FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1994920666> ?p ?o ?g. }

• W1994920666 endingPage "1206" @default.
• W1994920666 startingPage "1198" @default.
• W1994920666 abstract "SummaryBackground: Development of adipose tissue is a complex process involving adipogenesis, angiogenesis and proteolytic remodeling of the extracellular matrix. The matrix metalloproteinase (MMP) system plays an important role in these processes. Objective: To establish a functional role of gelatinase A (MMP‐2) in the development of adipose tissue. Methods: Mice with genetic deficiency in gelatinase A (MMP‐2−/−) and their wild‐type littermates (MMP‐2+/+), as well as wild‐type mice treated with a gelatinase inhibitor, were kept on a high‐fat diet (HFD) for 15 weeks, and this was followed by analysis of weight and composition of the fat pads. Results: MMP‐2−/− mice gained significantly (P < 0.05) less weight on the HFD than MMP‐2+/+ mice, resulting in lower body weights (P < 0.0005). The weights of the isolated subcutaneous and gonadal adipose tissues were also significantly lower (P < 0.005 and P < 0.0005, respectively). Immunohistochemical analysis revealed significant (P < 0.05) adipocyte hypotrophy in both fat pads. Treatment of wild‐type mice with the gelatinase inhibitor Tolylsam resulted in an approximately 15% reduction of body weight (P < 0.0001) and significantly lower subcutaneous and gonadal adipose tissue mass, associated with adipose hypotrophy (all P < 0.0001). Conclusion: Deficiency of MMP‐2 impairs adipose tissue development in mice by contributing to adipocyte hypotrophy. Background: Development of adipose tissue is a complex process involving adipogenesis, angiogenesis and proteolytic remodeling of the extracellular matrix. The matrix metalloproteinase (MMP) system plays an important role in these processes. Objective: To establish a functional role of gelatinase A (MMP‐2) in the development of adipose tissue. Methods: Mice with genetic deficiency in gelatinase A (MMP‐2−/−) and their wild‐type littermates (MMP‐2+/+), as well as wild‐type mice treated with a gelatinase inhibitor, were kept on a high‐fat diet (HFD) for 15 weeks, and this was followed by analysis of weight and composition of the fat pads. Results: MMP‐2−/− mice gained significantly (P < 0.05) less weight on the HFD than MMP‐2+/+ mice, resulting in lower body weights (P < 0.0005). The weights of the isolated subcutaneous and gonadal adipose tissues were also significantly lower (P < 0.005 and P < 0.0005, respectively). Immunohistochemical analysis revealed significant (P < 0.05) adipocyte hypotrophy in both fat pads. Treatment of wild‐type mice with the gelatinase inhibitor Tolylsam resulted in an approximately 15% reduction of body weight (P < 0.0001) and significantly lower subcutaneous and gonadal adipose tissue mass, associated with adipose hypotrophy (all P < 0.0001). Conclusion: Deficiency of MMP‐2 impairs adipose tissue development in mice by contributing to adipocyte hypotrophy. Obesity and its associated diseases such as atherosclerosis, non‐insulin‐dependent diabetes mellitus and hypertension have become major health issues. Development of obesity is a complex process associated with extensive modifications in adipose tissue involving adipogenesis, angiogenesis and extracellular matrix (ECM) remodeling [1Crandall D.L. Hausman G.J. Kral J.G. A review of the microcirculation of adipose tissue: anatomic, metabolic, and angiogenic perspectives.Microcirculation. 1997; 4: 211-32Crossref PubMed Scopus (419) Google Scholar]. Matrix metalloproteinases (MMPs) contribute to each of these processes by degradation of ECM and basement membrane components or by activation of latent growth factors [2Dollery C.M. McEwan J.R. Henney A.M. Matrix metalloproteinases and cardiovascular disease.Circ Res. 1995; 77: 863-8Crossref PubMed Scopus (819) Google Scholar, 3Carmeliet P. Collen D. Development and disease in proteinase‐deficient mice: role of the plasminogen, matrix metalloproteinase and coagulation system.Thromb Res. 1998; 91: 255-85Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar]. Their specific role in the development of adipose tissue remains, however, to be revealed. In this study, we focused on one member of a subclass of this zinc‐dependent superfamily of enzymes, gelatinase A (MMP‐2). Its main substrates are gelatins, different types of collagen, laminin, fibronectin, and elastin [4Okada Y. Proteinases and matrix degradation.in: Ruddy S Harris EDJr Sledge CB Kelley’s Textbook of Rheumatology. 