FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1994315177> ?p ?o ?g. }

• W1994315177 endingPage "16869" @default.
• W1994315177 startingPage "16861" @default.
• W1994315177 abstract "MNSFβ is a ubiquitously expressed member of the ubiquitin-like family that has been implicated in various biological functions. Previous studies have demonstrated that MNSFβ covalently binds to intracellular proapoptotic protein Bcl-G in mitogen-activated murine T cells. In this study, we further investigated the intracellular mechanism of action of MNSFβ in macrophage cell line, Raw 264.7 cells. We present evidence that MNSFβ·Bcl-G complex associates with ERKs in non-stimulated Raw 264.7. We found that MNSFβ·Bcl-G directly bound to ERKs and inhibited ERK activation by MEK1. In Raw 264.7 cells treated with MNSFβ small interfering RNA (siRNA) lipopolysaccharide (LPS)-induced ERK1/2 activation was enhanced and LPS-induced JNK and p38 activation was unaffected. SiRNA-mediated knockdown of MNSFβ increased tumor necrosis factor α (TNFα) expression at mRNA and protein levels in LPS-stimulated Raw 264.7 cells. Finally, we found that transfection with MNSFβ expression construct resulted in a significant inhibition of LPS-induced ERK activation and TNFα production. Co-transfection experiments with MNSFβ and Bcl-G greatly enhanced this inhibition. Collectively, these findings indicate that MNSFβ might be implicated in the macrophage response to LPS. MNSFβ is a ubiquitously expressed member of the ubiquitin-like family that has been implicated in various biological functions. Previous studies have demonstrated that MNSFβ covalently binds to intracellular proapoptotic protein Bcl-G in mitogen-activated murine T cells. In this study, we further investigated the intracellular mechanism of action of MNSFβ in macrophage cell line, Raw 264.7 cells. We present evidence that MNSFβ·Bcl-G complex associates with ERKs in non-stimulated Raw 264.7. We found that MNSFβ·Bcl-G directly bound to ERKs and inhibited ERK activation by MEK1. In Raw 264.7 cells treated with MNSFβ small interfering RNA (siRNA) lipopolysaccharide (LPS)-induced ERK1/2 activation was enhanced and LPS-induced JNK and p38 activation was unaffected. SiRNA-mediated knockdown of MNSFβ increased tumor necrosis factor α (TNFα) expression at mRNA and protein levels in LPS-stimulated Raw 264.7 cells. Finally, we found that transfection with MNSFβ expression construct resulted in a significant inhibition of LPS-induced ERK activation and TNFα production. Co-transfection experiments with MNSFβ and Bcl-G greatly enhanced this inhibition. Collectively, these findings indicate that MNSFβ might be implicated in the macrophage response to LPS. The covalent attachment of ubiquitin to proteins is an important cellular function that is required for protein degradation, DNA repair, cell cycle control, stress response, transcriptional regulation, signal transduction, and vesicular traffic (1Jentsch S. McGrath J.P. Varshavsky A. Nature. 1987; 329: 131-134Crossref PubMed Scopus (544) Google Scholar, 2Skowyra D. Koepp D.M. Kamura T. Conrad M.N. Conaway. R. C. Conaway Elledge J.W. Harper S. J.J.W. Science. 1999; 284: 662-665Crossref PubMed Scopus (357) Google Scholar, 3Pickart C.M. Annu. Rev. Biochem. 2001; 70: 503-533Crossref PubMed Scopus (2886) Google Scholar, 4Weissman A.M. Nat. Rev. Mol. Cell. Biol. 2001; 2: 169-178Crossref PubMed Scopus (1255) Google Scholar, 5Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (950) Google Scholar, 6Passmore L.A. Barford D. Biochem. J. 2004; 379: 513-525Crossref PubMed Scopus (229) Google Scholar). The attachment of a single ubiquitin polypeptide (monoubiquitination) is important for cellular regulation (7Hicke L. Nat. Rev. Mol. Cell. Biol. 2001; 2: 195-201Crossref PubMed Scopus (982) Google Scholar). Polyubiquitination targets proteins for destruction by the proteasome. Polyubiquitin chains are formed via isopeptide bond linkages between the C-terminal Gly-76 of ubiquitin and the side chain -NH2 from Lys-48 of another. In addition to ubiquitin, it is evident that several ubiquitin-like proteins have been found to be covalently or noncovalently attached to target proteins (8Malakhov M.P. Keun Il Kim K.I. Malakhova O.A. Jacobs B.S. Borden E.C. Zhang D.E. J. Biol. Chem. 2003; 278: 16608-16613Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 9Raasi S. Schmidtke G. Groettrup M. J. Biol. Chem. 2001; 276: 35334-35343Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar, 10Hemelaar J. Lelyveld V.S. Benedikt M.Kessler Ploegh B. M.H.L. J. Biol. Chem. 2003; 278: 51841-51850Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 11Marx. J. Science. 