attached at the 5′-end and for the 3′-untranslated region sequence (CCGGGTCGACTCGTCCTGCAAG, JKTBP 3′-untranslated region primer; italics indicate the SalI linker sequence). All of the PCR products were inserted into the pEGFP-C-GST vector, which was prepared by inserting the GST gene portion (XhoI-EcoRI fragments) of pGEX-6Ps (Amersham Biosciences, Inc.) into the pEGFP-C3 vector. Plasmids were purified by CsCl density gradient centrifugation (24Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual.2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 1.21-1.52Google Scholar). Various JKTBP deletion mutants, hnRNP A1, and hnRNP A1-(1–195)/UP1 were each expressed as a fusion protein with GST by culturing Escherichia coli BL21 cells carrying pGEX-6P2-JKTBP1, pGEX-4T-JKTBP deletion mutants, pGEX-6P2-hnRNP A1, and pGEX-6P3-UP1 with 0.1 mmisopropyl-β-d-thiogalactopyranoside for 10 h at 25 °C. The cells were collected and suspended in buffer C (150 mm NaCl, 10 mm Tris-HCl (pH 8.0), 5 mm EDTA, and 1 mm phenylmethanesulfonyl fluoride) containing 5 mm dithiothreitol, 1% Triton X-100, 1 m NaCl, and 200 μg/ml lysozyme. The cell suspension was sonicated 15 times for 10-s periods and then centrifuged at 12,000 × g for 30 min. The resultant supernatant was subjected to glutathione-Sepharose 4B affinity chromatography as described (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar, 19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar). For removing a GST portion from a fusion protein, a preparation (1 μg of protein) was digested with 0.01 unit of PreScission protease (Amersham Biosciences, Inc.), and the digest was passed through a glutathione-Sepharose column. Protein concentrations were determined by the method of Bradford (25Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215653) Google Scholar) with bovine serum albumin as a standard. HeLa cells (4 × 106 cells) suspended in 0.5 ml of RPMI 1640 medium were transfected with EGFP-JKTBP plasmids (50 μg) by electroporation (200 V, 1180-microfarad capacitance, and low ohm in a Cell-Porator, Invitrogen). About 1 × 105 cells were grown on a 15-mm glass coverslip, and the rest were grown for analysis of expression of EGFP-JKTBP fusion proteins. For in vivoimport assay, after 24 h, the subcellular distributions of EGFP-JKTBP fusion proteins were studied by fluorescence microscopy. Heterokaryon assay was performed as described by Cáceres et al. (26Cáceres J.F. Screaton G.R. Krainer A.R. Genes Dev. 1998; 12: 55-66Crossref PubMed Scopus (394) Google Scholar). The above-cultured cells were overlaid with 8 × 104 NIH3T3 cells and cultured for 3 h. They were then fused by exposure to 100 μl of 50% (w/v) polyethylene glycol 3400 (Polyscience) in RPMI 1640 medium for 2 min at 37 °C and, after washing, incubated in Dulbecco's modified Eagle's medium for 1 h in the presence of cycloheximide added to the culture 15 min before cell fusion. The cells were fixed and stained with 25 μg/ml Hoechst 33342 (Sigma) and studied by fluorescence microscopy. Fluorescent signals and cell images recorded with a cooled CCD camera (SenSys 1400, Photometrics Ltd.) were pseudo-colored. Expression of EGFP-JKTBP fusion proteins was checked by immunoblotting using rabbit anti-GFP serum (CLONTECH). HeLa cells on a 15-mm coverslip were permeabilized by treatment with 40 μg/ml digitonin transport buffer for 5 min as described by Adam et al. (27Adam S.A. Marr R.S. Gerace L. J. Cell Biol. 1990; 111: 807-816Crossref PubMed Scopus (767) Google Scholar). The import reaction mixture (20 μl) containing 8 μl of rabbit reticulocyte lysate (Promega), 0.1 μmGST-JKTBP-(226–420) as an import substrate with or without 3 μm competitor, and 5 μl of 4× transport buffer (80 mm HEPES (pH 7.3), 8 mm magnesium acetate, 20 mm sodium acetate, 