6th edn. WB Saunders, 2001: 55-72Google Scholar]. Several lines of evidence suggest its involvement in the development of adipose tissue. Thus, MMP‐2 activity was detected in conditioned medium of rat adipocytes and may play a role in their multicellular organization [5Brown L.M. Fox H.L. Hazen S.A. LaNoue K.F. Rannels S.R. Lynch C.J. Role of the matrixin MMP‐2 in multicellular organization of adipocytes cultured in basement membrane components.Am J Physiol. 1997; 272: 937-49Crossref PubMed Google Scholar]. MMP‐2 is highly expressed in adipose tissue of mice with nutritionally induced obesity [6Lijnen H.R. Maquoi E. Holvoet P. Mertens A. Lupu F. Morange P. Alessi M.C. Juhan‐Vague I. Adipose tissue expression of gelatinases in mouse models of obesity.Thromb Haemost. 2001; 85: 1111-16Crossref PubMed Scopus (54) Google Scholar, 7Maquoi E. Munaut C. Colige A. Collen D. Lijnen H.R. Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity.Diabetes. 2002; 51: 1093-101Crossref PubMed Scopus (223) Google Scholar], as well as in genetically obese mice [6Lijnen H.R. Maquoi E. Holvoet P. Mertens A. Lupu F. Morange P. Alessi M.C. Juhan‐Vague I. Adipose tissue expression of gelatinases in mouse models of obesity.Thromb Haemost. 2001; 85: 1111-16Crossref PubMed Scopus (54) Google Scholar]. Analysis of the expression of gelatinases in adipose tissue of obese mice revealed upregulation of mRNA levels of MMP‐2 [6Lijnen H.R. Maquoi E. Holvoet P. Mertens A. Lupu F. Morange P. Alessi M.C. Juhan‐Vague I. Adipose tissue expression of gelatinases in mouse models of obesity.Thromb Haemost. 2001; 85: 1111-16Crossref PubMed Scopus (54) Google Scholar, 7Maquoi E. Munaut C. Colige A. Collen D. Lijnen H.R. Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity.Diabetes. 2002; 51: 1093-101Crossref PubMed Scopus (223) Google Scholar, 8Chavey C. Mari B. Monthouel M.N. Bonnafous S. Anglard P. Van Obberghen E. Tartare‐Deckert S. Matrix metalloproteinases are differentially expressed in adipose tissue during obesity and modulate adipocyte differentiation.J Biol Chem. 2003; 278: 11888-96Abstract Full Text Full Text PDF PubMed Scopus (359) Google Scholar]. Human adipocytes also produce MMP‐2 [9Bouloumié A. Sengenès C. Portolan G. Galitzky J. Lafontan M. Adipocyte produces matrix metalloproteinase 2 and 9. Involvement in adipocyte differentiation.Diabetes. 2001; 50: 2080-6Crossref PubMed Scopus (277) Google Scholar]. Its specific effect on adipose tissue, however, remains unknown, mainly because of the lack of appropriate animal models. We have studied nutritionally induced development of fat tissue in mice with genetic MMP‐2 deficiency and in wild‐type mice treated with a selective gelatinase inhibitor. MMP‐2‐deficient mice (MMP‐2−/−, genetic background 100% C57Bl/6) and corresponding wild‐type littermates (MMP‐2+/+) were obtained from heterozygous breeding pairs as described elsewhere [10Itoh T. Ikeda T. Gomi H. Nakao S. Suzuki T. Itohara S. Unaltered secretion of beta‐amyloid precursor protein in gelatinase A (matrix metalloproteinase 2)‐deficient mice.J Biol Chem. 1997; 272: 22389-92Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar]. Genotyping was performed using the following primers: for MMP‐2+/+ mice, 5′‐CAACGATGGAGGCACGAGTG‐3′ and 5′‐GCCGGGGAACTTGATGATGG‐3′; and for MMP‐2−/− mice, 5′‐TGCAAAGCGCATGCTCCAGA‐3′ and 5′‐TGTATGTGATCTGGTTCTTG‐3′; After a denaturation step at 95 °C for 5 min, isolated DNA was subjected to a polymerase chain reaction (PCR) consisting of denaturation at 94 °C for 1 min, followed by 1 min of annealing at 62 °C and 1 min of elongation at 72 °C for 35 cycles. Five‐week‐old male mice were kept in microisolation cages on a 12‐h day/night cycle and fed at libitum with a high‐fat diet (HFD; Harlan Teklad TD 88137, Zeist, The Netherlands; 42% kcal as fat, 20.1 kJ g−1) for 15 weeks. Weight and food intake were measured at weekly intervals. Mice were anesthetized by intraperitoneal injection of 60 mg kg−1 