2005; 307: 836-839Crossref PubMed Scopus (29) Google Scholar, 12Mahajan R. Delphin C. Guan T. Gerace L. Melchior F. Cell. 1997; 88: 97-107Abstract Full Text Full Text PDF PubMed Scopus (1002) Google Scholar). Interestingly, small ubiquitin-like modifier 1 (SUMO-1) 2The abbreviations used are: SUMO-1, small ubiquitin-like modifier 1; MNSF, monoclonal nonspecific suppressor factor; RANTES, the regulated on activation normal T cell expressed and secreted; siRNA, small interfering RNA; PAK2, p21-activated kinase 2; IFN, interferon; TNF, tumor necrosis factor; LPS, lipopolysaccharide; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; SAPK, stress-activated protein kinase; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid; FBS, fetal bovine serum; RNAi, RNA interference. 2The abbreviations used are: SUMO-1, small ubiquitin-like modifier 1; MNSF, monoclonal nonspecific suppressor factor; RANTES, the regulated on activation normal T cell expressed and secreted; siRNA, small interfering RNA; PAK2, p21-activated kinase 2; IFN, interferon; TNF, tumor necrosis factor; LPS, lipopolysaccharide; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; SAPK, stress-activated protein kinase; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid; FBS, fetal bovine serum; RNAi, RNA interference. conjugation of IκB occurs on the same residues used for ubiquitination, thus making the protein resistant to proteasome-mediated degradation and consequently inhibiting NFκB activation (13Desterro J.M.P. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Abstract Full Text Full Text PDF PubMed Scopus (905) Google Scholar).Monoclonal nonspecific suppressor factor (MNSF), a lymphokine produced by murine T cell hybridoma, possesses pleiotrophic antigen-nonspecific suppressive functions (14Nakamura M. Ogawa H. Tsunematsu T. J. Immunol. 1986; 136: 2904-2909PubMed Google Scholar). We have cloned a cDNA encoding a subunit of MNSF, which was termed MNSFβ (15Nakamura M. Xavier R.M. Tsunematsu T. Tanigawa Y. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3463-3467Crossref PubMed Scopus (57) Google Scholar). MNSFβ cDNA encodes a protein of 133 amino acids consisting of a ubiquitin-like protein (36% identity with ubiquitin) fused to the ribosomal protein S30. The ubiquitin-like moiety of MNSFβ shows MNSF-like biologic activity without cytotoxic action (16Nakamura M. Xavier R.M. Tanigawa Y. J. Immunol. 1996; 156: 532-538PubMed Google Scholar). Interferon γ (IFNγ) is involved in the mechanism of action of MNSFβ. We have demonstrated that Ubi-L specifically binds to cell surface receptors on mitogen-activated lymphocytes and the T helper type 2 clone, the D.10 cells (17Nakamura M. Tanigawa Y. J. Biol. Chem. 1999; 274: 18026-18032Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar).We have also shown that MNSFβ covalently conjugates to acceptor proteins and forms MNSFβ adducts including 33.5-kDa protein in concanavalin A- and IFNγ-stimulated D.10 cells (18Nakamura M. Tanigawa Y. Biochem. J. 1998; 330: 683-688Crossref PubMed Scopus (14) Google Scholar). Recently, we found that this MNSFβ adduct consists of 8.5-kDa ubiquitin-like protein and Bcl-2-like protein (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar), murine orthologue of previously cloned human BCL-G gene product with proapoptotic function (20Guo B. Godzik A. Reed J.C. J. Biol. Chem. 2001; 276: 2780-2785Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). The BCL-G gene is a proapoptotic p53 target gene (21Miled C. Pontoglio M. Garbay. S. Yaniv Weitzman M.J.B. Cancer Res. 2005; 65: 5096-5104Crossref PubMed Scopus (68) Google Scholar). Murine Bcl-G mRNA was highly expressed in testis and significantly in spleen (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar).In