440 mm potassium acetate, and 4 mm EGTA) containing 2 μg/ml each aprotinin, leupeptin, and pepstatin was overlaid on the cells and incubated at 30 °C for 30 min. After the reaction, the cells were fixed and probed with 0.5 μg/ml diluted rabbit anti-GST IgG overnight at 4 °C, and then bound IgG was detected using goat anti-rabbit IgG (H + L)-biotin conjugate and streptavidin-Cy3 conjugate as described above. Anti-GST IgG was prepared by GST-Sepharose affinity chromatography of anti-GST-peptidylarginine deiminase serum (28Nakashima K. Hagiwara T. Ishigami A. Nagata S. Asaga H. Kuramoto M. Senshu T. Yamada M. J. Biol. Chem. 1999; 274: 27786-27792Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar). Growing HeLa cells were harvested and disrupted in binding buffer (50 mm HEPES (pH 7.6), 150 mm NaCl, 75 mm potassium acetate, 5 mm magnesium acetate, 0.1 mmphenylmethanesulfonyl fluoride, and 0.1% Nonidet P-40) by sonication 15 times for 10-s periods; and after centrifugation at 14,000 ×g for 10 min, the resultant supernatant was used to interact with immobilized JKTBP. GST-tagged JKTBP produced by E. coliin the extract was immobilized on glutathione-Sepharose beads (20-μl packed volume) by mixing at 4 °C for 1 h, and the beads were washed three times with buffer C containing 1 m NaCl and 5 mm dithiothreitol and twice with binding buffer without Nonidet P-40. The beads were mixed with HeLa cell extract (6 mg) in a total volume of 1.5 ml of binding buffer without Nonidet P-40 at 4 °C for 4 h and washed with binding buffer containing 200 mm NaCl. Bound proteins were eluted by boiling in SDS sample buffer and were analyzed by immunoblotting using 1000-fold diluted anti-transportin monoclonal antibody D45 (29Siomi M.C. Fromont M. Rain J.C. Wan L. Wang F. Legrain P. Dreyfuss G. Mol. Cell. Biol. 1998; 18: 4141-4148Crossref PubMed Scopus (48) Google Scholar). UV cross-linking was performed as described by Piñol-Roma et al. (30Piñol-Roma S. Adam S.A. Choi Y.D. Dreyfuss G. Methods Enzymol. 1989; 180: 410-418Crossref PubMed Scopus (54) Google Scholar). HeLa cells grown on a 10-cm dish were washed, immersed in 2 ml of cold Mg2+- and Ca2+-free phosphate-buffered saline containing 1 mm CaCl2and 0.5 mm MgCl2, and irradiated with UV light at 254 nm at a dose of 65 mJ/cm2. The cells were replaced in buffer A with 10 mm MgCl2, 10 mmvanadyl adenosine, 0.5% Nonidet P-40, 1% Tween 40, and 0.5% sodium deoxycholate. The cells were scraped off and homogenized by four passages thorough a 25-gauze needle with a syringe. After centrifugation at 3000 × g for 5 min, the resultant supernatant was brought to 1% SDS, 1% 2-mercaptoethanol, and 10 mm EDTA and called the cytoplasmic fraction. The pellet was suspended in buffer B and 10 mm vanadyl adenosine, sonicated four times for 10-s periods, and centrifuged at 16,000 × g for 10 min. The resultant supernatant was adjusted to 0.5% SDS, 1% 2-mercaptoethanol, and 10 mm EDTA and called the nuclear fraction. Cytoplasmic and nuclear poly(A)+ RNAs were prepared by two repeats of oligo(dT)-cellulose column chromatography (0.18 g; Collaborative Research), and the precipitated RNAs were digested with a mixture of RNase A1 (25 μg/ml) and RNase T1 (0.25 μg/ml) at 37 °C for 30 min. The digests were analyzed by immunoblotting using anti-JKTBP serum. For examination of whether the nuclear localization of JKTBP is perturbed by RNA synthesis inhibition, HeLa cells were treated with or without actinomycin D for 3 h in the presence of cycloheximide and stained with anti-JKTBP serum. As shown in Fig.1A, in the untreated cells, the JKTBP signal was mostly confined to the nucleus stained with DAPI (panel a), whereas in the treated cells, the JKTBP signal was found uniformly throughout the cells (panel b), indicating that RNA synthesis