Nembutal (Abbott Laboratories, North Chicago, IL, USA). Blood was collected via the retro‐orbital sinus on trisodium citrate (final concentration 0.01 mol L−1), and plasma was stored at −80 °C. Intra‐abdominal (gonadal) and inguinal subcutaneous fat pads were removed and weighed; portions were snap‐frozen in liquid nitrogen for histologic and zymographic analysis, RNA extraction, or protein extraction. Other organs, including kidneys, lungs, spleen, pancreas, liver and heart, were also removed, weighed and snap‐frozen. For comparison, mice of each genotype (n = 4) were kept on standard fat diet (SFD; KM‐04‐k12, Muracon, Carfil, Oud‐Turnhout, Belgium; 13% kcal as fat, 10.9 kJ g−1). Body weight and food intake were monitored weekly. To evaluate energy expenditure, spontaneous physical activity was evaluated by placing the mice in a separate cage equipped with a turning wheel linked to a computer to register full turning cycles in a 72‐h period. Data are expressed as number of cycles per night (12 h), as daytime activity was very low. Body temperature was measured using a rectal probe (TR‐100; Fine Science Tools, Foster City, CA, USA). Data were first averaged per mouse for a 1‐week period, and are given as means ± SEM for the number of animals studied. In separate experiments, male wild‐type mice (C57Bl/6 genetic background) were fed the HFD for 15 weeks with (n = 10) or without (n = 10) addition of 100 mg kg−1 per day of Tolylsam [(R)‐3‐methyl‐2‐{4‐(3‐p‐tolyl‐1,2,4‐oxadiazol‐5‐yl)‐benzenesulfonylamino}‐butyric acid], an inhibitor of MMP‐2, MMP‐9 and MMP‐12 (a kind gift of Shionogi & Co., Ltd, Osaka, Japan) [11Aoki T. Kataoka H. Morimoto M. Nozaki K. Hashimoto N. Macrophage‐derived matrix metalloproteinase‐2 and ‐9 promote the progression of cerebral aneurysms in rats.Stroke. 2007; 38: 162-9Crossref PubMed Scopus (235) Google Scholar]. All animal experiments were approved by the local ethical committee (KULeuven, P06022) and were performed in accordance with the guiding principles of the American Physiological Society and the International Society on Thrombosis and Haemostasis [12Giles A.R. Guidelines for the use of animals in biomedical research.Thromb Haemost. 1987; 58: 1078-84Crossref PubMed Scopus (253) Google Scholar]. The size and density of adipocytes was determined on 10‐μm paraffin sections of subcutaneous or gonadal adipose tissue, stained with hematoxylin–eosin under standard conditions. For each mouse, at least 10 areas in 12 sections were measured using a computerized image analyzer, and the volume of each cell was calculated assuming spherical morphology [13Sjöström L. Bjöntorp P. Vrana J. Microscopic fat cell size measurements on frozen‐cut adipose tissue in comparison with automatic determinations of osmium‐fixed fat cells.J Lipid Res. 1971; 12: 521-30Abstract Full Text PDF PubMed Google Scholar]. Data are expressed as mean ± SEM for the number of animals studied. Blood vessel staining was performed using the biotinylated Bandeiraea (Griffonia) Simplicifolia BSI lectin (Sigma‐Aldrich, Bornem, Belgium) [14Laitinen L. Griffonia simplicifolia lectins bind specifically to endothelial cells and some epithelial cells in mouse tissues.Histochem J. 1987; 19: 225-34Crossref PubMed Scopus (233) Google Scholar] followed by signal amplification with the Tyramide Signal Amplification Cyanine System (Perkin Elmer, Boston, MA, USA), and analysis by computer‐assisted image analysis. Blood vessel density was normalized to the adipocyte number. Gelatinase activity was determined by zymography or using a quenched fluorescently labeled substrate. Extracts were prepared by lysing adipose tissues in 10 mmol L−1 phosphate buffer, pH 7.2, containing 150 mmol L−1 NaCl, 1% Triton X‐100, 0.5% sodium deoxycholate, and 0.2% sodium azide. Total protein concentration was determined using the bicinchoninic acid (BCA) method (BCATM Protein Assay Kit assay; Pierce, Rockford, IL, USA). Samples were analyzed by zymography on gelatin‐containing gels as previously described [15Alexander C.M. Werb Z. Targeted disruption of the tissue inhibitor of metalloproteinases gene increases the invasive behavior of primitive mesenchymal cells derived from embryonic stem cells in vitro.J Cell Biol. 1992; 118: 727-39Crossref PubMed Scopus (106) Google Scholar, 16Kleiner D.E. Stetler Stevenson W.G. Quantitative zymography: detection of picogram quantities of gelatinases.Anal Biochem. 