this study, we investigated the intracellular mechanism of action of MNSFβ in murine macrophage cell line, Raw 264.7 cells. We observed that MNSFβ siRNA increased ERK activation and TNFα production by LPS-stimulated Raw 264.7 cells. We will show that the MNSFβ is implicated in the regulation of the ERK-MAPK cascade.EXPERIMENTAL PROCEDURESMaterials—Rabbit polyclonal antibodies to p38, ERK1, and JNK (SAPK) were purchased from Santa Cruz Biotechnology. Rabbit polyclonal antibodies to phospho-p38 and phospho-JNK were from Promega, and rabbit anti-phospho-ERK1/2 antibodies were from Sigma. Rabbit polyclonal antibodies to MNSFβ and Bcl-G were prepared as described (15Nakamura M. Xavier R.M. Tsunematsu T. Tanigawa Y. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3463-3467Crossref PubMed Scopus (57) Google Scholar, 19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). MNSFβ·Bcl-G complex was prepared as described (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar).Immunoprecipitation—Immunoprecipitation was performed with a horseradish peroxidase-conjugated antibody that recognizes native rabbit IgG (TrueBlot™, eBioscience, San Diego, CA) according to the manufacturer's instructions. RIPA buffer (50 mm Tris, 1% Nonidet P-40, 0.25% deoxycholate, 150 mm NaCl, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, pH 7.4, containing 1 μg/ml each of the protease inhibitors aprotinin, leupeptin, and pepstatin) extracts of Raw cells were precleared with 50 μl of anti-rabbit IgG beads for 1 h on ice. Subsequently, 5 μg of primary antibody to MNSFβ or ERK1 was added to precleared lysates and incubated on ice for additional 1 h. Samples were then incubated overnight at 4°C with 50 μl of anti-rabbit IgG bead. The beads were washed with five times with RIPA buffer, and immunoprecipitates were released from the beads by 10 min boiling in NuPAGE LDS sample buffer (Invitrogen) buffer. Immunoblotting was carried out with anti-ERK1 or anti-Bcl-G antibody. A rabbit IgG TrueBlot was employed as a second antibody.Western Blot Analysis—The protein concentrations of the cell lysates were determined by Bradford assay (Bio-Rad). Equal amounts of protein were loaded onto an SDS-polyacrylamide gel (10% acrylamide), resolved by electrophoresis, and transferred onto polyvinylidene fluoride membranes. The membrane was incubated overnight at 4°C in a Tris-buffered saline solution with 5% milk to block nonspecific binding sites. Membranes were incubated with the primary antibodies for a minimum of 2 h at room temperature in Tris-buffered saline with 0.1% Tween 20 (Tris/Tween). Horseradish peroxidase secondary antibodies were incubated for 1 h at room temperature in Tris/Tween with 5% milk. Labeled proteins were visualized by chemiluminescence according to the manufacturer's instructions (Amersham Biosciences).In-gel Digestion and MALDI-TOF—The 33.5-kDa MNSFβ adduct was purified to homogeneity from Raw cell extracts by a combination of ion exchange chromatography, anti-MNSFβ affinity chromatography and hydroxylapatite chromatography as described previously (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). Ingel digestion and MALDI-TOF were performed as described (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). Briefly, silver-stained spots were cut out of the gels and digested with 5 μg/ml V8 protease (Sigma) in 25 mm ammonium bicarbonate. Peptide mass fingerprinting was performed using a PerkinElmer Life Sciences/PerSeptive Biosystems Voyager-DE-RP MALDI-TOF mass spectrometer. The resulting sets of peptide masses were then used to search the NCBI data base for potential matches.GST Pulldown Assay—Purified MNSFβ·Bcl-G (0.5 μg) was incubated with 2 μg of GST or GST-ERK2 bound to GSH-Sepharose (Amersham Biosciences) for 3 h at 4°C with rocking followed by extensive washing of complexes. Bound proteins were eluted by boiling in 2× Laemmli. MNSFβ·Bcl-G complex was separated by SDS-PAGE and detected by immunoblotting with anti-MNSFβ antibody. Peptide competition assay was performed by using synthetic peptides derived from ERK2 (residues 181–199, including a MEK dual phosphorylation site: FLTEYVATRWYRAPEIMLN; residues 318–338, C-teminal: SDEPIAEAPFKFDMELDDLPK). GST-ERK2 (2 μg) was immobilized on GSH-Sepharose and incubated with MNSFβ·Bcl-G (0.5 μg) in the presence of 200 μm peptide.Peptide Affinity Chromatography—For affinity chromatography on peptide columns, synthetic peptides described above were coupled to Hi-Trap N-hydroxysuccinimide-activated agarose columns (Amersham Biosciences). Purified MNSFβ·Bcl-G was incubated with peptide columns, washed extensively, and eluted with 50 mm triethylamine, pH. 11. The eluates were neutralized with 100 mm Tris-HCl, pH 7.4, subjected to SDS-PAGE, and detected by immunoblotting with anti-MNSFβ antibody.Kinase Assay—To examine the effect of MNSFβ·Bcl-G complex on ERK activation, MEK kinase assay was performed. Activated GST-MEK1 (Upstate Biotechnology) was incubated with unphosphorylated GST-ERK2 (Upstate Biotechnology) in the presence or absence of MNSFβ·Bcl-G complex (0.5–2 μg) in a buffer containing 20 mm MOPS, pH 7.2, 5 mm EGTA, 10 μm sodium fluoride, 25 mm β-glycerophosphate, 1 mm sodium vanadate, 500 μm ATP, 75 mm, for 30 min at 30°C. The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody.Cell Culture, the siRNAs, and Transfection of Cells—The Raw 264.7 macrophage-like cell line (ATCC TIB-71) was cultured routinely in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (FBS) and penicillin-streptomycin at 37°C and 5% CO2. SiRNA duplexes (siRNAs) were synthesized and purified by Qiagen, Inc. (Chatsworth, CA). The target sequences were as follows: MNSFβ siRNA-332 (5′-CCCAAGGTGGCCAAACAGGAA-3′), MNSFβ siRNA-437 (5′-CCACCCTGCCATGCTAATAAA-3′), Bcl-G siRNA (5′-AGCATAATGGTTGGTAATTAA-3′. Scramble siRNA directed against 5′-GGACTCGACGCAATGGCGTCA-3′ was the negative control. Cells were treated with siRNA according to the instructions provided with the RNAiFect™ transfection reagent (Qiagen, Inc.). Raw 264.7 cells (1.2 × 105) were treated with 3 μg of siRNA in RPMI 1640 medium supplemented with 10% FBS in the presence of the RNAiFect™ transfection reagent. After a 48-h incubation at 37°C, the medium containing the mixture of RNAiFectTM and siRNA was replaced by Dulbecco's modified Eagle's medium that contained 10% FBS and cells were incubated for a further 24 h.Reverse Transcription (RT)-PCR—RT-PCR was performed for 30 cycles as described previously (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). The PCR primers used to detect mRNA are as follows: MNSFβ, CGCCCAGGAACTACACACC (sense) and GCCTGCTACTTCCAGAGTGG (antisense) (222 bp); Bcl-G, CCCAAGCTCTCCAGAACAAG (sense) and CTGAGCTCGGATCTCCTTTG (antisense) (213 bp). All short amplified PCR products were isolated and sequenced to verify their identity. PCR products were separated in 2% agarose gel electrophoresis and stained with ethidium bromide. In some experiments, signals were quantitated by densitometry and optical densities for MNSFβ and Bcl-G were normalized to the corresponding values for glyceraldehyde-3-phosphate dehydrogenase.Mutagenesis and Transfection—Mutant MNSFβ (G76A) was generated by replacing the codon for glycine 76 with the codon for alanine by utilizing QuikChange site-directed mutagenesis (Stratagene). cDNAs encoding MNSFβ and Bcl-G were subcloned into the vector pcDNA3.1(+) (Invitrogen Corp.). Transient DNA transfections were conducted using Lipofectamine Plus reagent (Invitrogen) with the protocol provided by the manufacturer and 8 μg of plasmid DNA per 6-well plate.Quantification of Cytokines—Murine cytokines were measured using sandwich ELISA (R&D System, Minneapolis, MN). The lower limits of detection for the cytokines were TNFα, 10 pg/ml; RANTES (regulated on activation normal T cell expressed and secreted), 20 pg/ml.Electrophoretic Mobility Shift Assay (EMSA)—Nuclear extracts were prepared following the methods of Dignam et al. (22Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9142) Google Scholar). Protein-DNA complexes were detected using biotin end-labeled double-stranded DNA probes. The sequence for the NFκB site was: GGGGACTTTCCC. Oligonucleotides were labeled in a reaction using terminal deoxynucleotide transferase and biotin-14-dCTP (Pierce). The binding reaction was performed using the LightShift kit according to the manufacture's instructions (Pierce). The reaction