FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1994678168> ?p ?o ?g. }

• W1994678168 endingPage "2434" @default.
• W1994678168 startingPage "2419" @default.
• W1994678168 abstract "Clathrin-coated vesicles are responsible for the trafficking of several internalized biological cargos. We have observed that the endogenous F-actin-linker moesin co-distributes with constitutive components of clathrin-coated structures. Total internal reflection fluorescence microscopy studies have shown that short interference RNA of moesin enhances the lateral movement of clathrin-coated structures and provokes their abnormal clustering. The aggregation of clathrin-coated structures has also been observed in cells overexpressing N-moesin, a dominant-negative construct unable to bind to F-actin. Only overexpressed moesin constructs with an intact phosphatidylinositol 4,5-bisphosphate-binding domain co-distribute with clathrin-coated structures. Hence, this N-terminal domain is mostly responsible for moesin/clathrin-coated structure association. Biochemical endosome fractioning together with total internal reflection fluorescence microscopy comparative studies, between intact cells and plasma-membrane sheets, indicate that moesin knockdown provokes the accumulation of endocytic rab5-clathrin-coated vesicles carrying the transferrin receptor. The altered trafficking of these endocytic rab5-clathrin-coated vesicles accounts for a transferrin receptor recycling defect that reduces cell-surface expression of the transferrin receptor and increases the amount of sequestered transferrin ligand. Therefore, we propose that moesin is a clathrin-coated vesicle linker that drives cargo trafficking and acts on nascent rab5-clathrin-coated vesicles by simultaneously binding to clathrin-coated vesicle-associated phosphatidylinositol 4,5-bisphosphate and actin cytoskeleton. Hence, functional alterations of moesin may be involved in pathological disorders associated with clathrin-mediated internalization or receptor recycling. Clathrin-coated vesicles are responsible for the trafficking of several internalized biological cargos. We have observed that the endogenous F-actin-linker moesin co-distributes with constitutive components of clathrin-coated structures. Total internal reflection fluorescence microscopy studies have shown that short interference RNA of moesin enhances the lateral movement of clathrin-coated structures and provokes their abnormal clustering. The aggregation of clathrin-coated structures has also been observed in cells overexpressing N-moesin, a dominant-negative construct unable to bind to F-actin. Only overexpressed moesin constructs with an intact phosphatidylinositol 4,5-bisphosphate-binding domain co-distribute with clathrin-coated structures. Hence, this N-terminal domain is mostly responsible for moesin/clathrin-coated structure association. Biochemical endosome fractioning together with total internal reflection fluorescence microscopy comparative studies, between intact cells and plasma-membrane sheets, indicate that moesin knockdown provokes the accumulation of endocytic rab5-clathrin-coated vesicles carrying the transferrin receptor. The altered trafficking of these endocytic rab5-clathrin-coated vesicles accounts for a transferrin receptor recycling defect that reduces cell-surface expression of the transferrin receptor and increases the amount of sequestered transferrin ligand. Therefore, we propose that moesin is a clathrin-coated vesicle linker that drives cargo trafficking and acts on nascent rab5-clathrin-coated vesicles by simultaneously binding to clathrin-coated vesicle-associated phosphatidylinositol 4,5-bisphosphate and actin cytoskeleton. Hence, functional alterations of moesin may be involved in pathological disorders associated with clathrin-mediated internalization or receptor recycling. Clathrin-mediated endocytosis is a key process that governs the internalization of a plethora of cell-surface receptors in metazoans, such as G-protein-coupled receptors and epithelial growth factor receptors, and is essential for controlling cell integrity, division, and signaling (1Maldonado-Baez L. Wendland B. Trends Cell Biol.. 2006; 16: 505-513Google Scholar, 2Ungewickell E.J. Hinrichsen L. Curr. Opin. Cell Biol.. 2007; 19: 417-425Google Scholar, 3Le Borgne R. Bardin A. Schweisguth F. Development.. 