1994; 218: 325-9Crossref PubMed Scopus (818) Google Scholar]. Twenty micrograms of protein was subjected to non‐reduced sodium dodecylsulfate polyacrylamide gel electrophoresis using 10% gels containing 0.1% gelatin. Gels were renatured by exchanging sodium dodecylsulfate with Triton X‐100 (2.5%), and then incubated for 24 h at 37 °C in developing buffer (50 mmol L−1 Tris–HCl, pH 7.5, containing 7 mmol L−1 CaCl2, 0.2 mol L−1 NaCl, and 0.02% Brij‐35). Gels were subsequently stained with Coomassie (0.5% Coomassie R250, 45% MeOH, 10% acetic acid) for 3 h, and this was followed by destaining (45% EtOH and 10% acetic acid). To activate pro‐MMPs, protein extracts were incubated with 0.5 mmol L−1p‐aminophenylmercuric acid (APMA) for 16 h at 37 °C prior to loading on gels. Gels were scanned (Epson Perfection V700 PHOTO scanner, Nagano, Japan) and bands quantified with NIH ImageJ 1.30 software. Alternatively, 20 μg of total protein was diluted in assay buffer (50 mmol L−1 Tris–HCl, pH 7.4, containing 0.1% Brij‐35, 10 mmol L−1 CaCl2, and 10 μmol L−1 ZnCl2) containing 5 μmol L−1 quenched fluorescently labeled substrate (OmniMMP Fluorogenic substrate; Biomol, Plymouth Meeting, PA, USA) [17Fields G.B. Using fluorogenic peptide substrates to assay matrix metalloproteinases.Methods Mol Biol. 2001; 151: 495-518PubMed Google Scholar]. For background correction, equivalent samples were measured in the presence of EDTA (50 mmol L−1 Tris–HCl, pH 7.4, containing 0.1% Brij‐35 and 50 mmol L−1 EDTA). MMP activity was monitored for 12 h with a Spectra Gemini fluorometer (Molecular Devices Corp., Sunnyvale, CA, USA) and analyzed with SOFTmax pro 4.0 (Molecular Devices Corp.). Expression of mRNA of MMP‐2, MMP‐9, tissue inhibitor of metalloproteinase (TIMP)‐1, TIMP‐2 and an endogenous control gene [glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH)] was measured by real‐time PCR using TaqMan Gene Expression Assay products [product numbers: Mm99999915_g1 (GAPDH), Mm00439506_m1 (MMP‐2), Mm01240562_g1 (MMP‐9), Mm00441818_m1 (TIMP‐1), Mm00441825_m1 (TIMP‐2); Applied Biosystems, Foster City, CA, USA] on an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems). MMP‐2, MMP‐9, TIMP‐1 and TIMP‐2 mRNA levels were normalized to that of endogenous GAPDH mRNA. Adipose tissues were homogenized using lysing matrix tubes (Qbiogene, Carlsbad, CA, USA) in a Hybaid ribolyser (Thermo, Wallham, MA, USA). Total DNA‐free RNA was extracted using the RNA Easy Quiagen kit (Quiagen, Valencia, CA, USA), and RNA concentrations were determined with the RiboGreen RNA quantification kit (Molecular Probes, Eugene, OR, USA). Samples were aliquoted and stored at −80 °C. Reverse transcription reactions were performed from 10 ng of total RNA with thermostable reverse transcriptase (rTth) at 70 °C for 15 min, and this was followed by 2 min of incubation at 95 °C for denaturation of RNA–DNA heteroduplexes, using the GeneAmp Thermostable RNA PCR Kit (Applied Biosystems) and target‐specific antisense primers. Amplification was started with 15 s at 94 °C, 20 s at 68 °C and 10 s at 72 °C (35 cycles) and terminated by 2 min at 72 °C, on a GeneAmp PCR System 9700 thermocycler (Perkin Elmer, Waltham, MA, USA). Blood glucose concentrations were measured using Glucocard strips (Menarini Diagnostics, Firenze, Italy). Levels of triglycerides, total cholesterol, high‐density lipoprotein cholesterol and low‐density lipoprotein cholesterol in plasma were determined using standard laboratory assays. Insulin (Mercodia, Uppsala, Sweden), adiponectin (R&D Systems, Abingdon, UK), leptin (R&D Systems), resistin (R&D Systems) and vascular endothelial growth factor (VEGF)‐A (R&D Systems) levels were determined using commercially available enzyme‐linked immunosorbent assays. For glucose tolerance and insulin sensitivity tests, after overnight fasting, glucose (3 mg g−1 body weight) or insulin (0.5 mU g−1) were injected into the peritoneal cavity of 20‐week‐old MMP‐2−/− mice (body weight = 24.4 ± 0.5 g, n = 4) or MMP‐2+/+ mice (body weight = 26.7 ± 0.4 g, n = 4) kept on standard chow. Blood was