FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1992994326> ?p ?o ?g. }

• W1992994326 endingPage "11124" @default.
• W1992994326 startingPage "11115" @default.
• W1992994326 abstract "SPI-B is a B lymphocyte-specific Ets transcription factor that shares a high degree of similarity with PU.1/SPI-1. In direct contrast to PU.1 −/−mice that die in utero and lack monocytes, neutrophils, B cells, and T cells, Spi-B −/− mice are viable and exhibit a severe B cell proliferation defect. Since PU.1 is expressed at wild type levels in Spi-B −/− B cells, the mutant mice provide genetic evidence that SPI-B and PU.1 have at least some non-redundant roles in B lymphocytes. To begin to understand the molecular basis for these defects, we delineated functional domains of SPI-B for comparison to those of PU.1. By using a heterologous co-transfection system, we identified two independent transactivation domains in the N terminus of SPI-B. Interestingly, only one of these domains (amino acids 31–61), a proline/serine/threonine-rich region, unique among Ets proteins, is necessary for transactivation of the immunoglobulin λ light chain enhancer. This transactivation motif is in marked contrast to PU.1, which contains acidic and glutamine-rich domains. In addition, we describe a functional PU.1 site within the c-FES promoter which SPI-B fails to bind efficiently and transactivate. Finally, we show that SPI-B interacts with the PU.1 cofactors Pip, TBP, c-Jun and with lower affinity to nuclear factor interleukin-6β and retinoblastoma. Taken together, these data suggest that SPI-B binds DNA with a different affinity for certain sites than PU.1 and harbors different transactivation domains. We conclude that SPI-B may activate unique target genes in B lymphocytes and interact with unique, although currently unidentified, cofactors. SPI-B is a B lymphocyte-specific Ets transcription factor that shares a high degree of similarity with PU.1/SPI-1. In direct contrast to PU.1 −/−mice that die in utero and lack monocytes, neutrophils, B cells, and T cells, Spi-B −/− mice are viable and exhibit a severe B cell proliferation defect. Since PU.1 is expressed at wild type levels in Spi-B −/− B cells, the mutant mice provide genetic evidence that SPI-B and PU.1 have at least some non-redundant roles in B lymphocytes. To begin to understand the molecular basis for these defects, we delineated functional domains of SPI-B for comparison to those of PU.1. By using a heterologous co-transfection system, we identified two independent transactivation domains in the N terminus of SPI-B. Interestingly, only one of these domains (amino acids 31–61), a proline/serine/threonine-rich region, unique among Ets proteins, is necessary for transactivation of the immunoglobulin λ light chain enhancer. This transactivation motif is in marked contrast to PU.1, which contains acidic and glutamine-rich domains. In addition, we describe a functional PU.1 site within the c-FES promoter which SPI-B fails to bind efficiently and transactivate. Finally, we show that SPI-B interacts with the PU.1 cofactors Pip, TBP, c-Jun and with lower affinity to nuclear factor interleukin-6β and retinoblastoma. Taken together, these data suggest that SPI-B binds DNA with a different affinity for certain sites than PU.1 and harbors different transactivation domains. We conclude that SPI-B may activate unique target genes in B lymphocytes and interact with unique, although currently unidentified, cofactors. Hematopoiesis represents the coordinated development of all blood cell lineages (granulocytes, monocytes, lymphocytes, erythrocytes, and platelets), which arise from a self-renewing, pluripotent stem cell. This complex developmental process is guided by interactions between extracellular signals, cell-surface receptors, cell-cell interactions, and the regulation of gene expression by transcription factors (reviewed in Refs. 1Shivdasani R.A. Orkin S.H. Blood. 