2005; 132: 1751-1762Google Scholar, 4Le Roy C. Wrana J.L. Nat. Rev. Mol. Cell. Biol.. 2005; 6: 112-126Google Scholar, 5Benesch S. Polo S. Lai F.P. Anderson K.I. Stradal T.E. Wehland J. Rottner K. J. Cell Sci.. 2005; 118: 3103-3115Google Scholar, 6Scott M.G. Benmerah A. Muntaner O. Marullo S. J. Biol. Chem.. 2002; 277: 3552-3559Google Scholar). The dynamic process that enables clathrin-coated pits (CCPs) 5The abbreviations used are: CCP, clathrin-coated pit; CCV, clathrin-coated vesicle; ERM, ezrin-radixin-moesin; LCa-DsRed, clathrin light-chain a DsRed fusion protein; TIRFM, total internal reflection fluorescence microscopy; PIP2, phosphatidylinositol 4,5-bisphosphate; siRNA, short interference RNA; Tf, transferrin ligand; TfR, Tf receptor; mAb, monoclonal antibody; polyAb, polyclonal antibody; GFP, green fluorescent protein; PBS, phosphate-buffered saline; CHC, clathrin heavy chain; EGFP, enhanced GFP; TfR-phl, TfR-phluorin; ECFP-PH, ECFP-tagged pleckstrin homology domain. 5The abbreviations used are: CCP, clathrin-coated pit; CCV, clathrin-coated vesicle; ERM, ezrin-radixin-moesin; LCa-DsRed, clathrin light-chain a DsRed fusion protein; TIRFM, total internal reflection fluorescence microscopy; PIP2, phosphatidylinositol 4,5-bisphosphate; siRNA, short interference RNA; Tf, transferrin ligand; TfR, Tf receptor; mAb, monoclonal antibody; polyAb, polyclonal antibody; GFP, green fluorescent protein; PBS, phosphate-buffered saline; CHC, clathrin heavy chain; EGFP, enhanced GFP; TfR-phl, TfR-phluorin; ECFP-PH, ECFP-tagged pleckstrin homology domain. to turn into clathrin-coated vesicles (CCVs) requires spatial coordination of several protein and lipid components working together to drive the formation and invagination of CCPs, and the subsequent scission and uncoating of CCVs (7Slepnev V.I. De Camilli P. Nat. Rev. Neurosci.. 2000; 1: 161-172Google Scholar, 8Merrifield C.J. Perrais D. Zenisek D. Cell.. 2005; 121: 593-606Google Scholar). Similarly, several lines of evidence have suggested a close association between the endocytic machinery in mammalian cells and the actin cytoskeleton (9Schafer D.A. Curr. Opin. Cell Biol.. 2002; 14: 76-81Google Scholar, 10Laroche G. Rochdi M.D. Laporte S.A. Parent J.L. J. Biol. Chem.. 2005; 280: 23215-23224Google Scholar, 11Hirasawa A. Awaji T. Sugawara T. Tsujimoto A. Tsujimoto G. Br. J. Pharmacol.. 1998; 124: 55-62Google Scholar, 12Lunn J.A. Wong H. Rozengurt E. Walsh J.H. Am. J. Physiol. Cell Physiol.. 2000; 279: C2019-2027Google Scholar, 13Zaslaver A. Feniger-Barish R. Ben-Baruch A. J. Immunol.. 2001; 166: 1272-1284Google Scholar, 14Cao H. Orth J.D. Chen J. Weller S.G. Heuser J.E. McNiven M.A. Mol. Cell. Biol.. 2003; 23: 2162-2170Google Scholar). Cortical actin dynamics is affected by cytoskeleton-associated proteins, such as those responsible for the growth and capping of actin filaments (15Mangeat P. Roy C. Martin M. Trends Cell Biol.. 1999; 9: 187-192Google Scholar). Therefore, the ezrin-radixin-moesin (ERM) proteins from the band 4.1 superfamily are fundamental in determining signaling-induced cell shape, membrane-protein localization, cell adhesion, motility, cytokinesis, phagocytosis, and the integration of membrane transport with signaling pathways (15Mangeat P. Roy C. Martin M. Trends Cell Biol.. 1999; 9: 187-192Google Scholar, 16Bretscher A. Edwards K. Fehon R.G. Nat. Rev. Mol. Cell. Biol.. 2002; 3: 586-599Google Scholar). These ERM functions rely directly on their regulated and reversible link between membrane-associated proteins and the actin cytoskeleton (15Mangeat P. Roy C. Martin M. Trends Cell Biol.. 1999; 9: 187-192Google Scholar). Remarkably, the F-actin-linker ezrin has recently been related to clathrin-mediated endocytosis of the α1β-adrenergic receptor, thereby contributing to receptor recycling to the plasma membrane (17Stanasila L. Abuin L. Diviani D. Cotecchia S. J. Biol. Chem.. 2006; 281: 4354-4363Google Scholar). Moreover, the trafficking of some G-protein-coupled receptors seems to be regulated by the ERM linker EBP50, also known as NHERF1 (17Stanasila L. Abuin L. Diviani D. Cotecchia S. J. Biol. Chem.. 2006; 281: 4354-4363Google Scholar, 18Cao T.T. Deacon H.W. Reczek D. Bretscher A. von Zastrow M. Nature.. 