collected via the tail vein for glucose measurement before injection and at 15–30‐min intervals for 150 min. The area under the curve (AUC) of glucose levels vs. time was determined for each experiment. Data are expressed as mean ± SEM. Differences between groups were analyzed with the non‐parametric t‐test (Mann–Whitney). Comparison of progress curves was performed by two‐way repeated‐measures anova. Statistical significance was set at P < 0.05. Body weight and adipose tissue composition At 5 weeks of age, the body weight of MMP‐2−/− mice was lower than that of wild‐type littermates (MMP‐2+/+) (Fig. 1A and Table 1). During HFD feeding, weight gain was significantly reduced for MMP‐2−/− as compared to MMP‐2+/+ mice (Fig. 1B), resulting in significantly lower body weight at the end of the 15‐week experimental period.Table 1Effect of gelatinase A deficiency and gelatinase inhibition on adipose tissue and organ weights of mice kept on a high‐fat diet for 15 weeksGelatinase ATolylsamMMP‐2+/+ (n = 10)MMP‐2−/− (n = 9)Controls (n = 10)Inhibitor (n = 10)Body weight start (g)21 ± 0.318 ± 0.7‡22 ± 0.322 ± 0.4Body weight end (g)42 ± 1.034 ± 1.3‡43 ± 1.036 ± 0.7‡Weight gain (g)21 ± 0.916 ± 1.3*21 ± 0.815 ± 0.7‡SC fat (g)1.6 ± 0.10.9 ± 0.1†1.6 ± 0.10.8 ± 0.1‡GON fat (g)2.5 ± 0.11.5 ± 0.1‡2.1 ± 0.11.3 ± 0.1‡Lungs (mg)166 ± 18163 ± 15172 ± 17189 ± 13Spleen (mg)83 ± 577 ± 5106 ± 696 ± 3Heart (mg)148 ± 5136 ± 7*149 ± 6149 ± 4Pancreas (mg)262 ± 18201 ± 14*255 ± 20173 ± 10†Liver (mg)2650 ± 1551390 ± 140‡2620 ± 1722470 ± 99Kidneys (mg)401 ± 20375 ± 18450 ± 16414 ± 8MMP, matrix metalloproteinase; SC, subcutaneous; GON, gonadal. Data are mean ± SEM of n experiments in each group. *P < 0.05, †P < 0.005, ‡P < 0.0005 vs. the corresponding wild‐type mice. Open table in a new tab MMP, matrix metalloproteinase; SC, subcutaneous; GON, gonadal. Data are mean ± SEM of n experiments in each group. *P < 0.05, †P < 0.005, ‡P < 0.0005 vs. the corresponding wild‐type mice. Food intake was lower for MMP‐2−/− mice (3.0 ± 0.02 g per day vs. 3.1 ± 0.03 g per day for MMP‐2+/+ mice, P < 0.0001), but feeding efficiency (weight gain normalized to caloric intake) was not different (2.7 ± 0.3 mg kJ−1 vs. 3.2 ± 0.3 mg kJ−1, P = 0.11). The weight of the isolated subcutaneous and gonadal adipose tissues was also significantly lower for the MMP‐2−/− mice. The weight of kidneys, lungs and spleen did not differ between the two genotypes, whereas heart, pancreas and liver weights were lower in MMP‐2−/− mice (Table 1). When kept on normal chow (SFD), the body weight of age‐ and sex‐matched MMP‐2−/− mice was significantly lower than that of MMP‐2+/+ mice (28 ± 0.4 g vs. 32 ± 0.4 g, P = 0.03), whereas food intake was comparable (4.6 ± 0.17 g per mouse per day vs. 4.5 ± 0.16 g per mouse per day, P = 0.88). Energy expenditure for MMP‐2+/+ and MMP‐2−/− mice, as measured in cages with a computer‐linked turning wheel, was comparable (11 890 ± 2600 turning cycles/12 h vs. 12 730 ± 1330 turning cycles/12 h, P = 1.00). Also, the rectal temperature was not different between MMP‐2+/+ and MMP‐2−/− mice (38.6 ± 0.04 °C vs. 38.7 ± 0.06 °C, P = 0.63). Histologic analysis of hematoxylin–eosin‐stained paraffin sections revealed a smaller adipocyte size in both subcutaneous and gonadal adipose tissues of MMP‐2−/− mice, corresponding to a higher adipocyte density (Table 2 and Fig. 2A,B). Staining with an endothelial cell‐specific lectin revealed no differences in blood vessel size or density, even after normalization for adipocyte density (Table 2).Table 2Effect of gelatinase A deficiency and gelatinase inhibition on adipocyte and blood vessel size and density in adipose tissue of mice kept on a high‐fat diet for 15 weeksGelatinase ATolylsamMMP‐2+/+ (n = 10)MMP‐2−/− (n = 9)Controls (n = 10)Inhibitor (n = 10)Adipocyte size (μm2) SC fat4160 ± 1703350 ± 270*4330 ± 1423040 ± 169‡ GON fat6860 ± 3105430 ± 520*6800 ± 2614960 ± 241‡Adipocyte density (×10−6 μm−2) SC fat255 ± 17338 ± 30*239 ± 8355 ± 22† GON fat151 ± 8203 ± 28*150 ± 5208 ± 10†Blood vessel size (μm2) SC fat44 ± 4.535 ± 3.141 ± 1.928 ± 1.7† GON fat45 ± 3.643 ± 2.445 ± 1.730 ± 2.7†Blood vessel density (×10−6 μm−2) SC fat320 ± 56312 ± 60320 ± 14330 ± 19 GON fat227 ± 26261 ± 56236 ± 9214 ± 13Normalized blood