products were separated on a 5% polyacrylamide gel in 0.5% Tris borate-EDTA, transferred onto a nylon membrane, and fixed on the membrane by UV cross-linking. The biotin-labeled probe was detected using chemiluminescence (LightShift kit; Pierce).RESULTSMNSFβ Complex Is Associated with ERKs—It has been reported that ubiquitin-like protein, ISG15, covalently binds to ERK1 (8Malakhov M.P. Keun Il Kim K.I. Malakhova O.A. Jacobs B.S. Borden E.C. Zhang D.E. J. Biol. Chem. 2003; 278: 16608-16613Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). Thus, first we addressed whether MNSFβ could associate with the MAPK family including ERK, JNK, and p38 MAPK. Cell lysates were prepared from non-stimulated Raw 264.7 cells and immunoprecipitated with antibodies directed against MNSFβ, and associated proteins were analyzed by Western blot analysis by using anti-ERK1, anti-JNK, and anti-p38 antibodies. As shown in Fig. 1A, MNSFβ associated with ERKs, but not with other members of the MAPK family, under non-stimulated conditions. It should be noted that anti-ERK1 polyclonal antibodies recognize both the 44-kDa ERK1 and the 42-kDa ERK2. Immunoprecipitation of cell lysates with normal IgG followed by Western blot analysis revealed no detectable association of ERKs, indicating the specificity of MNSFβ with ERKs. In addition, converse immunoprecipitation with anti-ERK1 antibody and immunoblot analysis with anti-MNSFβ antibody confirmed the association between ERKs and the MNSFβ adduct (Fig. 1B). It should be pointed out that anti-MNSFβ antibody does not recognize free 8.5-kDa MNSFβ in murine T helper type 2 clone, D.10 cells (18Nakamura M. Tanigawa Y. Biochem. J. 1998; 330: 683-688Crossref PubMed Scopus (14) Google Scholar). In Raw macrophages as well as D.10 cells, anti-MNSFβ antibody recognized several bands including a band of 33.5-kDa protein (Fig. 1A). We have demonstrated that Bcl-G, a novel proapoptotic member of the Bcl-2 family, is post-translationally modified by MNSFβ (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). Thus, it seemed likely that the 33.5-kDa MNSFβ adduct was the MNSFβ·Bcl-G complex. To determine this, we carried out Western blot analysis with anti-Bcl-G antibody. As depicted in Fig. 1B, antibody directed against Bcl-G reacted with the 33.5-kDa MNSFβ adduct, indicative of the covalent interaction of MNSFβ and Bcl-G as described (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). To confirm the interaction between MNSFβ and Bcl-G in Raw cells, MALDI-TOF was performed. The 33.5-kDa MNSFβ adduct was purified to homogeneity from Raw cell lysates by a combination of ion exchange chromatography, anti-MNSFβ affinity chromatography, and hydroxylapatite chromatography as described (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). The purified MNSFβ adduct was digested by V8 protease and subjected to MALDI-MS analysis. Table 1 shows the peptide masses of observed by MALDI-TOF mass fingerprinting of 33.5-kDa MNSFβ adduct purified from Raw cells. The resulting sets of peptide masses were then used to search the NCBI data base for potential matches, confirming the MNSFβ adduct as MNSFβ·Bcl-G complex. MNSFβ may conjugate to Bcl-G with a linkage between the C-terminal Gly-74 and Lys-110, as described (19Nakamura M. Tanigawa Y. Eur. J. Biochem. 2003; 270: 4052-4058Crossref PubMed Scopus (36) Google Scholar). These results indicate that covalent MNSFβ·Bcl-G complex can specifically associate with ERKs in unstimulated Raw macrophages.TABLE 1Assignments of peptide fragments from a Staphylococcus V8 protease digest of the 33.5-kDa MNSFβ adductProteinMass (MH+)ResiduesSequenceObservedCalculatedBcl-G930.0930.1208-215QIISKIVE1283.71283.5173-184VIHSQGGSKLKE1396.81396.6112-124IRAQGPQGPFPVE1598.91598.7305-317YFSPWVQQNGGWE2065.42065.4288-304NHPMNRMLGFGTKYLRE2350.02349.881-100KNISLGKKKSSWRTLFRVAEMNSFβ1241.11241.438-49DQVVLLAGSPLE1412.31411.620-32TVAQIKDHVASLEMNSFβ · Bcl-G2934.62934.4104GLPSSPKEIRAQGPQGPFPVE124|67VAGRMLGG74 Open table in a new tab MNSFβ·Bcl-G Directly Binds to ERK2—We next investigated the nature of the binding of MNSFβ·Bcl-G to ERKs. Purified MNSFβ·Bcl-G complex was incubated with GST or GST-ERK2 bound to GSH-Sepharose. The bead