1996; 87: 1025-4039Crossref Google Scholar and 2Orkin S.H. Curr. Opin. Cell Biol. 1995; 7: 870-877Crossref PubMed Scopus (134) Google Scholar). Transcription factors play a crucial role in hematopoiesis due to their ability to regulate gene expression controlling the eventual differentiation and development of distinct cell types. One family of transcription factors thought to play a pivotal role in hematopoiesis is the Ets DNA-binding proteins. This family of transcription factors consists of approximately 30 different proteins that bear a high degree of similarity to the founding member, Ets-1. Ets proteins are monomeric transcription factors that bind to the purine-rich element of GGA(A/T) through their Ets domain (3Macleod K. Leprince D. Stehelin D. Trends Biochem. Sci. 1992; 17: 251-256Abstract Full Text PDF PubMed Scopus (289) Google Scholar, 4Nye J.A. Petersen J.M. Gunther C.V. Jonsen M.D. Graves B.J. Genes Dev. 1992; 6: 975-990Crossref PubMed Scopus (311) Google Scholar, 5Gunther C.V. Nye J.A. Bryner R.S. Graves B.J. Genes Dev. 1990; 4: 667-679Crossref PubMed Scopus (119) Google Scholar, 6Leprince D. Crepieux P. Stehelin D. Oncogene. 1992; 7: 9-17PubMed Google Scholar). Based upon differences within the Ets and other domains, Ets proteins can be divided into a series of subfamilies consisting of the Ets-1, PU.1, Elf-1, Fli-1, and GABPα groups. The PU.1 subgroup consists of PU.1/SPI-1 and SPI-B and represents the most divergent members of the Ets family due to many differences in the Ets domain (40% similarity to Ets-1). In contrast to other Ets proteins, both PU.1 and SPI-B can bind the non-canonical DNA sequence GCAGAA (7Shin M.K. Koshland M.E. Genes Dev. 1993; 7: 2006-2015Crossref PubMed Scopus (123) Google Scholar). In addition to having a distinct DNA binding domain compared with other Ets family members, PU.1 possesses several protein motifs unique among Ets proteins (Fig. 1). PU.1 has a C-terminal Ets domain that is involved in both DNA binding as well as protein-protein interactions involving AP-1 family members (8Basuyaux J.P. Ferreira E. Stehelin D. Buttice G. J. Biol. Chem. 1997; 272: 26188-26195Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 9Bassuk A.G. Leiden J.M. Immunity. 1995; 3: 223-237Abstract Full Text PDF PubMed Scopus (173) Google Scholar), NF-IL6β 1The abbreviations used are: NF-IL6β, nuclear factor interleukin-6β; Rb, retinoblastoma protein; PEST, proline-, glutamic acid-, serine-, and threonine-rich, aa, amino acid(s); B4, tetramerized λB element; TK, herpes simplex virus thymidine kinase promoter; GH, human growth hormone protein; PCR, polymerase chain reaction; CMV, cytomegalovirus; GAL4, GAL4 DNA binding domain; EMSA, electrophoretic mobility shift assay; GST, glutathioneS-transferase protein; IVT, in vitro transcribed and translated protein; HA, the hemagglutinin epitope YPYDVPPDYA; PAGE, polyacrylamide gel electrophoresis.1The abbreviations used are: NF-IL6β, nuclear factor interleukin-6β; Rb, retinoblastoma protein; PEST, proline-, glutamic acid-, serine-, and threonine-rich, aa, amino acid(s); B4, tetramerized λB element; TK, herpes simplex virus thymidine kinase promoter; GH, human growth hormone protein; PCR, polymerase chain reaction; CMV, cytomegalovirus; GAL4, GAL4 DNA binding domain; EMSA, electrophoretic mobility shift assay; GST, glutathioneS-transferase protein; IVT, in vitro transcribed and translated protein; HA, the hemagglutinin epitope YPYDVPPDYA; PAGE, polyacrylamide gel electrophoresis. (C/EBPδ) (10Nagulapalli S. Pongubala J.M. Atchison M.L. J. Immunol. 1995; 155: 4330-4338PubMed Google Scholar), and other Ets proteins (8Basuyaux J.P. Ferreira E. Stehelin D. Buttice G. J. Biol. Chem. 1997; 272: 26188-26195Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 11Rao E. Dang W. Tian G. Sen R. J. Biol. Chem. 1997; 272: 6722-6732Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 12Erman B. Sen R. EMBO J. 1996; 15: 4565-4575Crossref Scopus (27) Google Scholar). Immediately adjacent to the Ets domain is a proline-, glutamic acid-, serine-, and threonine-rich (PEST) region, which is involved in protein-protein interactions with the lymphoid-specific co-activator Pip/IRF4/NF-EM5 and other IRF proteins (13Eisenbeis C.F. Singh H. Storb U. Genes Dev. 1995; 9: 1377-1387Crossref PubMed Scopus (411) Google Scholar, 14Pongubala J.M. Nagulapalli S. Klemsz M.J. McKercher S.R. Maki R.A. Atchison M.L. Mol. Cell. Biol. 1992; 12: 368-378Crossref PubMed Scopus (309) Google Scholar), but does not destabilize protein as other PEST sequences do (15Rogers S. Wells R. Rechsteiner M. Science. 