1999; 401: 286-290Google Scholar, 19Li J.G. Chen C. Liu-Chen L.Y. J. Biol. Chem.. 2002; 277: 27545-27552Google Scholar). These data suggest that the interaction of EBP50 and ERM proteins is necessary for receptor recycling, although the mechanism that relates EBP50/ERM/F-actin linking and the receptor membrane traffic pathway is still unknown. It is interesting that ezrin and moesin proteins have been found to be associated with endosomes in an annexin-II-dependent manner (20Harder T. Kellner R. Parton R.G. Gruenberg J. Mol. Biol. Cell.. 1997; 8: 533-545Google Scholar). However, there were no reports indicating functional evidence for moesin involvement during CCV formation, internalization, or recycling. In the present work, we have studied the functional involvement of the F-actin-linker moesin in the trafficking of CCVs. Total internal reflection fluorescence microscopy (TIRFM) using the clathrin light-chain a DsRed fusion protein (LCa-DsRed) (21Merrifield C.J. Feldman M.E. Wan L. Almers W. Nat. Cell Biol.. 2002; 4: 691-698Google Scholar), as well as biochemical approaches, indicates that moesin is a component of the complex molecular machinery involved in the control of the trafficking of nascent moesin-associated CCVs. Antibodies and Reagents—The monoclonal antibody (mAb) moesin (38/87)-sc-58806 recognizes moesin, the goat polyclonal antibody (polyAb) ezrin (C-19)-sc-6407 that recognizes ezrin and moesin, rabbit polyAb α-adaptin (M-300)-sc-10761, goat polyAb anti-rab5 (FL-205)-sc-28570, rabbit polyAb anti-rab7 (H-50)-sc-10767, mAb CD71 (3B82A1)-sc-32272 against transferrin receptor (TfR), and anti-phosphatidylinositol 4,5-bisphosphate (PIP2) mAb (sc-53412), and anti-GFP rabbit polyAb (sc-8334) came from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Anti-clathrin heavy chain (CHC), anti-γ-adaptin and anti-α-tubulin mAbs, and PIP2 were from Sigma-Aldrich. Secondary horseradish peroxidise-conjugated anti-mAb was from Immunotools (Friesoythe, Germany), and secondary horseradish peroxidise-conjugated anti-goat Ab was from Dako (Glostrup, Denmark). Alexa 488-conjugated transferrin (Tf), Alexa 568-labeled phalloïdin, and secondary antibodies Alexa 488- and/or Alexa 568-conjugated were from Invitrogen. DNA Constructs—Human FL, N- and C-moesin-GFP constructs were kindly provided by Dr. Francisco Sánchez-Madrid (Universidad Autónoma de Madrid, Spain) and Dr. Furthmayr (Stanford University, CA) (22Amieva M.R. Litman P. Huang L. Ichimaru E. Furthmayr H. J. Cell Sci.. 1999; 112: 111-125Google Scholar). LCa-DsRed, TfR-EGFP, and TfR-phluorin (TfR-phl) were provided by Dr. Wolfhard Almers (21Merrifield C.J. Feldman M.E. Wan L. Almers W. Nat. Cell Biol.. 2002; 4: 691-698Google Scholar) (Vollum Institute, Oregon Health & Science University, OR). ECFP-rab5, EGFP-rab7, and EYFP-rab11 were provided by Dr. Marino Zerial (Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany). GFP-α-adaptin construct was provided by Dr. Alexandre Benmerah (Institute Cochin, Paris, France). N-terminal ECFP-tagged pleckstrin homology domain of the phosphatidylinositol-specific phospholipase Cδ1 (ECFP-PH) was provided by Dr. Senena Corbalán-García (Universidad de Murcia, Spain), and was used as a PIP2 biosensor in the plasma membrane (23Stauffer T.P. Ahn S. Meyer T. Curr. Biol.. 1998; 8: 343-346Google Scholar, 24Varnai P. Balla T. J. Cell Biol.. 1998; 143: 501-510Google Scholar, 25Marin-Vicente C. Gomez-Fernandez J.C. Corbalan-Garcia S. Mol. Biol. Cell.. 2005; 16: 2848-2861Google Scholar). All constructs were verified by digestion with restriction enzymes and automated dideoxynucleotide sequencing. The 4K/4N-moesin-GFP construct was prepared by using the QuikChange site-directed mutagenesis kit from Stratagene (Cedar Creek, TX). The oligonucleotides (sense, (5′-3′)) used for introducing the K253N/K254N and the K262N/K263N mutations in the FL-moesin-GFP-(1-578) molecule were (the changed bases are underlined) GGAACATCTCTTTCAATGATAACAACTTTGTGATCAAGCCC and GTCATCAAGCCCATCGATAACAACGCCCCGGACTTCGTC, respectively. Both oligonucleotides were used as follows: 18 cycles, 95 °C, 50 s; 60 °C, 50 s; and 68 °C, 10 min. Cells and Transfection—The human HeLa cell line was grown at 37 °C in a humidified atmosphere with 5% CO2 in Dulbecco's modified Eagle's medium (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza), 