matrices were extensively washed before eluting bound proteins off of the bead matrices. MNSFβ·Bcl-G complex was separated by SDS-PAGE and detected by immunoblotting with anti-MNSFβ antibody. As shown in Fig. 2A, MNSFβ·Bcl-G bound to GST-ERK2 but not to GST. Excess peptide for the MEK dual phosphorylation site of ERK2 inhibited 50–60% this association, compared with a control peptide (mapping at the C terminus of ERK2), indicating that MNSFβ·Bcl-G might bind to near the phosphorylation site. To confirm these results, we carried out peptide affinity chromatography. MNSFβ·Bcl-G was incubated with peptides derived from ERK2 immobilized on agarose columns. Bound and eluted MNSFβ·Bcl-G was resolved by SDS-PAGE and immunoblotted with anti-MNSFβ antibody. As can be seen in Fig. 2B, MNSFβ·Bcl-G bound to a column of immobilized the competitive peptide but not of control peptide, albeit this binding was not complete.FIGURE 2A, MNSFβ·Bcl-G directly associates with ERK and regulates its activity. GST pulldown assay: purified MNSFβ·Bcl-G was incubated with GST or GST-ERK2 bound to GSH-Sepharose as described under “Experimental Procedures.” Bound proteins were separated by SDS-PAGE and detected by immunoblotting with anti-MNSFβ antibody (top panel). Western blot analysis for GST was performed to confirm equal loading of proteins (bottom panel). The peptide competition assay was carried out by using peptide for the MEK dual phosphorylation site of ERK2. The data represent one of three independent experiments yielding similar results. B, peptide affinity chromatography. For affinity chromatography on peptide columns, synthetic peptides derived from ERK2 were coupled to N-hydroxysuccinimide-activated agarose columns. MNSFβ·Bcl-G was incubated with peptide columns, washed extensively, and eluted. The eluates were subjected to SDS-PAGE and detected by immunoblotting with anti-MNSFβ antibody. The flow-through (FT) and elusion material (Elu) are indicated. Lane C, MNSFβ·Bcl-G as a control. C, MEK kinase assay. Activated GST-MEK1 was incubated with unactivated GST-ERK2 in a kinase assay buffer. To evaluate the effect of MNSFβ·Bcl-G complex on ERK activation, unphosphorylated GST-ERK2 was preincubated with the MNSFβ adduct (0.5 and 2μg) for 1 h at 4°C prior to addition of activated GST-MEK1. The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody. The data represent one of three independent experiments that gave similar results.View Large Image Figure ViewerDownload Hi-res image Download (PPT)MNSFβ·Bcl-G Inhibits ERK Activation—To investigate whether ERK function is directly modified by MNSFβ·Bcl-G, we carried out MEK kinase assay. GST-MEK1 activated with c-Raf was employed in this assay. Activated GST-MEK1 was incubated with unphosphorylated GST-ERK2 in the presence or absence of MNSFβ·Bcl-G as described under “Experimental Procedures.” The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody. As depicted in Fig. 2C, ERK activation by MEK1 was significantly inhibited in the presence of MNSFβ·Bcl-G. These observations were consistent with the results of GST pulldown experiments showing that MNSFβ·Bcl-G directly binds to near the phosphorylation site of ERKs (Fig. 2A).MNSFβ siRNA Increases LPS-stimulated TNFα Production by Raw Cells—It has been reported that ERK pathway is involved in the regulation of TNFα production (23Schröder N.W.J. Pfeil D. Opitz B. Michelsen K.S. Amberger J. Zähringer U. Göbel U.B. Schumann R.R. J. Biol. Chem. 2001; 276: 9713-9719Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 24Dumitru C.D. Ceci J.D. Tsatsanis C. Kontoyiannis D. Stamatakis K. Lin J.H. Patriotis C. Jenkins N.A. Copeland N.G. Kollias G. Tsichlis P.N. Cell. 2000; 103: 1071-1083Abstract Full Text Full Text PDF PubMed Scopus (693) Google Scholar, 25Shi L. Kishore R. McMullen M.R. Nagy L.E. Am. J. Physiol. 2002; 282: C1205-C1211Crossref PubMed Scopus (115) Google Scholar, 26Fu S.L. Hsu Y.H. Lee P.Y. Hou W.C. Hung L.C. Lin C.H. Chen C.M. Huang Y.J. Biochem. Biophys. Res. Commun. 