1986; 234: 364-368Crossref PubMed Scopus (1936) Google Scholar). The PU.1-Pip interaction is crucial for the transcription of immunoglobulin light chain loci (13Eisenbeis C.F. Singh H. Storb U. Genes Dev. 1995; 9: 1377-1387Crossref PubMed Scopus (411) Google Scholar) and CD20 (16Himmelmann A. Riva A. Wilson G.L. Lucas B.P. Thevenin C. Kehrl J.H. Blood. 1997; 90: 3984-3995Crossref PubMed Google Scholar) and requires PU.1 binding to DNA with subsequent recruitment of Pip via a phosphorylated serine residue (Ser-148) in the PEST region (17Pongubala J.M. Van Beveren C. Nagulapalli S. Klemsz M.J. McKercher S.R. Maki R.A. Atchison M.L. Science. 1993; 259: 1622-1625Crossref PubMed Scopus (240) Google Scholar, 18Brass A.L. Kehrli E. Eisenbeis C.F. Storb U. Singh H. Genes Dev. 1996; 10: 2335-2347Crossref PubMed Scopus (207) Google Scholar). At the N terminus of PU.1 resides a series of three independent transcriptional activation domains, including two acidic subdomains and one glutamine-rich domain (19Klemsz M.J. Maki R.A. Mol. Cell. Biol. 1996; 16: 390-397Crossref PubMed Scopus (82) Google Scholar). In addition to activating transcription, the N terminus of the protein has been shown to interact with Rb and TBP (20Hagemeier C. Bannister A.J. Cook A. Kouzarides T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1580-1584Crossref PubMed Scopus (272) Google Scholar). In contrast to PU.1, very little is known about the functional domains of SPI-B (Fig. 1). The two proteins are 60% similar overall, with the N terminus of SPI-B being highly diverged from PU.1 (20% similarity) but presumed to contain the transcriptional activation domain. The SPI-B Ets domain is 90% similar to that of PU.1, whereas the PEST region exhibits 70% similarity (21Ray D. Bosselut R. Ghysdael J. Mattei M.G. Tavitian A. Moreau-Gachelin F. Mol. Cell. Biol. 1992; 12: 4297-4304Crossref PubMed Scopus (143) Google Scholar). SPI-B binds to the same DNA elements as PU.1 in vitro and interacts with Pip to transactivate a target site in the λ enhancer (21Ray D. Bosselut R. Ghysdael J. Mattei M.G. Tavitian A. Moreau-Gachelin F. Mol. Cell. Biol. 1992; 12: 4297-4304Crossref PubMed Scopus (143) Google Scholar, 22Ray-Gallet D. Mao C. Tavitian A. Moreau-Gachelin F. Oncogene. 1995; 11: 303-313PubMed Google Scholar, 23Su G.H. Ip H.S. Cobb B.S. Lu M.M. Chen H.M. Simon M.C. J. Exp. Med. 1996; 184: 203-214Crossref PubMed Scopus (90) Google Scholar). Furthermore, SPI-B has been shown to bind Rb via its N terminus which requires a single threonine residue (Thr-56) whose phosphorylation by ERK1 abolishes this interaction (24Mao C. Ray-Gallet D. Tavitian A. Moreau-Gachelin F. Oncogene. 1996; 12: 863-873PubMed Google Scholar). It has not been determined if SPI-B can also bind to other PU.1 interacting proteins such as c-Jun, TBP, NF-IL6β, or other Ets proteins. The highly related PU.1 and SPI-B proteins share overlapping patterns of expression. PU.1 is expressed in granulocytes, monocytes, immature erythroid cells, mast cells, megakaryocytes, B cells, and early in T cells (21Ray D. Bosselut R. Ghysdael J. Mattei M.G. Tavitian A. Moreau-Gachelin F. Mol. Cell. Biol. 1992; 12: 4297-4304Crossref PubMed Scopus (143) Google Scholar, 25Klemsz M.J. McKercher S.R. Celada A. Van Beveren C. Maki R.A. Cell. 1990; 61: 113-124Abstract Full Text PDF PubMed Scopus (754) Google Scholar, 26Hromas R. Orazi A. Neiman R.S. Maki R. Van Beveran C. Moore J. Klemsz M. Blood. 1993; 82: 2998-3004Crossref PubMed Google Scholar). Although previously thought to have a similar tissue distribution as PU.1 (21Ray D. Bosselut R. Ghysdael J. Mattei M.G. Tavitian A. Moreau-Gachelin F. Mol. Cell. Biol. 1992; 12: 4297-4304Crossref PubMed Scopus (143) Google Scholar), it has been shown that SPI-B is expressed only in B cells and immature T cells but not monocytes or neutrophils (23Su G.H. Ip H.S. Cobb B.S. Lu M.M. Chen H.M. Simon M.C. J. Exp. Med. 1996; 184: 203-214Crossref PubMed Scopus (90) Google Scholar, 27Chen H.M. Zhang P. Voso M.T. Hohaus S. Gonzalez D.A. Glass C.K. Zhang D.E. Tenen D.G. Blood. 