FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1995522818> ?p ?o ?g. }

• W1995522818 endingPage "3056" @default.
• W1995522818 startingPage "3051" @default.
• W1995522818 abstract "Strictosidine β-d-glucosidase (SGD) is an enzyme involved in the biosynthesis of terpenoid indole alkaloids (TIAs) by converting strictosidine to cathenamine. The biosynthetic pathway toward strictosidine is thought to be similar in all TIA-producing plants. Somewhere downstream of strictosidine formation, however, the biosynthesis diverges to give rise to the different TIAs found. SGD may play a role in creating this biosynthetic diversity. We have studied SGD at both the molecular and enzymatic levels. Based on the homology between different plant β-glucosidases, degenerate polymerase chain reaction primers were designed and used to isolate a cDNA clone from a Catharanthus roseuscDNA library. A full-length clone gave rise to SGD activity when expressed in Saccharomyces cerevisiae. SGD shows ∼60% homology at the amino acid level to other β-glucosidases from plants and is encoded by a single-copy gene. Sgd expression is induced by methyl jasmonate with kinetics similar to those of two other genes acting prior to Sgd in TIA biosynthesis. These results show that coordinate induction of the biosynthetic genes forms at least part of the mechanism for the methyl jasmonate-induced increase in TIA production. Using a novel in vivo staining method, subcellular localization studies of SGD were performed. This showed that SGD is most likely associated with the endoplasmic reticulum, which is in accordance with the presence of a putative signal sequence, but in contrast to previous localization studies. This new insight in SGD localization has significant implications for our understanding of the complex intracellular trafficking of metabolic intermediates during TIA biosynthesis. Strictosidine β-d-glucosidase (SGD) is an enzyme involved in the biosynthesis of terpenoid indole alkaloids (TIAs) by converting strictosidine to cathenamine. The biosynthetic pathway toward strictosidine is thought to be similar in all TIA-producing plants. Somewhere downstream of strictosidine formation, however, the biosynthesis diverges to give rise to the different TIAs found. SGD may play a role in creating this biosynthetic diversity. We have studied SGD at both the molecular and enzymatic levels. Based on the homology between different plant β-glucosidases, degenerate polymerase chain reaction primers were designed and used to isolate a cDNA clone from a Catharanthus roseuscDNA library. A full-length clone gave rise to SGD activity when expressed in Saccharomyces cerevisiae. SGD shows ∼60% homology at the amino acid level to other β-glucosidases from plants and is encoded by a single-copy gene. Sgd expression is induced by methyl jasmonate with kinetics similar to those of two other genes acting prior to Sgd in TIA biosynthesis. These results show that coordinate induction of the biosynthetic genes forms at least part of the mechanism for the methyl jasmonate-induced increase in TIA production. Using a novel in vivo staining method, subcellular localization studies of SGD were performed. This showed that SGD is most likely associated with the endoplasmic reticulum, which is in accordance with the presence of a putative signal sequence, but in contrast to previous localization studies. This new insight in SGD localization has significant implications for our understanding of the complex intracellular trafficking of metabolic intermediates during TIA biosynthesis. terpenoid indole alkaloids methyl jasmonate strictosidine β-d-glucosidase endoplasmic reticulum anion-exchange chromatography 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol high-performance liquid chromatography polymerase chain reaction base pair(s) Terpenoid indole alkaloids (TIAs)1 form the largest group of alkaloids with >3000 representatives. About 15 of these are of pharmaceutical interest. Catharanthus roseus (L.) G. Don (Apocynaceae) is the commercial source of three such alkaloids, which have pharmaceutical applications. Ajmalicine is used to improve cerebral circulation, and the dimeric alkaloids vinblastine and vincristine are important antitumor drugs. The biosynthesis of these alkaloids has been studied quite extensively (for a review, see Ref.1.Verpoorte R. van der Heijden R. Memelink J. Alkaloids. 