1% of l-glutamine and 1% of the penicillin-streptomycin antibiotics. Cells were harvested and resuspended at a density of 50-70% in fresh supplemented Dulbecco's modified Eagle's medium, 24 h before cell transfection with siRNA and/or DNA construct. Specific Amaxa-kits (Amaxa GmbH, Koeln, Germany) were used for delivery of DNA constructs and/or siRNA into HeLa cells. Cells were nucleofected with 1 μm siRNA and/or 2 μg of each used DNA construct and assayed 24 h or 48 h later. None of the nucleofected protein constructs or siRNA oligonucleotides were toxic to the cells. Immunofluorescence—Immunofluorescent HeLa cells were grown on glass coverslips. The cells were washed three times with phosphate-buffered saline (PBS) and fixed for 3 min in 2% formaldehyde in PBS. Cells were washed three times with PBS after fixation and then permeabilized with 0.5% Triton X-100 in PBS. The cells were washed with PBS after permeabilization and immunostained for 1 h at room temperature for primary antibodies diluted in PBS. The fluorophore-conjugated secondary antibody was also diluted in PBS for 1 h at room temperature. Finally, several washings with PBS were performed at room temperature. Coverslips were mounted in Mowiol-antifade (Dako, Glostrup, Denmark) and imaged in xy mid-sections in a FluoView™ FV1000 confocal microscope (Olympus, Center Valley, PA), for high-resolution imaging of fixed cells. The final images were analyzed with Metamorph software (Universal Imaging Corp., Downington, PA). Western Blotting—The extent of protein expression or gene silencing was assessed by Western blot of cell lysates. Cells nucleofected with scrambled oligonucleotides or short interference RNA (siRNA) oligonucleotides against moesin (siRNA-moesin or -moesin2) or with the different DNA constructs were lysed 24 h later at +4 °C in 1% SDS sample buffer with a protease inhibitor mixture (Roche Diagnostics GmbH, Mannheim, Germany) and homogenized by sonication. Equivalent amounts of proteins, measured using the bicinchoninic acid method (BCA protein assay kit from Pierce), were separated by SDS-PAGE, using 12% gradient gels and electroblotted onto nitrocellulose membrane (Sigma-Aldrich). Cell lysates were immunoblotted with specific antibodies, and protein bands were detected by luminescence using an ECL System (Pierce). Messenger RNA Silencing—Alexa 546-conjugated or non-fluorescence siRNA oligonucleotides, scrambled or siRNA-moesin, were from Qiagen. siRNA-moesin was generated against the following mRNA sequence of moesin: 5′-agaucgaggaacagacuaa-3′. siRNA-moesin2 was generated against the following mRNA sequence of moesin: 5′-acuaacucccaagauaggcuuc-3′. Irrelevant scrambled siRNA served as a control. The siRNAs for moesin sustained specific interference of moesin protein expression for at least 72 h. Tf Uptake and Recycling Assays—Tf internalization assay: HeLa cells nucleofected with scrambled or siRNA-moesin oligonucleotides (1.5 μm) were detached with PBS/5 mm EDTA, washed three times with PBS, and balanced for 1 h at 37 °C in Tf uptake buffer (Krebs-Hepes buffer with 2 mm of Ca2+), before starting the experiment. Then, equivalent amounts of cells (1 × 106 cells·ml-1) were kept on ice-cold Tf uptake buffer, and incubated with 200 nm of Alexa 488-labeled Tf ligand at +4 °C for 30 min. Cells were washed in cold Tf uptake buffer to remove unbound ligand, and surface-bound fluorescent Tf was measured at +4 °C, under any experimental condition. This prebound Alexa 488-labeled Tf ligand was internalized at 37 °C for the indicated early times. Returning the samples to ice stopped the internalization of fluorescent Tf. Cells were washed with ice-cold PBS, and the remaining surface-bound Tf was removed by acid washing (PBS-glycine 150 mm, pH 2.3) for 3 min. Alexa 488-associated fluorescence Tf uptake was measured in cells by flow cytometry, and normalized by the total amount of Tf ligand prebound at +4 °C, as described (26Sever S. Damke H. Schmid S.L. J. Cell Biol.. 2000; 150: 1137-1148Google Scholar). Tf Recycling Assay—HeLa cells nucleofected with scrambled or siRNA-moesin oligonucleotides (1.5 μm) were detached as described for Tf uptake. Cells (1 × 106 cells·ml-1) were then incubated with Alexa 488-labeled Tf (200 nm in Tf uptake buffer) at 37 °C for 30 