1995; 85: 2918-2928Crossref PubMed Google Scholar). PU.1-binding sites are important for the transcriptional activity of a large number of myeloid genes such asCD11b (28Chen H.M. Pahl H.L. Scheibe R.J. Zhang D.E. Tenen D.G. J. Biol. Chem. 1993; 268: 8230-8239Abstract Full Text PDF PubMed Google Scholar, 29Pahl H.L. Scheibe R.J. Zhang D.E. Chen H.M. Galson D.L. Maki R.A. Tenen D.G. J. Biol. Chem. 1993; 268: 5014-5020Abstract Full Text PDF PubMed Google Scholar), MCSF-R (30Zhang D.E. Hetherington C.J. Chen H.M. Tenen D.G. Mol. Cell. Biol. 1994; 14: 373-381Crossref PubMed Scopus (53) Google Scholar), interleukin 1β (31Kominato Y. Galson D. Waterman W.R. Webb A.C. Auron P.E. Mol. Cell. Biol. 1995; 15: 59-68Crossref Google Scholar), GM-CSFR (32Hohaus S. Petrovick M.S. Voso M.T. Sun Z. Zhang D.E. Tenen D.G. Mol. Cell. Biol. 1995; 15: 5830-5845Crossref PubMed Google Scholar), scavenger receptor (33Moulton K.S. Semple K. Wu H. Glass C.K. Mol. Cell. Biol. 1994; 14: 4408-4418Crossref PubMed Scopus (160) Google Scholar), and macrophage mannose receptor (34Eichbaum Q. Heney D. Raveh D. Chung M. Davidson M. Epstein J. Ezekowitz R.A. Blood. 1997; 90: 4135-4143Crossref PubMed Google Scholar) as well as B cell targets such as the immunoglobulin light chain loci (14Pongubala J.M. Nagulapalli S. Klemsz M.J. McKercher S.R. Maki R.A. Atchison M.L. Mol. Cell. Biol. 1992; 12: 368-378Crossref PubMed Scopus (309) Google Scholar, 35Eisenbeis C.F. Singh H. Storb U. Mol. Cell. Biol. 1993; 13: 6452-6461Crossref PubMed Google Scholar), mb-1 (36Feldhaus A.L. Mbangkollo D. Arvin K.L. Klug C.A. Singh H. Mol. Cell. Biol. 1992; 12: 1126-1133Crossref PubMed Scopus (57) Google Scholar), μ heavy chain (37Nelsen B. Tian G. Erman B. Gregoire J. Maki R. Graves B. Sen R. Science. 1993; 261: 82-86Crossref PubMed Scopus (196) Google Scholar), and J chain (7Shin M.K. Koshland M.E. Genes Dev. 1993; 7: 2006-2015Crossref PubMed Scopus (123) Google Scholar). In contrast to PU.1, the only confirmed mammalian target gene of SPI-B is the λ2–4enhancer (23Su G.H. Ip H.S. Cobb B.S. Lu M.M. Chen H.M. Simon M.C. J. Exp. Med. 1996; 184: 203-214Crossref PubMed Scopus (90) Google Scholar). To address the in vivo functional differences between PU.1 and SPI-B, we have generated mice with targeted mutations in both loci.PU.1 −/− mice die at approximately day 16.5 of gestation (38Scott E.W. Simon M.C. Anastasi J. Singh H. Science. 1994; 265: 1573-1577Crossref PubMed Scopus (1266) Google Scholar) and lack monocytes, neutrophils, B, and T cells but do possess erythroid cells, megakaryocytes, and immature mast cells. Mice with a different PU.1 −/− allele display a similar but less severe phenotype (39Henkel G.W. McKercher S.R. Yamamoto H. Anderson K.L. Oshima R.G. Maki R.A. Blood. 1996; 88: 2917-2926Crossref PubMed Google Scholar, 40McKercher S.R. Torbett B.E. Anderson K.L. Henkel G.W. Vestal D.J. Baribault H. Klemsz M. Feeney A.J. Wu G.E. Paige C.J. Maki R.A. EMBO J. 1996; 15: 5647-5658Crossref PubMed Scopus (914) Google Scholar, 41Anderson K.L. Smith K.A. Conners K. McKercher S.R. Maki R.A. Torbett B.E. Blood. 1998; 91: 3702-3710Crossref PubMed Google Scholar). The loss of both lymphoid and myeloid cells suggests that PU.1 is required for the survival and/or differentiation of a multipotential lymphoid/myeloid precursor (42Scott E.W. Fisher R.C. Olson M.C. Kehrli E.W. Simon M.C. Singh H. Immunity. 1997; 6: 437-447Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). In contrast to PU.1 −/− mice,Spi-B −/− animals are viable and display a normal number of B and T cells (43Su G.H. Chen H. Muthususamy N. Garrett-Sinha L. Baunuch D. Tenen D.G. Simon M.C. EMBO J. 1997; 16: 7118-7129Crossref PubMed Scopus (139) Google Scholar). However, upon stimulation of B cells either in vitro or in vivo, they exhibit a proliferation defect (43Su G.H. Chen H. Muthususamy N. Garrett-Sinha L. Baunuch D. Tenen D.G. Simon M.C. EMBO J. 1997; 16: 7118-7129Crossref PubMed Scopus (139) Google Scholar) due to decreased signaling through the B cell receptor and inappropriate apoptosis. 2L. Garrett-Sinha, G. Su, S. Rao, Z. Hao, M. Clark, and M. C. Simon, submitted for publication. 