1998; 50: 453-508Google Scholar), among others, with the aim of applying this knowledge to improve the production in plants or plant cell cultures. Some of the early steps leading to strictosidine, the key intermediate to all TIAs and quinoline alkaloids, have been studied in detail. Strictosidine is formed by the coupling of secologanin to tryptamine in a reaction catalyzed by the enzyme strictosidine synthase (EC 4.3.3.2). This enzyme is located in the vacuole (2.McKnight T.D. Bergey D.R. Burnett R.J. Nessler C.L. Planta (Heidelb.). 1991; 185: 148-152Crossref PubMed Scopus (91) Google Scholar). Tryptamine is formed from the amino acid tryptophan by the action of the cytosolic enzyme tryptophan decarboxylase (EC 4.1.1.28), and secologanin is a glucoiridoid formed from geraniol. The expression of the Strand Tdc genes is induced by the plant stress signaling hormone MeJA (3.Menke F.L.H. Parchmann S. Mueller M.J. Kijne J.W. Memelink J. Plant Physiol. (Bethesda). 1999; 119: 1289-1296Crossref PubMed Scopus (212) Google Scholar). Furthermore, MeJA increases alkaloid production in cell suspension cultures (4.Gantet P. Imbault N. Thiersault M. Doireau P. Plant Cell Physiol. 1998; 39: 220-225Crossref Scopus (96) Google Scholar) and seedlings (5.Aerts R.J. Gisi D. De Carolis E. De Luca V. Baumann T.W. Plant J. 1994; 5: 635-643Crossref Scopus (189) Google Scholar) of C. roseus, showing that TIA-producing plants respond to stress by increasing their alkaloid content, among others, through increased gene expression. It is unknown how strictosidine is channeled into various pathways that lead to the different types of TIA skeletons. The first step after strictosidine formation is removal of the glucose moiety, a reaction that is catalyzed by the enzyme strictosidine β-d-glucosidase (SGD; EC 3.2.1.105). Removal of glucose results in a highly reactive dialdehyde. Depending on the conditions (e.g. solvent, pH), various products can be formed from this dialdehyde. Under mildly acidic incubation conditions, the major product of SGD from C. roseus is cathenamine (6.Stevens L.H. Formation and Conversion of Strictosidine in the Biosynthesis of Monoterpenoid Indole and Quinoline Alkaloids..in: Ph.D. Thesis. Leiden University, Leiden, The Netherlands1994Google Scholar). Better understanding of this step may lead to the development of strategies to channel the flux toward the desired type of alkaloid. Apart from its role in the biosynthesis of TIAs, which have putative functions in plant defense, SGD may also have a more direct role in defense. In young tissue of C. roseus, where strictosidine is the major TIA, SGD in combination with strictosidine is thought to be part of a damage-inducible biochemical defense system. Strictosidine is stored in the vacuole, whereas SGD is thought to be outside the vacuole (7.Luijendijk T.J.C. Stevens L.H. Verpoorte R. Plant Physiol. Biochem. 1998; 36: 419-425Crossref Scopus (47) Google Scholar, 29.Jackson M.R. Nilsson T. Peterson P.A. EMBO J. 1990; 9: 3153-3162Crossref PubMed Scopus (720) Google Scholar). Upon cell damage, SGD will rapidly convert strictosidine into the aglucon, which was shown to have antimicrobial activity (8.Luijendijk T.J.C. van der Meijden E. Verpoorte R. J. Chem. Ecol. 1996; 22: 1355-1366Crossref PubMed Scopus (60) Google Scholar). This proposed defense mechanism shows similarity to cyanogenesis occurring as a result of the damage-induced interaction between cyanogenic glucosides and their specific glucosidases (9.Jones D.A. Phytochemistry (Oxf.). 1998; 47: 155-162Crossref PubMed Scopus (291) Google Scholar). In this paper, we present the cloning of the SGD cDNA and the functional expression of the encoded protein in yeast. We show thatSgd expression is induced by MeJA with kinetics similar to those of two other genes acting earlier in TIA biosynthesis. Finally, via an in vivo activity staining method, we present evidence that SGD is localized in the endoplasmic reticulum (ER). A C. roseus cell suspension culture (cell line A12A2) was harvested 7 days after subculturing and used to purify SGD. This cell culture was grown in MS basal salt medium (10.Murashige T. Skoog F. Physiol. Plant. 1962; 15: 473-497Crossref Scopus (52758) Google Scholar) containing 100 mg/liter meso-inositol, 0.4 mg/liter thiamin, 2 mg/liter 1-naphthalene acetic acid, 0.2 mg/liter kinetin, and 30 g/liter sucrose. Purification of SGD was based on the purification scheme previously described (7.Luijendijk T.J.C. Stevens L.H. Verpoorte R. Plant Physiol. Biochem. 