min. Cells were put in ice-cold buffer to stop the uptake and recycling processes and washed in acidic buffer (PBS-glycine 150 mm, pH 2.3) to remove recycled surface-Tf ligand. Cells were then reincubated to 37 °C to allow the recycling of the internalized fluorescent Tf for the indicated time points. At these time points, cells were put on ice, washed with acidic buffer to remove recycled Tf from the cell surface, and fixed (in PBS/2% paraformaldehyde). The amount of the fluorescent Tf ligand remained (non-released) in cells was measured by flow cytometry and expressed as the percentage of the initial intracellular Tf amount detected in cells (100%, time 0 of recycling), in each experimental condition. Cell Surface Expression of the TfR—To detect cell-surface TfR, cells were labeled for 1 h at +4 °C with mouse monoclonal anti-CD71 primary antibody diluted in PBS buffer, washed, and incubated 1 h at +4 °C with goat anti-mouse Alexa 568-conjugated secondary antibody. The cells were washed, fixed for 3 min in 2% paraformaldehyde, and fluorescence intensity was analyzed using FACScan (BD Biosciences, San José, CA). Data were analyzed using WinMDI 2.9 application software (1993-2000 Joseph Trotter). TIRFM—Cells were imaged with an inverted microscope Zeiss 200 m (Zeiss, Germany) through a 1.45-numerical aperture objective (alpha Fluar, 100×/1.45, Zeiss) in a Krebs-Hepes buffer containing 2 mm Ca2+. The objective was coupled to the coverslip using an immersion fluid (n488 = 1.518, Zeiss). The expanded beam of an argon ion laser (Lasos, Lasertechnik GmbH, Germany) was band-pass filtered and used to selectively excite different fluorescent proteins, for evanescent field illumination. Different filters were used for each analyzed fluorophor. The beam was focused at an off-axis position in the back focal plane of the objective. Light, after entering the coverslip, underwent total internal reflection as it struck the interface between the glass and the solution or cell at a glancing angle. Total internal reflection generates an evanescent field that declines exponentially with increasing distance from the interface, depending on the angle at which light strikes the interface. The angle was measured using a hemicylinder, as described previously (21Merrifield C.J. Feldman M.E. Wan L. Almers W. Nat. Cell Biol.. 2002; 4: 691-698Google Scholar). The images were projected onto a back-illuminated charge-coupled device camera (AxioCam MRm, Zeiss) through a dichoric and specific band-pass filter for each fluorophor. Each cell was imaged using Axiovision (Zeiss) for up to 2 min with 0.25-s exposures at 1 Hz when illuminated under the evanescent field. Tracking Analysis of CCSs Movement by TIRFM Imaging—Tracking analysis of single LCa-DsRed-labeled structures was performed by using Metamorph. CCSs were excluded if they were larger than 0.5 μm or if they became oblong at any time. We marked the position of each tagged pit and tracked their x-y position as a function of time. The average radius for the x-y lateral trajectories of tracked CCSs were determined in single cells, as described (27Gaidarov I. Santini F. Warren R.A. Keen J.H. Nat. Cell Biol.. 1999; 1: 1-7Google Scholar), and calculated from the total number of cells analyzed by Metamorph. TIRFM or Confocal Co-distribution Analysis—The overlap between different fluorescence molecules was determined by taking evanescent field and confocal images. The images were low-pass filtered using Metamorph. We plotted a small circle of 0.9-μm diameter around each analyzed spot and five circles outside these spots. These circles were used to calculate the local background. We drew 0.9-μm diameter circles around clathrin spots, duplicated the circles into the image of the pair molecule at identical pixel locations, and then determined whether the new circle contained a fluorescent point concentric to within 0.15 μm to quantify the degree of co-distribution of endogenous moesin with endogenous clathrin or α-adaptin molecules (by confocal), or the overexpressed fluorescent rab5, rab7, rab11, TfR, or α-adaptin molecules with LCa-DsRed-labeled CCSs (by TIRFM). Circles were scored as positive if they contained a fluorescent spot and negative if they did not. Moreover, co-localization was scored positive when the fluorescence