2L. Garrett-Sinha, G. Su, S. Rao, Z. Hao, M. Clark, and M. C. Simon, submitted for publication. One interesting issue raised by the Spi-B −/− mice is that PU.1 is obviously unable to complement this defect since it is present at wild type levels (43Su G.H. Chen H. Muthususamy N. Garrett-Sinha L. Baunuch D. Tenen D.G. Simon M.C. EMBO J. 1997; 16: 7118-7129Crossref PubMed Scopus (139) Google Scholar). The genetic evidence that SPI-B and PU.1 are not completely redundant implies that they (i) regulate different target genes and/or (ii) bind different cofactors. To distinguish between these two possibilities, we attempt to elucidate differences between SPI-B and PU.1 which may alter their transcriptional activity. These studies reveal that SPI-B contains two N-terminal activation domains which are highly divergent from PU.1. In addition, the affinity of SPI-B for certain DNA sites appears to be different from PU.1, affecting the ability of SPI-B to transactivate the c-FES promoter, a known PU.1 target gene. Finally, SPI-B is shown to interact with Pip as well as other proteins in a manner similar to PU.1, suggesting that these interactions are critical for the proper function of the PU.1/SPI-B Ets subfamily but that interactions with other cofactors may contribute to differences in their ability to activate target genes. A tetrameric λ2–4 enhancer element (referred to as the λB site) (13Eisenbeis C.F. Singh H. Storb U. Genes Dev. 1995; 9: 1377-1387Crossref PubMed Scopus (411) Google Scholar) was subcloned immediately upstream of a TK (2Orkin S.H. Curr. Opin. Cell Biol. 1995; 7: 870-877Crossref PubMed Scopus (134) Google Scholar) promoter in the pTKGH plasmid (Nichols Institute) to form the reporter construct B4TKGH. The 450-base pair promoter element from the human c-FES gene (44Heydemann A. Juang G. Hennessy K. Parmacek M.S. Simon M.C. Mol. Cell. Biol. 1996; 16: 1676-1686Crossref PubMed Scopus (74) Google Scholar) was subcloned into the promoterless pφGH vector (Nichols Institute) to form the reporter construct c-FES GH. The pGAL4GH (45Morrisey E.E. Ip H.S. Tang Z. Parmacek M.S. J. Biol. Chem. 1997; 272: 8515-8524Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) reporter and the Pip-CMV vector (23Su G.H. Ip H.S. Cobb B.S. Lu M.M. Chen H.M. Simon M.C. J. Exp. Med. 1996; 184: 203-214Crossref PubMed Scopus (90) Google Scholar) have been previously described. The human SPI-B (21Ray D. Bosselut R. Ghysdael J. Mattei M.G. Tavitian A. Moreau-Gachelin F. Mol. Cell. Biol. 1992; 12: 4297-4304Crossref PubMed Scopus (143) Google Scholar) and murine PU.1 (25Klemsz M.J. McKercher S.R. Celada A. Van Beveren C. Maki R.A. Cell. 1990; 61: 113-124Abstract Full Text PDF PubMed Scopus (754) Google Scholar) cDNAs have also been previously reported. Of note, the human SPI-B is 95% similar to the murine form, with only conservative differences in the Ets domain. All plasmids for cDNA expression in mammalian cells used the CMV promoter-based pCDNA3 vector (Invitrogen). Constructs were generated by PCR and confirmed by sequencing. Deletion mutants are named based upon the amino acids that are missing from the protein. Hemagglutinin (HA) epitope-tagged cDNAs were generated by cloning PCR-generated fragments into the previously described vector pcDNA3-HA (18Brass A.L. Kehrli E. Eisenbeis C.F. Storb U. Singh H. Genes Dev. 1996; 10: 2335-2347Crossref PubMed Scopus (207) Google Scholar). SPI-B/PU.1 Ets and PU.1/SPI-B Ets containXhoI and HindIII linkers between domains which insert two in-frame codons (LG and KL, respectively). ΔPEST (aa 107–165), Δ31–62, Δ31–106, Δ64–106, ΔEts (aa 166–257), and Δ257–262 contain an internal XhoI site within the deleted region. GAL4 fusion proteins were constructed by inserting PCR-generated fragments of SPI-B into the pGAL4 vector (45Morrisey E.E. Ip H.S. Tang Z. Parmacek M.S. J. Biol. Chem. 1997; 272: 8515-8524Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) that contains the DNA binding domain of the GAL4 protein (aa 1–147) followed by a multiple cloning site and in-frame stop codons. Point mutations were introduced by overlapping PCR mutagenesis (46Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6771) Google Scholar). The mutations are named by the normal amino acid, position, and the new amino acid. Cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 100 units of penicillin, and 100 μg of streptomycin. NIH 3T3 fibroblasts were transfected with Lipofectin (Life Technologies, Inc.) according to manufacturer's protocol. For co-transfection experiments, 2 μg of reporter plasmid and 2 μg of a β-galactosidase expressing plasmid (pMSVβgal) were used. Transfections using the B4TKGH and c-FES GH reporters utilized 20 μg of expression plasmid; 8 μg of expression plasmid were used for the transfections with the GAL4GH reporter. 