vessel density SC fat1.3 ± 0.21.0 ± 0.21.3 ± 0.10.9 ± 0.1† GON fat1.4 ± 0.21.4 ± 0.31.5 ± 0.11.0 ± 0.1‡MMP, matrix metalloproteinase; SC, subcutaneous; GON, gonadal. Data are mean ± SEM of n experiments in each group. *P < 0.05, †P < 0.005, ‡P < 0.0005 vs. the corresponding wild‐type mice. Open table in a new tab MMP, matrix metalloproteinase; SC, subcutaneous; GON, gonadal. Data are mean ± SEM of n experiments in each group. *P < 0.05, †P < 0.005, ‡P < 0.0005 vs. the corresponding wild‐type mice. Obese MMP‐2−/− mice displayed significantly lower levels of glucose, insulin and cholesterol than their wild‐type littermates, whereas triglyceride levels were not affected (Table 3). No differences were observed between MMP‐2+/+ and MMP‐2−/− mice in glucose tolerance (AUC of 58.100 ± 5.510 vs. 64.800 ± 4.650, P = 0.68) (Fig. 3A) or in insulin sensitivity (AUC of 10.800 ± 130 vs. 10.900 ± 440, P = 1.00) (Fig. 3B).Table 3Effect of gelatinase A deficiency and gelatinase inhibition on plasma metabolic parameters of mice kept on a high‐fat diet for 15 weeksGelatinase ATolylsamMMP‐2+/+ (n = 10)MMP‐2−/− (n = 9)Controls (n = 10)Inhibitor (n = 10)Glucose (mg dL−1)187 ± 13139 ± 16*142 ± 14101 ± 16*Insulin (mg mL−1)1.8 ± 0.30.9 ± 0.2*1.8 ± 0.31.2 ± 0.3Triglycerides (mg dL−1)48 ± 356 ± 968 ± 547 ± 5*Total cholesterol (mg dL−1)176 ± 19114 ± 11*163 ± 13181 ± 11HDL cholesterol (mg dL−1)166 ± 14117 ± 11*152 ± 5169 ± 10LDL cholesterol (mg dL−1)35 ± 518 ± 2†NDNDMMP, matrix metalloproteinase; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein; ND, not determined. Data are mean ± SEM of n experiments in each group.*P < 0.05, †P < 0.0005 vs. the corresponding wild‐type mice. Open table in a new tab MMP, matrix metalloproteinase; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein; ND, not determined. Data are mean ± SEM of n experiments in each group. *P < 0.05, †P < 0.0005 vs. the corresponding wild‐type mice. Plasma levels of resistin were comparable in MMP‐2−/− and MMP‐2+/+ mice (12 ± 0.5 ng mL−1 vs. 11 ± 1.0 ng mL−1, P = 0.24), whereas adiponectin levels were significantly higher (8.92 ± 0.64 μg mL−1 vs. 6.77 ± 0.37 μg mL−1, P = 0.008) and leptin levels were significantly lower (12 ± 1.0 ng mL−1 vs. 18 ± 0.80 ng mL−1, P = 0.0008) in MMP‐2−/− mice. VEGF‐A protein levels in adipose tissue extracts of MMP‐2+/+ and MMP‐2−/− mice were comparable for subcutaneous (10 ± 0.9 pg mg−1 protein vs. 10 ± 0.6 pg mg−1 protein) and gonadal (13 ± 1.5 pg mg−1 protein vs. 16 ± 1.5 pg mg−1 protein) tissues. TIMP‐1 mRNA levels were comparable for MMP‐2+/+ and MMP‐2−/− mice in both subcutaneous (13 ± 3.0 arbitrary units (AU) vs. 10 ± 1.0 AU) and gonadal (76 ± 15 AU vs. 50 ± 9 AU) adipose tissues. Similarly, TIMP‐2 mRNA levels were similar for MMP‐2+/+ and MMP‐2−/− mice in subcutaneous (2290 ± 150 AU vs. 2720 ± 200 AU) and gonadal (3380 ± 320 AU vs. 3060 ± 300 AU) fat. Gelatinase expression and activity On zymograms, four gelatinolytic bands were consistently observed in adipose tissues from wild‐type mice, corresponding to pro‐MMP‐9 (92 kDa), pro‐MMP‐2 (72 or 68 kDa, differently glycosylated) and active MMP‐2 (58 kDa). Active MMP‐2 (62‐kDa form) and active MMP‐9 (82‐kDa form) were not consistently detected. Zymography confirmed the absence of MMP‐2 in the MMP‐2−/− subcutaneous and gonadal adipose tissues (Fig. 4) and revealed an upregulation of MMP‐9 in subcutaneous adipose tissues of MMP‐2−/− mice (14 ± 1.4 AU vs. 5 ± 1.2 AU for MMP‐2+/+, P = 0.03), but not in gonadal adipose tissues (5 ± 0.6 AU vs. 5 ± 0.4 AU). Activation with APMA for 16 h resulted in reduced levels of the latent forms of MMP‐2, with concomitant increase of active MMP‐2 (58 kDa) and appearance of 62‐kDa active MMP‐2. In subcutaneous adipose tissue of MMP‐2−/− mice, a significant upregulation of MMP‐9 mRNA was observed (157 ± 16 AU vs. 70 ± 6 AU in MMP‐2+/+ samples, P < 0.0001). This difference was not observed in the gonadal adipose tissues (31 ± 4 AU vs. 32 ± 6 AU). Zymography with plasma samples further confirmed the absence of MMP‐2 in MMP‐2−/− mice and revealed upregulation of MMP‐9 (10 ± 1.0 AU vs. 5 ± 0.5 AU in MMP‐2+/+ mice, P = 0.0003). Body weight and adipose tissue composition Wild‐type mice fed the HFD supplemented with Tolylsam had a