intensity average was at least three times the standard deviation of the background. The percentage of co-distribution was determined in single cells after random co-distribution subtraction, and the average values were calculated from the total number of cells analyzed. Images were rotated 90 degrees and molecule co-distribution was calculated again, as described above, to determine that the observed correlation was not due to random signal overlap. If the observed co-localization was random, rotation of the image would not change the degree of signal overlap obtained before the rotation of the image. TIRFM-based Analysis of the Tf Binding to Cell-surface TfR—To study the binding of the Tf ligand to TfR at the cell surface by TIRFM, Alexa 568-labeled Tf (50 nm in Tf uptake buffer (Krebs-Hepes with 2 mm of Ca2+)) was added at +4 °C for 30 min to control (scrambled) or moesin-silenced cells. Both of these cells transiently expressed the TfR-phl receptor. Cells were kept in starvation medium before Tf incubation, incubated on ice in Tf uptake buffer for 30 min, and washed with cold-Tf uptake buffer. After binding of Alexa 568-labeled Tf to TfR-phl, the cell-surface-associated fluorescence was analyzed by TIRFM, as described above for TIRFM co-distribution analysis. Imaging TfR Exocytosis by TIRFM—Exocytosis of the TfR-phl receptor was monitored by TIRFM in control (scrambled) and moesin-silenced cells, both transiently overexpressing the fluorescent TfR-phl molecule. The frequency of TfR-phl exocytosis was calculated as the number of events recorded per cell for 60 s (3 frames/s), and comparing the frequency average between control and moesin-silenced cells (total events analyzed from 12 cells per each experimental condition). Preparation of Plasma-membrane Sheets—Freshly nucleofected cells were grown on glass coverslips (ø, 12 mm) overnight. The coverslip was then rinsed in HEPES buffer (25 mm, pH 7.4), and put in contact with poly-l-Lysine (0.2 mg·ml-1)-precoated glass coverslip (ø, 18 mm) for 30 min at room temperature. Afterward, this coverslip sandwich was placed onto moist filter paper for 10 min without applying pressure. The sandwich was transferred to a Petri dish and filled with HEPES buffer, and the large coverslip (ø, 18 mm) was positioned on top. The coverslips were spontaneously separated while floating, thereby ripping off the cells to obtain plasma-membrane sheets on the poly-l-lysine-coated glass coverslip (ø, 18 mm), as described (28Burns A.R. Oliver J.M. Pfeiffer J.R. Wilson B.S. Methods Mol. Biol.. 2008; 440: 235-245Google Scholar). These preparations were analyzed by TIRFM to visualize the different fluorescent nucleofected proteins at the cell surface. PIP2 Binding Assay and Dot-blot Analysis—Binding assay of FL-moesin-GFP or 4K/4N-moesin-GFP to soluble PIP2 was performed with purified moesin molecules from lysates of respective nucleofected cells. Cells were lysed at +4 °C (PBS-1% Triton X-100, completed with a protease inhibitor mixture), and sonicated for 10 s. These lysates were precleared, and then incubated (500 μg of total protein) overnight at +4 °C with anti-GFP polyAb (40 μg), non-covalently complexed to protein G-Sepharose beads (100 μl). Co-immunoprecipitated proteins were washed with PBS buffer and incubated with 100 μl of soluble PIP2 (0.5 mg·ml-1 in chloroform:methanol:1 n HCl: H2O; at a volume ratio of 20:10:1:1) for 2 h at room temperature. The samples were washed with PBS and boiled in β-mercaptoethanol-Laemmli sample buffer for 1 min at 90 °C. Protein G-Sepharose beads were removed by centrifugation, and the supernatants were spotted in polyvinylidene fluoride membranes using a dot-blot apparatus (Slotblot, GE Healthcare). PIP2 bands were probed with a specific anti-PIP2 mAb (1:200). The dot blots were then reprobed, after membrane stripping with anti-GFP polyAb (1:200). PIP2 and GFP fusion protein bands were detected by luminescence using the ECL system (Pierce). Subcellular Fractionation and Protein Precipitation—Scrambled (control) or siRNA-moesin-treated HeLa cells (1 × 107 cells) were washed twice with PBS at +4 °C. Cells were gently scraped from culture plates and collected by centrifugation. They were then homogenized in 200 μl of buffer (78 mm KCl, 4 mm MgCl2, 8.37 mm CaCl2, 10 mm EGTA, 50 mm