48 h after transfections, supernatants were collected for human growth hormone assay using a commercially available radioimmunoassay (Nichols Institute). Transfection efficiencies were measured by β-galactosidase activity in cell extracts as described previously (47Parmacek M.S. Ip H.S. Jung F. Shen T. Martin J.F. Vora A.J. Olson E.N. Leiden J.M. Mol. Cell. Biol. 1994; 14: 1870-1885Crossref PubMed Scopus (98) Google Scholar). COS-7 cells were transfected with Lipofectin and 20 μg of expression plasmid. Nuclear extracts were prepared 48 h after transfection using the method of Andrews and Faller (48Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2207) Google Scholar). [35S[Methionine incorporated IVT proteins were generated using a commercially available TNT-coupled rabbit reticulocyte lysate kit (Promega). Proteins were resolved by SDS-PAGE and quantitated by PhosphorImager analysis (Molecular Dynamics). Binding reactions were performed at room temperature for 30 min and contained equimolar amounts of IVT protein or 10 μg of nuclear extracts, 10 mm Tris, 1 mm EDTA, 1 mmdithiothreitol, 75 mm KCl, 4% Ficoll, 12.5 mg/ml poly(dI·dC) (Amersham Pharmacia Biotech), and 5 × 105 cpm/ml of 32P-labeled double-stranded oligonucleotide probe. Protein-DNA complexes were resolved on a 6% (19:1) acrylamide:bisacrylamide (Bio-Rad), 0.5× TBE gel at 200 V for 4.5 h, dried, and subjected to autoradiography. The following double-stranded synthetic oligonucleotides were used (top strand): λB, 5′ CTAGCGAGAAATAAAAGGAAGTGAAACCAAGT 3′; GAL4, 5′ GAGCGGAGTACTGTCCTCCGAG 3′; c-FES, 5′ CGGAATCAGGAACTGGCCGGGG 3′. The GST fusion proteins were created by inserting the entire coding sequence of SPI-B or PU.1 into the pGEX vector multiple cloning site (Amersham Pharmacia Biotech). DH5α cultures expressing the fusion proteins were grown to saturation, diluted 1:10 in Luria broth, grown for 1 h at 30 °C, and induced with 1 mmisopropyl-1-thio-β-d-galactopyranoside for 4 h at 30 °C. Cells were then pelleted, washed once with NETN buffer (20 mm Tris, 100 mm NaCl, 1 mm EDTA, 0.2% Nonidet P-40), and sonicated on ice with 3–15-s bursts. Cell debris was then pelleted, and the fusion proteins were bound to pre-swelled glutathione-agarose beads (Sigma) for 30 min at 4 °C. Beads were then washed 3 times with NETN. [35S[Methionine-incorporated IVTs were pre-cleared for 1 h with glutathione-agarose beads at 4 °C. Equivalent amounts of fusion protein as judged by Coomassie staining were incubated with equal counts of IVT proteins for 1 h at 4 °C in NETN buffer. Beads were then washed 5 times with NETN, boiled in loading dye, fractionated by 10% (37.5:1) acrylamide:bisacrylamide (National Diagnostics) SDS-PAGE, and subjected to autoradiography. 3T3 cells were transfected with 24 μg of expression plasmids coding for HA epitope-tagged versions of each construct (18Brass A.L. Kehrli E. Eisenbeis C.F. Storb U. Singh H. Genes Dev. 1996; 10: 2335-2347Crossref PubMed Scopus (207) Google Scholar), and protein extracts were made 24 h post-transfection. Extracts were subjected to Western blot analysis using standard techniques and probed with an anti-HA antibody (Babco). To identify regions of the SPI-B protein that could function as independent transactivation domains, portions of the SPI-B cDNA were fused in frame to the C terminus of the GAL4 DNA binding domain and tested for their ability to transactivate five linked copies of the GAL4 DNA-binding site upstream of a minimal TK promoter and the human growth hormone cDNA (pGAL4GH) when co-transfected into NIH 3T3 cells (Fig. 2 A). As demonstrated in Fig. 2 A, the PEST region of SPI-B exhibited no transactivation potential (GAL4/PEST), but the N-terminal 108 amino acids (aa, GAL4-(1–108)) potently activated the expression of the pGAL4GH reporter. C-terminal deletions within this region revealed that even the very N-terminal 30 aa (GAL4-(1–31)) could function as an independent transcriptional activator. N-terminal truncations of this region showed that aa 31–108 could also function as a transcriptional activator (data not shown), but aa 63–108 (GAL4-(63–108)) were unable to activate transcription. The small stretch of aa contained in the GAL4-(31–61) was able to transactivate the reporter, thereby localizing two independent transactivation domains