inhibition results in cytoplasmic accumulation of JKTBP. Next, we treated cells with a reversible inhibitor of RNA synthesis, DRB (Fig. 1B). Like actinomycin D, DRB also resulted in JKTBP accumulation in the cytoplasm (panels a and b). After removal of the drug by culturing cells at 37 °C for 1 h, the cytoplasmic JKTBP signal decreased, and the signal was found only in the nucleus, like that in the untreated cells, whereas at 4 °C, the cytoplasmic signal persisted (panels c and d). These results suggest that JKTBP shuttles between the cytoplasm and the nucleus. To further examine the two JKTBP1 and JKTBP2 isoforms for subcellular localization in cells treated with or without actinomycin D, we prepared their cytoplasmic and nuclear fractions and analyzed them by immunoblotting using anti-JKTBP serum. On the blots of whole cell lysates, two major bands of ∼53 kDa (JKTBP2) and 38 kDa (JKTBP1) and at least two minor bands of ∼48 and 36 kDa were detected. No appreciable difference in the JKTBP contents between the untreated and treated cells was observed (Fig. 1C). In the untreated cells, the relative amounts of JKTBP1 recovered in the cytoplasmic and nuclear fractions were 25 and 75%, respectively (Fig. 1C,upper panel, lanes 1–3). In the treated cells, the percentage of JKTBP1 in the cytoplasmic fraction increased to 50% (lanes 4–6). Unlike JKTBP1, JKTBP2 was recovered only in the nuclear fractions from the untreated and treated cells. The minor proteins of 48 and 38 kDa became obscure in the subcellular fractionation. hnRNPs A1 and C as controls for polymerase II transcription-dependent and -independent nuclear localization, respectively, were detected on the same blots. Upon actinomycin D treatment, hnRNP A1 in the cytoplasm increased (middle panel), whereas hnRNP C was always recovered only in the nuclear fraction of the untreated and treated cells (lower panel), as reported previously (5Piñol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (737) Google Scholar). These results indicated that the increased amount of cytoplasmic JKTBP1 was not due to leakage from the nucleus. In the DRB-treated cells, cytoplasmic JKTBP increased compared with that in the untreated cells (Fig. 1D,lanes 1–6). Upon deprivation of the drug, the increased cytoplasmic JKTBP1 decreased to a low level at 37 °C, but not at 4 °C (lanes 8–12). This indicated that the accumulated cytoplasmic JKTBP1 was re-imported into the nucleus. The three JKTBP isoforms are depicted in Fig. 2A. JKTBP1 and JKTBP2 have been characterized previously (18Tsuchiya N. Kamei D. Takano A. Matsui T. Yamada M. J. Biochem. (Tokyo). 1998; 123: 499-507Crossref PubMed Scopus (28) Google Scholar, 19Kamei D. Tsuchiya N. Yamazaki M. Meguro H. Yamada M. Gene (Amst.). 1999; 228: 13-22Crossref PubMed Scopus (24) Google Scholar), and JKTBP1Δ6 was characterized by cDNA cloning in this work. A JKTBP1Δ6 cDNA encodes a 244-residue polypeptide (27,161 Da) and is generated by alternative splicing of exon 6. JKTBP1Δ6 produced by in vitro transcription and translation was ∼36 kDa as determined by SDS-PAGE (data not shown). JKTBP1Δ6 produced by cells was found as a minor 36-kDa band on the immunoblots (Fig. 1C). To determine the nucleocytoplasmic movements of the three distinct isoforms, we prepared plasmid constructs consisting of three JKTBP cDNAs fused to a 3′-end of the EGFP gene and used them to transfect HeLa cells. After 22 h of cell cultivation, expression of the three EGFP-tagged JKTBP isoforms was confirmed as proteins with the expected molecular masses on the immunoblots probed with anti-GFP serum (Fig.2B). Parallel cultures were incubated with or without actinomycin D in the presence of cycloheximide for 3 h, and then their subcellular localization were examined by fluorescence microscopy. The