HEPES/KOH, pH 7.0) containing 250 mm sucrose and centrifuged at 1000 × g for 5 min. The supernatants (from scrambled or siRNA-moesin cells) were placed on a 5-20% linear Optiprep™ (Nycomed, Amersham Biosciences) gradient, formed in 12 ml of the above buffer, and centrifuged at +4 °C, for 20 h at 100,000 × g, in an SW28 rotor (Beckman, Germany). Following the centrifugation, the total volume gradient was separated into 1-ml fractions, collected from top to bottom (from 5% to 20% Optiprep™ concentration, respectively). The protein precipitation was as follows: the volume of each collected fraction (1 ml) was duplicated with cool acetone (1 ml, -20 °C) in acetone-compatible tubes. The samples were then vortexed and incubated for 1 h at -20 °C, and further centrifuged for 10 min at 13,000 × g. Samples were decanted, and the protein pellets were resuspended in Laemmli buffer to be resolved by SDS-PAGE (12%) and Western blot techniques using specific antibodies. Statistics—Data were compared using Student's t test. Asterisks indicate p < 0.05. Moesin Co-distributes with Constitutive Components of CCSs—To study the involvement of moesin in CCV trafficking, we first analyzed the distribution of endogenous moesin with constitutive components of CCSs by using fluorescence confocal microscopy. We observed that endogenous moesin presented a punctated pattern of distribution in HeLa cells (Fig. 1), partially co-distributing with the endogenous CHC (Fig. 1A; quantified in Fig. 1D), a main component of the clathrin triskelion that forms CCPs and CCVs (29Kirchhausen T. Annu. Rev. Biochem.. 2000; 69: 699-727Google Scholar, 30Musacchio A. Smith C.J. Roseman A.M. Harrison S.C. Kirchhausen T. Pearse B.M. Mol. Cell.. 1999; 3: 761-770Google Scholar, 31Ybe J.A. Brodsky F.M. Hofmann K. Lin K. Liu S.H. Chen L. Earnest T.N. Fletterick R.J. Hwang P.K. Nature.. 1999; 399: 371-375Google Scholar). We also observed a partial co-distribution of moesin with endogenous α-adaptin (Fig. 1B; quantified in Fig. 1D), a key component of the AP2 complex for CCV formation and clathrin-mediated endocytosis (32Brodsky F.M. Chen C.Y. Knuehl C. Towler M.C. Wakeham D.E. Annu. Rev. Cell Dev. Biol.. 2001; 17: 517-568Google Scholar, 33Conner S.D. Schmid S.L. Nature.. 2003; 422: 37-44Google Scholar). However, endogenous moesin slightly co-distributed with the γ-adaptin protein (Fig. 1C; quantified in Fig. 1D), a component of the heterotetrameric adaptor protein complex AP-1, which has been involved in mediating cargo sorting from the trans-Golgi network to the endosome compartment (reviewed in Refs. 34Schmid S.L. Annu. Rev. Biochem.. 1997; 66: 511-548Google Scholar, 35Knuehl C. Chen C.Y. Manalo V. Hwang P.K. Ota N. Brodsky F.M. Traffic.. 2006; 7: 1688-1700Google Scholar, 36Robinson M.S. Trends Cell Biol.. 2004; 14: 167-174Google Scholar, 37Kirchhausen T. Cell.. 2002; 109: 413-416Google Scholar, 38Boehm M. Bonifacino J.S. Mol. Biol. Cell.. 2001; 12: 2907-2920Google Scholar), as well as in promoting retrograde endosome to trans-Golgi network transport (39Meyer C. Zizioli D. Lausmann S. Eskelinen E.L. Hamann J. Saftig P. von Figura K. Schu P. EMBO J.. 2000; 19: 2193-2203Google Scholar). The quantification of moesin co-distribution with these molecules was performed as indicated under “Experimental Procedures.” These data indicate that a pool of endogenous moesin mostly co-distributes with specific components of CCSs that are associated with plasma membrane-derived CCSs. Moesin Silencing Alters Movement and Causes Clustering of CCSs—To investigate the functional involvement of moesin in CCV trafficking, we first performed TIRFM experiments tracking LCa-DsRed-labeled structures in cells where endogenous moesin was silenced by siRNA (Fig. 2, A and B). We observed that overexpressed LCa-DsRed displayed a diffraction-limited punctated pattern in transfected cells (Fig. 2C, white arrows in scrambled and siRNA-moesin images), which is characteristic of CCSs (8Merrifield C.J. Perrais D. Zenisek D. Cell.. 2005; 121: 593-606Google Scholar, 21Merrifield C.J. Feldman M.E. Wan L. Almers W. Nat. Cell Biol.. 2002; 4: 691-698Google Scholar, 27Gaidarov I. Santini F. Warren R.A. Keen J.H. Nat. Cell Biol.. 1999; 1: 1-7G" @default.
• W1994678168 created "2016-06-24" @default.
• W1994678168 creator A5012674591 @default.