of SPI-B to aa 1–31 and aa 31–61. To delineate further the domain contained between aa 31–61 (which conferred transcriptional activity at the λB site, see below), a series of smaller fusion proteins were generated. As demonstrated in Fig. 2 A, GAL4-(31–51) and GAL4-(41–61) still functioned as transcriptional activators, and in fact only 10 aa (GAL4-(41–51)) retained some transactivation potential even though the flanking aa (GAL4-(31–41) and GAL4-(52–62)) did not. However, due to the strong potential exhibited by GAL4-(41–61) over GAL4-(41–51), it appears that the full transcriptional activation domain resides between aa 41 and 61. To ensure that all constructs were stably expressed and capable of binding to the GAL4 DNA element, nuclear extracts were prepared from COS cells transfected with all constructs shown in Fig. 2 Aand assayed for their ability to bind DNA in an electrophoretic mobility shift assay (EMSA lanes 2–14, Fig.2 B). Based upon the GAL4 fusion protein analyses, it appears that SPI-B contains two independent transcriptional activation domains. The N-terminal domain (aa 1–31) has a calculated pI of 3.8, making it an acidic domain, similar to a motif found in PU.1 (19Klemsz M.J. Maki R.A. Mol. Cell. Biol. 1996; 16: 390-397Crossref PubMed Scopus (82) Google Scholar) and other Ets proteins (49Bassuk A.G. Leiden J.M. Adv. Immunol. 1997; 64: 65-104Crossref PubMed Google Scholar). However, aa 41–61 most resemble a proline-,serine-, and Threonine (PST)-rich domain since they comprise almost 40% of the amino acids in this region, although it also has some acidic characteristics. PST activation domains have also been identified in GATA factors (45Morrisey E.E. Ip H.S. Tang Z. Parmacek M.S. J. Biol. Chem. 1997; 272: 8515-8524Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) as well as the homeodomain protein Pax6 (50Tang H.K. Singh S. Saunders G.F. J. Biol. Chem. 1998; 273: 7210-7221Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Interestingly, computer based alignment of the PST activation domain of SPI-B yielded no similarity with PU.1 or any other Ets family member (data not shown). It has previously been demonstrated that PU.1 or SPI-B in conjunction with the lymphoid-specific co-activator Pip (13Eisenbeis C.F. Singh H. Storb U. Genes Dev. 1995; 9: 1377-1387Crossref PubMed Scopus (411) Google Scholar) effectively transactivates a DNA element from the λ2–4 enhancer (5′ AAAAGGAAGTGAAACC 3′), termed the λB site, which is required for maximal activity of the enhancer (23Su G.H. Ip H.S. Cobb B.S. Lu M.M. Chen H.M. Simon M.C. J. Exp. Med. 1996; 184: 203-214Crossref PubMed Scopus (90) Google Scholar). Full-length PU.1, SPI-B, and N-terminal deletions of SPI-B were tested for their ability to transactivate a tetramer of the λB site upstream of a minimal TK promoter driving growth hormone expression (pB4TKGH). As shown in Fig.3 A, both PU.1 and SPI-B, in combination with Pip, efficiently transactivated (15–20-fold over the empty mammalian expression vector pCDNA3) pB4TKGH. Deletion of the entire N terminus of the protein, leaving only a PEST and Ets domain (Δ2–106), produced a construct that did not transactivate pB4TKGH. Deletion of the first 30 aa of SPI-B (Δ2–30) yielded a construct with almost wild type levels of transactivation, but subsequent deletion of the first 61 aa (Δ2–62) resulted in a construct with no transactivation potential (Fig. 3 A). This implies that only aa 31–61 are required for transactivation at the λ enhancer. To define further the λB transactivation domain, small deletions were generated in the N terminus of SPI-B. Deletion of aa 31–62 (Δ31–62) or 31–107 (Δ31–107) sharply reduced transactivation, whereas deletions adjacent to aa 31–62 (Δ64–107) only modestly affected transactivation potential. These data demonstrate that aa 31–62 of SPI-B function as the primary transcriptional activation domain at the λ enhancer. The residual activity observed in Δ31–62 and Δ31–107 is most likely due to the N-ter" @default.
• W1992994326 created "2016-06-24" @default.
• W1992994326 creator A5006514024 @default.
• W1992994326 creator A5006718870 @default.
• W1992994326 creator A5007317144 @default.
• W1992994326 creator A5031833096 @default.
• W1992994326 date "1999-04-01" @default.
• W1992994326 modified "2023-09-30" @default.