2006; 339: 137-144Crossref PubMed Scopus (58) Google Scholar). Because our data suggested that covalent MNSFβ·Bcl-G complex affects ERK activation, it seemed likely that inhibition of MNSFβ expression would result in increased or decreased TNFα synthesis. Raw cells were transfected with scramble siRNA or siRNA directed against MNSFβ. After 72 h of siRNA transfection, Raw cells were stimulated with 100 ng/ml of LPS for 4 h. Then the concentration of TNFα in the supernatant was determined by ELISA. Production of the TNFα in LPS-stimulated Raw cells transfected with MNSFβ siRNA-437 was significantly (over 2-fold) up-regulated, compared with the cells with scramble siRNA (Fig. 3A). RT-PCR analysis demonstrated that MNSFβ siRNA-437, but not control scramble siRNA, specifically reduced the expression of MNSFβ but not glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Fig. 3C). Western blot analysis demonstrated that MNSFβ siRNA-437 reduced complex formation of MNSFβ with Bcl-G (33.5-kDa MNSFβ adduct) (Fig. 3D, lane 3). Like MNSFβ siRNA, Bcl-G siRNA also inhibited the complex formation of MNSFβ with Bcl-G (Fig. 3D, lane 4). We also determined whether Bcl-G siRNA would affect TNFα production by LPS-stimulated Raw cells. As can be seen in Fig. 3A, Bcl-G siRNA caused a significantly increased TNFα production, although the effect was less than that seen with MNSFβ siRNA. We did not observe a synergistic effect of transfection with both siRNA. To explore the RNAi effect at the mRNA level, we performed RT-PCR on total RNA isolated from siRNA-transfected Raw cells. MNSFβ siRNA-437 up-regulated 60% TNFα expression (data not shown). We also investigated whether MNSFβ siRNA would affect RANTES, a member of C-C chemokine superfamily, production by LPS-stimulated Raw cells. MNSFβ siRNA-437 caused a significantly increased RANTES production (Fig. 3B), indicative of the involvement of MNSFβ in RANTES production by LPS-stimulated Raw cells.FIGURE 3MNSFβ siRNA increases LPS-induced TNFα production. A, Raw cells were transfected with RNAiFect™ transfection reagent alone or siRNA directed against MNSFβ, Bcl-G, or scramble siRNA. After 72 h of siRNA transfection, Raw cells were stimulated with 100 ng/ml LPS for 4 h. Then the concentration of TNFα in the supernatant was determined by ELISA as described under “Experimental Procedures.” The data represent one of three independent experiments with similar results. Values are shown as the mean ± S.D. of triplicate samples. *, p < 0.05 versus untreated; **, p < 0.01. B, transfection experiments were performed as described above, although Raw cells were stimulated with LPS for 12 h. The concentration of RANTES in the supernatant was determined by ELISA. The data represent one of three independent experiments with similar results. Values are shown as the mean ± S.D. of triplicate samples. *, p < 0.05 versus untreated; **, p < 0.01. C, MNSFβ and Bcl-G mRNA expression was analyzed by RT-PCR after treatment with siRNAs for 48 h. D, 33.5-kDa MNSFβ·Bcl-G complex was determined by Western blot analysis with antibody directed against MNSFβ after transfection with siRNAs for 72 h. The data represent one of three independent experiments with similar results. Lane 1, no siRNA; lane 2, scramble; lane 3, MNSFβ; lane 4, Bcl-G. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.View Large Image Figure ViewerDownload Hi-res image Download (PPT)MNSFβ·Bcl-G Association with ERK Is Decreased in a LPS-dependent Manner—To determine whether the interaction of MNSFβ·Bcl-G with ERK could be altered by treatment with LPS, Raw cells were stimulated with 100 ng/ml of LPS f" @default.
• W1994315177 created "2016-06-24" @default.
• W1994315177 creator A5079948261 @default.
• W1994315177 creator A5085190477 @default.
• W1994315177 date "2006-06-01" @default.
• W1994315177 modified "2023-10-18" @default.
• W1994315177 title "The Ubiquitin-like Protein MNSFβ Regulates ERK-MAPK Cascade" @default.
• W1994315177 cites W1487505092 @default.
• W1994315177 cites W1497941038 @default.
• W1994315177 cites W1553941527 @default.
• W1994315177 cites W1614022827 @default.
• W1994315177 cites W1780544763 @default.
• W1994315177 cites W1832030339 @default.
• W1994315177 cites W1965171248 @default.
• W1994315177 cites W1968309990 @default.
• W1994315177 cites W1981243923 @default.
• W1994315177 cites W1993243592 @default.
• W1994315177 cites W1999836892 @default.