lower body weight gain (Fig. 1D), resulting in a lower body weight after 15 weeks as compared to the mice on HFD only (Fig. 1C). Food intake of inhibitor‐treated mice (2.2 ± 0.04 g per day) was higher than that of untreated mice (2.0 ± 0.05 g per day, P = 0.003), but the feeding efficiency was lower (2.9 ± 0.4 mg kJ−1 vs. 4.9 ± 0.7 mg kJ−1, P = 0.02). The weight of subcutaneous and gonadal fat pads was significantly lower in the inhibitor‐treated than in the placebo‐treated mice (Table 1). Histologic analysis revealed a smaller adipocyte size (Fig. 2C,D) and smaller vessels in adipose tissues (Fig. 5). The blood vessel density was not affected in inhibitor‐treated mice, but after normalization for adipocyte density, this was significantly lower for both subcutaneous and gonadal fat pads (Table 2). Metabolic parameters were not significantly affected by Tolylsam treatment, with the exception of reduced glucose and triglyceride levels (both P < 0.05) (Table 3). Plasma levels of resistin (16 ± 1.2 ng mL−1 vs. 14 ± 0.70 ng mL−1, P = 0.13) and adiponectin (4.73 ± 1.6 μg mL−1 vs. 2.5 ± 0.67 μg mL−1, P = 0.48) were comparable in Tolylsam‐treated and in control mice, whereas leptin levels were significantly reduced (10 ± 1.1 ng mL−1 vs. 17 ± 0.70 ng mL−1, P = 0.0003) in Tolylsam‐treated mice. VEGF‐A levels in subcutaneous adipose tissues were not affected by Tolylsam treatment (11 ± 0.7 pg mg−1 protein vs. 10 ± 0.3 pg mg−1 protein for controls), but were enhanced in gonadal adipose tissues (22 ± 1.6 pg mg−1 protein vs. 13 ± 0.5 pg mg−1 protein for controls, P < 0.0001). Treatment with Tolylsam did not affect TIMP‐1 mRNA levels in subcutaneous (17 ± 3 AU vs. 22 ± 3 AU for controls) or gonadal (60 ± 5 AU vs. 74 ± 7 AU for controls) adipose tissues. Similarly, TIMP‐2 mRNA levels were not affected in either subcutaneous (2240 ± 130 AU vs. 2020 ± 100 AU for controls) or gonadal (2250 ± 140 AU vs. 2770 ± 350 AU for controls) adipose tissues. Gelatinase expression and activity Overall MMP activity in adipose tissue extracts, monitored using a fluorescent broad‐spectrum substrate, was only slightly decreased in the samples treated with inhibitor, as compared to placebo (P = 0.58) (data not shown). In both subcutaneous (553 ± 41 AU vs. 1040 ± 53 AU, P < 0.0001) and gonadal (282 ± 22 AU vs. 554 ± 41 AU, P = 0.0002) adipose tissues of inhibitor‐treated mice, mRNA levels of MMP‐2 were significantly lower than in adipose tissues of controls, whereas mRNA levels of MMP‐9 were higher in inhibitor‐treated tissues (for subcutaneous tissue, 77 ± 4 AU vs. 44 ± 4 AU, P = 0.0006; and for gonadal tissue, 20 ± 2 AU vs. 12 ± 1 AU, P = 0.002). Zymography of subcutaneous adipose tissue extracts revealed no difference in 92‐kDa pro‐MMP‐9 and 68‐kDa or 72‐kDa pro‐MMP‐2 levels. The 58‐kDa active MMP‐2 levels were, however, strongly reduced in the inhibitor‐treated mice. Thus, 58‐kDa active MMP‐2 levels amounted to 11 ± 2% of the total MMP‐2 species (active plus latent) for inhibitor‐treated subcutaneous adipose tissues, as compared to 26 ± 2% for placebo‐treated samples (P < 0.0005). Active MMP‐9 could not be consistently detected (Table 4).Table 4Effect of Tolylsam on gelatinolytic activity in adipose tissues of mice kept on a high‐fat diet for 15 weeksPlaceboTolylsamSC adipose tissue 92‐kDa Pro‐MMP‐93.5 ± 0.33.7 ± 0.2 82‐kDa Active MMP‐9NDND 72‐kDa Pro‐MMP‐217 ± 1.415 ± 0.9 62‐kDa Active MMP‐2NDND 68‐kDa Pro‐MMP‐227 ± 2.127 ± 1.9 58‐kDa Active MMP‐210 ± 1.43.5 ± 0.8*GON adipose tissue 92‐kDa Pro‐MMP‐9NDND 82‐kDa Active MMP‐9NDND 72‐kDa Pro‐MMP‐215 ± 2.26 ± 0.7* 62‐kDa Active MMP‐2NDND 68‐kDa Pro‐MMP‐229 ± 1.315 ± 1.0* 58‐kDa Active MMP‐212 ± 1.80.9 ± 0.4*SC, subcutaneous; GON, gonadal; ND, not detected. Data are mean ± SEM and are expressed in arbitrary units.*P < 0.0005 vs. placebo‐treated mice. Open table in a new tab SC, subcutaneous; GON, gonadal; ND, not detected. Data are mean ± SEM and are expressed in arbitrary units. *P < 0.0005 vs. placebo‐treated mice. In extracts from gonadal fat tissue, a significant decrease in 68‐kDa and 72‐kDa pro‐MMP‐2 levels, as well as in 58‐kDa active MMP‐2 levels, was observed. The 58‐kDa active MMP‐2 levels corresponded to 6 ± 3% of the total MMP‐2 species for inhib" @default.