• W1992994326 title "SPI-B Activates Transcription via a Unique Proline, Serine, and Threonine Domain and Exhibits DNA Binding Affinity Differences from PU.1" @default.
• W1992994326 cites W1483582136 @default.
• W1992994326 cites W1485987033 @default.
• W1992994326 cites W1541937812 @default.
• W1992994326 cites W1599437019 @default.
• W1992994326 cites W1764615552 @default.
• W1992994326 cites W1956433925 @default.
• W1992994326 cites W1963838197 @default.
• W1992994326 cites W19721907 @default.
• W1992994326 cites W1972310581 @default.
• W1992994326 cites W1985177466 @default.
• W1992994326 cites W1996251228 @default.
• W1992994326 cites W1998903985 @default.
• W1992994326 cites W1998973642 @default.
• W1992994326 cites W2004092007 @default.
• W1992994326 cites W2005606581 @default.
• W1992994326 cites W2005735929 @default.
• W1992994326 cites W2007625577 @default.
• W1992994326 cites W2008832557 @default.
• W1992994326 cites W2010601153 @default.
• W1992994326 cites W2017956702 @default.
• W1992994326 cites W2034141855 @default.
• W1992994326 cites W2041497115 @default.
• W1992994326 cites W2043930487 @default.
• W1992994326 cites W2055192078 @default.
• W1992994326 cites W2058339758 @default.
• W1992994326 cites W2060484473 @default.
• W1992994326 cites W2060913542 @default.
• W1992994326 cites W2072764050 @default.
• W1992994326 cites W2077216446 @default.
• W1992994326 cites W2093339251 @default.
• W1992994326 cites W2094646101 @default.
• W1992994326 cites W2118491726 @default.
• W1992994326 cites W2118636735 @default.
• W1992994326 cites W2122599803 @default.
• W1992994326 cites W2123480703 @default.
• W1992994326 cites W2146886804 @default.
• W1992994326 cites W2151360445 @default.
• W1992994326 cites W2161743101 @default.
• W1992994326 cites W2170276453 @default.
• W1992994326 cites W2261476468 @default.
• W1992994326 cites W2271515476 @default.
• W1992994326 cites W2286150378 @default.
• W1992994326 cites W2339091398 @default.
• W1992994326 cites W2409222426 @default.
• W1992994326 cites W2411489146 @default.
• W1992994326 cites W6965533 @default.
• W1992994326 doi "https://doi.org/10.1074/jbc.274.16.11115" @default.
• W1992994326 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10196196" @default.
• W1992994326 hasPublicationYear "1999" @default.
• W1992994326 type Work @default.
• W1992994326 sameAs 1992994326 @default.
• W1992994326 citedByCount "45" @default.
• W1992994326 countsByYear W19929943262012 @default.
• W1992994326 countsByYear W19929943262013 @default.
• W1992994326 countsByYear W19929943262014 @default.
• W1992994326 countsByYear W19929943262015 @default.
• W1992994326 countsByYear W19929943262016 @default.
• W1992994326 countsByYear W19929943262017 @default.
• W1992994326 countsByYear W19929943262018 @default.
• W1992994326 countsByYear W19929943262020 @default.
• W1992994326 countsByYear W19929943262022 @default.
• W1992994326 crossrefType "journal-article" @default.
• W1992994326 hasAuthorship W1992994326A5006514024 @default.
• W1992994326 hasAuthorship W1992994326A5006718870 @default.
• W1992994326 hasAuthorship W1992994326A5007317144 @default.
• W1992994326 hasAuthorship W1992994326A5031833096 @default.
• W1992994326 hasBestOaLocation W19929943261 @default.
• W1992994326 hasConcept C104317684 @default.
• W1992994326 hasConcept C107824862 @default.
• W1992994326 hasConcept C11960822 @default.
• W1992994326 hasConcept C12554922 @default.
• W1992994326 hasConcept C138885662 @default.
• W1992994326 hasConcept C179926584 @default.
• W1992994326 hasConcept C185592680 @default.
• W1992994326 hasConcept C2775880066 @default.
• W1992994326 hasConcept C2776414213 @default.
• W1992994326 hasConcept C2779815552 @default.
• W1992994326 hasConcept C33987129 @default.
• W1992994326 hasConcept C41895202 @default.
• W1992994326 hasConcept C515207424 @default.
• W1992994326 hasConcept C552990157 @default.
• W1992994326 hasConcept C55493867 @default.
• W1992994326 hasConcept C86339819 @default.
• W1992994326 hasConcept C86803240 @default.
• W1992994326 hasConcept C94966510 @default.
• W1992994326 hasConcept C95444343 @default.
• W1992994326 hasConceptScore W1992994326C104317684 @default.
• W1992994326 hasConceptScore W1992994326C107824862 @default.
• W1992994326 hasConceptScore W1992994326C11960822 @default.

• next