• W1994315177 cites W2000421661 @default.
• W1994315177 cites W2001192666 @default.
• W1994315177 cites W2001399809 @default.
• W1994315177 cites W2001822032 @default.
• W1994315177 cites W2002427738 @default.
• W1994315177 cites W2002898689 @default.
• W1994315177 cites W2013289317 @default.
• W1994315177 cites W2030311370 @default.
• W1994315177 cites W2032731042 @default.
• W1994315177 cites W2033105452 @default.
• W1994315177 cites W2034415508 @default.
• W1994315177 cites W2040792935 @default.
• W1994315177 cites W2054248107 @default.
• W1994315177 cites W2070044709 @default.
• W1994315177 cites W2073148985 @default.
• W1994315177 cites W2073253686 @default.
• W1994315177 cites W2079879285 @default.
• W1994315177 cites W2080889643 @default.
• W1994315177 cites W2093646218 @default.
• W1994315177 cites W2110559333 @default.
• W1994315177 cites W2126133378 @default.
• W1994315177 cites W2133987610 @default.
• W1994315177 cites W2141122215 @default.
• W1994315177 cites W2145573546 @default.
• W1994315177 cites W2416529593 @default.
• W1994315177 doi "https://doi.org/10.1074/jbc.m509907200" @default.
• W1994315177 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16621790" @default.
• W1994315177 hasPublicationYear "2006" @default.
• W1994315177 type Work @default.
• W1994315177 sameAs 1994315177 @default.
• W1994315177 citedByCount "31" @default.
• W1994315177 countsByYear W19943151772012 @default.
• W1994315177 countsByYear W19943151772013 @default.
• W1994315177 countsByYear W19943151772014 @default.
• W1994315177 countsByYear W19943151772015 @default.
• W1994315177 countsByYear W19943151772016 @default.
• W1994315177 countsByYear W19943151772018 @default.
• W1994315177 countsByYear W19943151772019 @default.
• W1994315177 countsByYear W19943151772020 @default.
• W1994315177 countsByYear W19943151772021 @default.
• W1994315177 countsByYear W19943151772023 @default.
• W1994315177 crossrefType "journal-article" @default.
• W1994315177 hasAuthorship W1994315177A5079948261 @default.
• W1994315177 hasAuthorship W1994315177A5085190477 @default.
• W1994315177 hasBestOaLocation W19943151771 @default.
• W1994315177 hasConcept C104317684 @default.
• W1994315177 hasConcept C11960822 @default.
• W1994315177 hasConcept C185592680 @default.
• W1994315177 hasConcept C25602115 @default.
• W1994315177 hasConcept C2909378205 @default.
• W1994315177 hasConcept C34146451 @default.
• W1994315177 hasConcept C43617362 @default.
• W1994315177 hasConcept C55493867 @default.
• W1994315177 hasConcept C57074206 @default.
• W1994315177 hasConcept C86803240 @default.
• W1994315177 hasConcept C95444343 @default.
• W1994315177 hasConceptScore W1994315177C104317684 @default.
• W1994315177 hasConceptScore W1994315177C11960822 @default.
• W1994315177 hasConceptScore W1994315177C185592680 @default.
• W1994315177 hasConceptScore W1994315177C25602115 @default.
• W1994315177 hasConceptScore W1994315177C2909378205 @default.
• W1994315177 hasConceptScore W1994315177C34146451 @default.
• W1994315177 hasConceptScore W1994315177C43617362 @default.
• W1994315177 hasConceptScore W1994315177C55493867 @default.
• W1994315177 hasConceptScore W1994315177C57074206 @default.
• W1994315177 hasConceptScore W1994315177C86803240 @default.
• W1994315177 hasConceptScore W1994315177C95444343 @default.
• W1994315177 hasIssue "25" @default.
• W1994315177 hasLocation W19943151771 @default.
• W1994315177 hasOpenAccess W1994315177 @default.
• W1994315177 hasPrimaryLocation W19943151771 @default.
• W1994315177 hasRelatedWork W1521411817 @default.
• W1994315177 hasRelatedWork W1966199536 @default.
• W1994315177 hasRelatedWork W1982459028 @default.
• W1994315177 hasRelatedWork W1998344207 @default.
• W1994315177 hasRelatedWork W2009037891 @default.
• W1994315177 hasRelatedWork W2463958563 @default.
• W1994315177 hasRelatedWork W2976725891 @default.
• W1994315177 hasRelatedWork W3093368373 @default.
• W1994315177 hasRelatedWork W4206814676 @default.

• next