• W1994678168 creator A5038782747 @default.
• W1994678168 creator A5066171893 @default.
• W1994678168 creator A5088003575 @default.
• W1994678168 date "2009-01-01" @default.
• W1994678168 modified "2023-10-07" @default.
• W1994678168 title "Moesin Regulates the Trafficking of Nascent Clathrin-coated Vesicles" @default.
• W1994678168 cites W1507084693 @default.
• W1994678168 cites W1509530066 @default.
• W1994678168 cites W1512080499 @default.
• W1994678168 cites W1517127887 @default.
• W1994678168 cites W1564784444 @default.
• W1994678168 cites W1565704598 @default.
• W1994678168 cites W1595083713 @default.
• W1994678168 cites W1960862471 @default.
• W1994678168 cites W1965940344 @default.
• W1994678168 cites W1968323673 @default.
• W1994678168 cites W1969473585 @default.
• W1994678168 cites W1970277398 @default.
• W1994678168 cites W1975126814 @default.
• W1994678168 cites W1976609069 @default.
• W1994678168 cites W1978842225 @default.
• W1994678168 cites W1981378770 @default.
• W1994678168 cites W1983769291 @default.
• W1994678168 cites W1988518158 @default.
• W1994678168 cites W2001532503 @default.
• W1994678168 cites W2003603726 @default.
• W1994678168 cites W2004362675 @default.
• W1994678168 cites W2005252392 @default.
• W1994678168 cites W2012107438 @default.
• W1994678168 cites W2012848672 @default.
• W1994678168 cites W2013376648 @default.
• W1994678168 cites W2016166286 @default.
• W1994678168 cites W2016294450 @default.
• W1994678168 cites W2020631983 @default.
• W1994678168 cites W2024316397 @default.
• W1994678168 cites W2026740840 @default.
• W1994678168 cites W2027689184 @default.
• W1994678168 cites W2029022457 @default.
• W1994678168 cites W2029873308 @default.
• W1994678168 cites W2033021180 @default.
• W1994678168 cites W2039023142 @default.
• W1994678168 cites W2039526500 @default.
• W1994678168 cites W2041521061 @default.
• W1994678168 cites W2042395036 @default.
• W1994678168 cites W2046093759 @default.
• W1994678168 cites W2052213010 @default.
• W1994678168 cites W2053031822 @default.
• W1994678168 cites W2053527054 @default.
• W1994678168 cites W2053610637 @default.
• W1994678168 cites W2055231253 @default.
• W1994678168 cites W2060362040 @default.
• W1994678168 cites W2060982278 @default.
• W1994678168 cites W2062163666 @default.
• W1994678168 cites W2063273434 @default.
• W1994678168 cites W2064369134 @default.
• W1994678168 cites W2066444607 @default.
• W1994678168 cites W2068984345 @default.
• W1994678168 cites W2071636548 @default.
• W1994678168 cites W2073476855 @default.
• W1994678168 cites W2077178397 @default.
• W1994678168 cites W2078530446 @default.
• W1994678168 cites W2080691203 @default.
• W1994678168 cites W2082426787 @default.
• W1994678168 cites W2087980955 @default.
• W1994678168 cites W2093429365 @default.
• W1994678168 cites W2094993046 @default.
• W1994678168 cites W2103470975 @default.
• W1994678168 cites W2107383749 @default.
• W1994678168 cites W2115534911 @default.
• W1994678168 cites W2115666450 @default.
• W1994678168 cites W2115994196 @default.
• W1994678168 cites W2117352422 @default.
• W1994678168 cites W2119809698 @default.
• W1994678168 cites W2128015182 @default.
• W1994678168 cites W2130436369 @default.
• W1994678168 cites W2132236695 @default.
• W1994678168 cites W2134835707 @default.
• W1994678168 cites W2136452679 @default.
• W1994678168 cites W2138854186 @default.
• W1994678168 cites W2142498139 @default.
• W1994678168 cites W2143965966 @default.
• W1994678168 cites W2144420636 @default.
• W1994678168 cites W2144535282 @default.
• W1994678168 cites W2144945392 @default.
• W1994678168 cites W2145206503 @default.
• W1994678168 cites W2145273873 @default.
• W1994678168 cites W2145333947 @default.
• W1994678168 cites W2153841101 @default.
• W1994678168 cites W2159367229 @default.
• W1994678168 cites W2166155213 @default.
• W1994678168 cites W2166348969 @default.
• W1994678168 cites W2167806590 @default.
• W1994678168 cites W2167852809 @default.
• W1994678168 cites W2168596258 @default.
• W1994678168 cites W2169685486 @default.

• next