• W1994920666 created "2016-06-24" @default.
• W1994920666 creator A5015282498 @default.
• W1994920666 creator A5042192451 @default.
• W1994920666 date "2008-07-01" @default.
• W1994920666 modified "2023-10-14" @default.
• W1994920666 title "A functional role of gelatinase A in the development of nutritionally induced obesity in mice" @default.
• W1994920666 cites W1574172480 @default.
• W1994920666 cites W1631449371 @default.
• W1994920666 cites W175031653 @default.
• W1994920666 cites W1828551992 @default.
• W1994920666 cites W1895025635 @default.
• W1994920666 cites W1977897098 @default.
• W1994920666 cites W1979745959 @default.
• W1994920666 cites W1990757970 @default.
• W1994920666 cites W1997661967 @default.
• W1994920666 cites W1999239339 @default.
• W1994920666 cites W2005707246 @default.
• W1994920666 cites W2021765303 @default.
• W1994920666 cites W2043082899 @default.
• W1994920666 cites W2059659414 @default.
• W1994920666 cites W2075221395 @default.
• W1994920666 cites W2091759162 @default.
• W1994920666 cites W2101630029 @default.
• W1994920666 cites W2116590039 @default.
• W1994920666 cites W2123211548 @default.
• W1994920666 cites W2126975440 @default.
• W1994920666 cites W2136858036 @default.
• W1994920666 cites W2141692232 @default.
• W1994920666 cites W2154401382 @default.
• W1994920666 cites W2160969448 @default.
• W1994920666 cites W2169095915 @default.
• W1994920666 cites W2171153460 @default.
• W1994920666 cites W2214504257 @default.
• W1994920666 cites W2227278468 @default.
• W1994920666 cites W2277094856 @default.
• W1994920666 cites W2341473203 @default.
• W1994920666 cites W2343896887 @default.
• W1994920666 cites W4323282404 @default.
• W1994920666 cites W44458377 @default.
• W1994920666 doi "https://doi.org/10.1111/j.1538-7836.2008.02988.x" @default.
• W1994920666 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18433461" @default.
• W1994920666 hasPublicationYear "2008" @default.
• W1994920666 type Work @default.
• W1994920666 sameAs 1994920666 @default.
• W1994920666 citedByCount "79" @default.
• W1994920666 countsByYear W19949206662012 @default.
• W1994920666 countsByYear W19949206662013 @default.
• W1994920666 countsByYear W19949206662014 @default.
• W1994920666 countsByYear W19949206662015 @default.
• W1994920666 countsByYear W19949206662016 @default.
• W1994920666 countsByYear W19949206662017 @default.
• W1994920666 countsByYear W19949206662018 @default.
• W1994920666 countsByYear W19949206662019 @default.
• W1994920666 countsByYear W19949206662020 @default.
• W1994920666 countsByYear W19949206662022 @default.
• W1994920666 countsByYear W19949206662023 @default.
• W1994920666 crossrefType "journal-article" @default.
• W1994920666 hasAuthorship W1994920666A5015282498 @default.
• W1994920666 hasAuthorship W1994920666A5042192451 @default.
• W1994920666 hasBestOaLocation W19949206661 @default.
• W1994920666 hasConcept C109523444 @default.
• W1994920666 hasConcept C126322002 @default.
• W1994920666 hasConcept C134018914 @default.
• W1994920666 hasConcept C2776232661 @default.
• W1994920666 hasConcept C511355011 @default.
• W1994920666 hasConcept C71924100 @default.
• W1994920666 hasConceptScore W1994920666C109523444 @default.
• W1994920666 hasConceptScore W1994920666C126322002 @default.
• W1994920666 hasConceptScore W1994920666C134018914 @default.
• W1994920666 hasConceptScore W1994920666C2776232661 @default.
• W1994920666 hasConceptScore W1994920666C511355011 @default.
• W1994920666 hasConceptScore W1994920666C71924100 @default.
• W1994920666 hasIssue "7" @default.
• W1994920666 hasLocation W19949206661 @default.
• W1994920666 hasLocation W19949206662 @default.
• W1994920666 hasLocation W19949206663 @default.
• W1994920666 hasOpenAccess W1994920666 @default.
• W1994920666 hasPrimaryLocation W19949206661 @default.
• W1994920666 hasRelatedWork W1966504330 @default.
• W1994920666 hasRelatedWork W1966775726 @default.
• W1994920666 hasRelatedWork W1979139803 @default.
• W1994920666 hasRelatedWork W1991560548 @default.
• W1994920666 hasRelatedWork W2030889776 @default.
• W1994920666 hasRelatedWork W2037631372 @default.
• W1994920666 hasRelatedWork W2040058909 @default.
• W1994920666 hasRelatedWork W2132898409 @default.
• W1994920666 hasRelatedWork W2748952813 @default.
• W1994920666 hasRelatedWork W4249176446 @default.
• W1994920666 hasVolume "6" @default.
• W1994920666 isParatext "false" @default.
• W1994920666 isRetracted "false" @default.
• W1994920666 magId "1994920666" @default.
• W1994920666 workType "article" @default.