fluorescent signal of control EGFP was found diffusely in the cytoplasm and the nucleus in the untreated and treated cells (Fig. 2, C and D, panel a). The signals of EGFP-tagged JKTBP1 and JKTBP1Δ6 were confined solely to the nucleus in the untreated cells (Fig. 2C, panels c and d), whereas following actinomycin D treatment, the JKTBP1 and JKTBP1Δ6 signals appeared to be distributed evenly over the cells (Fig. 2D, panels c andd). The JKTBP2 signal was always retained in the nucleus before and after treatment (Fig. 2, C and D,panel b). These results indicated that JKTBP1 and JKTBP1Δ6 differed in nucleocytoplasmic movement from JKTBP2. First, we searched for potential NLSs of JKTBP by sequence homology. Sequence homologous to neither basic type NLSs nor the nucleocytoplasmic shuttling sequence of M9 was present in JKTBP. To delineate an NLS sequence of JKTBP, N- and C-terminal deletion mutants were prepared by PCR with parent JKTBP cDNAs as a template. All of the mutants are represented according to JKTBP2 numbering (Fig. 3A). The mutant cDNAs were fused to the 3′-end of an EGFP-GST gene encoding an EGFP-GST fusion protein. In these constructs, a tripartite fusion gene of EGFP, GST, and mutant genes rather than a bipartite fusion gene of EGFP and mutant genes was constructed because the smallest mutant gene examined encoded a 23-residue peptide. These constructs were used to transfect HeLa cells and were expressed for 22 h. Expression of all EGFP-GST mutant fusion proteins with the expected sizes was confirmed by immunoblotting using anti-GFP serum (Fig. 3B). In parallel cultures, the subcellular localization of mutant proteins was studied by fluorescence microscopy (Fig. 3C). The fluorescent signal of control EGFP-GST (∼58 kDa) spread out from the cytoplasm to the nucleus (panel a). In the C-terminal deletion mutants 227–341, 227–398, and 226–408, the signals were all confined to the cytoplasm (panels b–d), indicating that the 12 C-terminal residues are indispensable for the nuclear localization of JKTBP. In the N-terminal deletion mutants 226–420, 323–420, 396–420, and 398–420, the signals were located in the nucleus (panels e–h). These results indicate that the 23-residue C terminus has NLS activity. A single amino acid substitution of Gly404 with Ala in JKTBP-(226–420) reduced its nuclear localization weakly, but significantly (data not shown). We next examined whether the NLS sequence has nuclear export signal activity. For heterokaryon assay, HeLa cells were labeled with EGFP-tagged JKTBP and EGFP-GST-tagged N-terminal deletion mutants and then fused with unlabeled mouse NIH3T3 cells. After cell fusion, cell culture was continued for 1 h in the absence of new protein synthesis. In the het" @default.
• W1992879612 created "2016-06-24" @default.
• W1992879612 creator A5005363653 @default.
• W1992879612 creator A5033472438 @default.
• W1992879612 creator A5047228096 @default.
• W1992879612 creator A5058630840 @default.
• W1992879612 creator A5065528065 @default.
• W1992879612 creator A5066224161 @default.
• W1992879612 date "2002-01-01" @default.
• W1992879612 modified "2023-09-30" @default.
• W1992879612 title "Identification of the Nucleocytoplasmic Shuttling Sequence of Heterogeneous Nuclear Ribonucleoprotein D-like Protein JKTBP and Its Interaction with mRNA" @default.
• W1992879612 cites W1044509411 @default.
• W1992879612 cites W1508541438 @default.
• W1992879612 cites W1675243257 @default.
• W1992879612 cites W1957196271 @default.
• W1992879612 cites W1967034105 @default.
• W1992879612 cites W1973052124 @default.
• W1992879612 cites W1973178590 @default.
• W1992879612 cites W1978827094 @default.
• W1992879612 cites W1979906352 @default.
• W1992879612 cites W1983722036 @default.
• W1992879612 cites W1994852911 @default.
• W1992879612 cites W2005100774 @default.
• W1992879612 cites W2008837951 @default.
• W1992879612 cites W2010646886 @default.
• W1992879612 cites W2013994555 @default.
• W1992879612 cites W2014306050 @default.
• W1992879612 cites W2014319709 @default.
• W1992879612 cites W2016493017 @default.
• W1992879612 cites W2033932199 @default.
• W1992879612 cites W2035052662 @default.
• W1992879612 cites W2037534409 @default.
• W1992879612 cites W2042704408 @default.
• W1992879612 cites W2045845081 @default.
• W1992879612 cites W2051948296 @default.
• W1992879612 cites W2062958036 @default.
• W1992879612 cites W2073409278 @default.
• W1992879612 cites W2077543321 @default.
• W1992879612 cites W2080489609 @default.
• W1992879612 cites W2083340704 @default.
• W1992879612 cites W2100837269 @default.
• W1992879612 cites W2101679570 @default.
• W1992879612 cites W2113031608 @default.
• W1992879612 cites W2118627132 @default.
• W1992879612 cites W2124437615 @default.
• W1992879612 cites W2137204877 @default.
• W1992879612 cites W2138647063 @default.
• W1992879612 cites W2141238215 @default.
• W1992879612 cites W2143566830 @default.
• W1992879612 cites W2143814486 @default.
• W1992879612 cites W2146052851 @default.
• W1992879612 cites W2160604432 @default.
• W1992879612 cites W2164134985 @default.
• W1992879612 cites W4293247451 @default.
• W1992879612 doi "https://doi.org/10.1074/jbc.m108477200" @default.
• W1992879612 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11705999" @default.
• W1992879612 hasPublicationYear "2002" @default.
• W1992879612 type Work @default.
• W1992879612 sameAs 1992879612 @default.
• W1992879612 citedByCount "64" @default.
• W1992879612 countsByYear W19928796122012 @default.
• W1992879612 countsByYear W19928796122013 @default.
• W1992879612 countsByYear W19928796122014 @default.
• W1992879612 countsByYear W19928796122015 @default.
• W1992879612 countsByYear W19928796122018 @default.
• W1992879612 countsByYear W19928796122019 @default.
• W1992879612 countsByYear W19928796122020 @default.
• W1992879612 countsByYear W19928796122021 @default.
• W1992879612 countsByYear W19928796122022 @default.
• W1992879612 countsByYear W19928796122023 @default.
• W1992879612 crossrefType "journal-article" @default.
• W1992879612 hasAuthorship W1992879612A5005363653 @default.
• W1992879612 hasAuthorship W1992879612A5033472438 @default.
• W1992879612 hasAuthorship W1992879612A5047228096 @default.
• W1992879612 hasAuthorship W1992879612A5058630840 @default.
• W1992879612 hasAuthorship W1992879612A5065528065 @default.
• W1992879612 hasAuthorship W1992879612A5066224161 @default.
• W1992879612 hasBestOaLocation W19928796121 @default.
• W1992879612 hasConcept C104317684 @default.
• W1992879612 hasConcept C105580179 @default.
• W1992879612 hasConcept C116834253 @default.
• W1992879612 hasConcept C128943096 @default.
• W1992879612 hasConcept C185592680 @default.
• W1992879612 hasConcept C2778112365 @default.
• W1992879612 hasConcept C2780114586 @default.
• W1992879612 hasConcept C2780723820 @default.
• W1992879612 hasConcept C2909472194 @default.
• W1992879612 hasConcept C54757728 @default.
• W1992879612 hasConcept C55493867 @default.
• W1992879612 hasConcept C59822182 @default.
• W1992879612 hasConcept C67705224 @default.
• W1992879612 hasConcept C70721500 @default.
• W1992879612 hasConcept C75934600 @default.
• W1992879612 hasConcept C86803240 @default.
• W1992879612 hasConcept C95444343 @default.
• W1992879612 hasConceptScore W1992879612C104317684 @default.
• W1992879612 hasConceptScore W1992879612C105580179 @default.
• W1992879612 hasConceptScore W1992879612C116834253 @default.

• next