1998; 36: 419-425Crossref Scopus (47) Google Scholar). After protein extraction, a concentration step was performed on a Filtron concentrator containing a 30-kDa filter, followed by size-exclusion column chromatography (Sephacryl S-300). Instead of anion-exchange chromatography (AEC), a batch procedure with AEC material (Q-Sepharose) was used. The protein solution, in 50 mm BisTris (pH 6.3; Sigma), was incubated with the AEC material for 1 h at 4 °C. The AEC material was then washed with 0.1 m NaCl in 50 mm BisTris (pH 6.3) on a glass filter. The bound protein was eluted from the AEC material with 0.4 m NaCl in the same buffer. This fraction contained all the SGD activity and was used for the subsequent purification steps. After ultracentrifugation (2 h at 100,000 ×g), the pellet was resuspended in 4 ml of 50 mmBisTris (pH 6.3) and further purified by fast protein liquid chromatography using a Mono-Q HR 5/5 column (Amersham Pharmacia Biotech) with an increasing NaCl concentration (from 0 to 1m NaCl in 50 mm BisTris (pH 6.3)). The fractions containing SGD activity were pooled. Protein concentrations were determined by the method of Bradford (11.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar). Polyacrylamide gel electrophoresis was carried out using precast gels (12.5% SDS and 4–15% native polyacrylamide) on a PhastSystem (Amersham Pharmacia Biotech). Total visualization of proteins was carried out by silver staining (12.Davis L.G. Dibner M.D. Battey J.F. Davis L.G. Basic Methods in Molecular Biology. Elsevier Science Publishing Co., Inc., New York1986: 315-317Crossref Google Scholar). SGD was visualized on a native gel by incubation in 2 mm strictosidine solution in 0.1 m sodium phosphate buffer (pH 6.3) (13.Luijendijk T.J.C. Stevens L.H. Verpoorte R. Phytochem. Anal. 1996; 7: 16-19Crossref Scopus (11) Google Scholar). Glycosylation of SGD was determined with purified enzyme using the GlycotrackTM carbohydrate detection kit from Oxford Glycosystems. Strictosidine was prepared enzymatically using immobilized strictosidine synthase (14.Pfitzner U. Zenk M.H. Planta Med. 1982; 46: 10-14Crossref PubMed Scopus (58) Google Scholar). Quantitative SGD activity measurements were performed by HPLC (15.Stevens L.H. Schripsema J. Pennings E.J.M. Verpoorte R. Plant Physiol. Biochem. 1992; 30: 675-681Google Scholar). Qualitative SGD activity was determined by spotting 1 μl of protein solution on nitrocellulose. The protein bound to the nitrocellulose was then incubated at room temperature in 0.1 m sodium phosphate buffer (pH 6.3) containing 2 mm strictosidine until a yellow spot became visible. This staining procedure is based on the visualization method previously described (13.Luijendijk T.J.C. Stevens L.H. Verpoorte R. Phytochem. Anal. 1996; 7: 16-19Crossref Scopus (11) Google Scholar). Nonspecific β-glucosidase activity was measured by incubating the protein samples at 30 °C with the substrate p-nitrophenyl-β-d-glucopyranoside (2 mm in sodium phosphate buffer (pH 6.3)). After stopping the incubation with 1 m Na2CO3 (1:1), the absorption was measured at 400 nm. The activity was calculated using a molar absorptivity of 10,300 liter·mole−1·cm−1 after correction for a blank assay. Escherichia coli strain XL1-Blue (Stratagene) was used as a plasmid host. Saccharomyces cerevisiae strain YPH500 (16.Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) was used for expression ofSgd. The cDNA coding for SGD was inserted in theBamHI and KpnI sites of the shuttle vector pYPGE15 (17.Brunelli J.P. Pall M.L. Yeast. 1993; 9: 1309-1318Crossref PubMed Scopus (92) Google Scholar). This recombinant plasmid containing the geneURA3 was transformed into yeast and selected on minimal synthetic dextrose medium without amino acids (nitrogen base, Difco) supplemented with 20 mg/liter Ade, 20 mg/liter His, 30 mg/liter Leu, 30 mg/liter Lys, and 20 mg/liter Trp. A control yeast culture contained the vector pYPGE15 without an insert. Total RNA was isolated from two C. roseus cell suspension cultures elicited at 1 and 4 h with 0.05% yeast extract (Difco). The total RNA extracted from both cultures was mixed in a 1:1 ratio. Poly(A)+ RNA was isolated using a Promega kit. The cDNA was synthesized and inserted in λ-ZAP using the ZAP-cDNATM kit from Stratagene. Based on highly conserved regions (VT(L/I)FHWD and KG(Y/F)(Y/F)AWS) of plant β-glucosidases (18.Hughes M.A. Am. Chem. Soc. Symp. Ser. 1992; 533: 151-169Google Scholar), two degenerate PCR primers were designed (GTNACNHTITTYCAYTGGGA and GACCANGCRWARWAICCYTT). One-hundred ng of λ-ZAP DNA containingC. roseus cDNA was used as a template. PCR cycles were carried out for 5 min at 94 °C, followed by 40 cycles of 1 min at 94 °C, 1 min at 35 °C, and 2 min at 72 °C in a Hybaid thermal reactor. PCRs were carried out with Taq DNA polymerase from Amersham Pharmacia Biotech. The PCR with primers T3 (AATTAACCCTCACTAAAGGG) and SgsecI (TTCGATCACTCAAGAAGCC) was done under the same conditions as described above, but with an annealing temperature of 50 °C instead of 35 °C. Approximately 500,000 cDNA-containing phages were screened on nylon filters (Hybond-N, Amersham Pharmacia Biotech) using a 32P-radiolabeled probe based on a PCR product obtained with degenerate primers. A total of seven positive phages were isolated and converted to plasmids. Sequence analysis showed that all seven clones were identical, except for their length, and the longest clone was selected for further studies. Since this clone was not full-length, a second PCR was performed using primers T3 and SgsecI. This PCR product was digested with the restriction enzyme SacII and inserted in pBluescript II SK+. This 313-bp insert was found to be identical to the 5′-end of the previously isolated cDNA clone, except for an additional 72-bp part at the 5′-end containing a start codon. Using the restriction enzyme SacII, the 5′-part was inserted in front of the cDNA clone, making it full-length. The predicted amino acid sequence of SGD was analyzed using several computer programs available on the Internet. Homology to other amino acid sequences from the NCBI Protein Database was checked with the BLAST program (19.Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (68368) Google Scholar). The PSORT program (20.Nakai K. Kanehisa M. Genomics. 1992; 14: 897-911Crossref PubMed Scopus (1364) Google Scholar) was used to analyze the amino acid sequence for putative protein localization signals. Secondary structure prediction of the amino acid sequence was analyzed by the SAPS program (21.Brandel V. Bucher P. Nourbakhsh I. Blaisdell B.E. Karlin S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2002-2006Crossref PubMed Scopus (340) Google Scholar). DNA sequencing was done using the T7 DNA sequencing kit from Amersham Pharmacia Biotech using primers T3 and T7. The complete cDNA coding for SGD was sequenced on both strands by making subclones in pBluescript II SK+ with different restriction enzymes. DNA isolated fromC. roseus was digested overnight with the restriction enzymes BglI, EcoRI, and EcoRV. Root, stem, flower, and leaf tissues from three mature C. roseusplants were pooled, and RNA was isolated. Three-day-old C. roseus cell suspensions (MP183L) were treated for different lengths of time with 50 μm MeJA (Bedoukian Research, Danbury, CT) diluted in Me2SO. Total RNA was isolated from tissue ground in liquid nitrogen by phenol/chloroform extraction and precipitation with LiCl at a final concentration of 2 m. The Rps9 probe has been described previously (3.Menke F.L.H. Parchmann S. Mueller M.J. Kijne J.W. Memelink J. Plant Physiol. (Bethesda). 1999; 119: 1289-1296Crossref PubMed Scopus (212) Google Scholar). Southern and Northern blot analyses were performed as described (22.Memelink J. Swords K.M.M. Staehelin L.A. Hoge J.H.C. Gelvin S.B. Schilperoort R.A. Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands1994: F1-F23Crossref Google Scholar) at high stringency with the following modifications. Northern blots contain 10 μg of total RNA/lane, and Southern blots 10 μg of digested DNA/lane. Prehybridization was done for 4 h in 1 mNaCl, 10% dextran sulfate (sodium salt, Sigma), 1% SDS, and 50 μg/ml denatured salmon sperm DNA at 65 °C. After overnight hybridization, blots were washed three times at 65 °C using 0.5× SSPE (saline/sodium phosphate/EDTA) and 0.5% SDS. Finally, the blots were washed once with 0.1× SSPE and exposed at −80 °C to Fuji RX films mounted on Kyokko intensifying screens or to phosphor screens. Expression levels were quantitated using ImageQuant software. For subcellular localization studies of SGD, the C. roseus cell line A11 was used (23.Contin A. van der Heijden R. Lefeber A.W.M. Verpoorte R. FEBS Lett. 1998; 434: 413-416Crossref PubMed Scopus (151) Google Scholar). Cells were grown in medium containing 0.1 g/liter B5 salts, 0.1 g/litermeso-inositol, 10 mg/liter thiamin, 1 mg/liter pyridoxine, 1 mg/liter niacin, 1.86 mg/liter NAA, and 20 g/liter sucrose at 25 °C and 2800 lux on a gyratory shaker (120 rpm). Protoplasts and vacuoles were prepared as described (24.Renaudin J.P. Brown H. Barbier-Brygoo H. Guern J. Physiol. Plant. 1986; 68: 695-703Crossref Scopus (30) Google Scholar). The marker enzymes alcohol dehydrogenase (cytosol), cytochrome-c oxidase (mitochondria), NADPH-dependent cytochrome-creductase (ER), and catalase (peroxisomes) were measured as described previously (24.Renaudin J.P. Brown H. Barbier-Brygoo H. Guern J. Physiol. Plant. 1986; 68: 695-703Crossref Scopus (30) Google Scholar). The marker enzyme for the vacuole (α-mannosidase) was determined as reported (25.Boller T. Kende H. Plant Physiol. (Bethesda). 1979; 63: 1123-1132Crossref PubMed Google Scholar). Relative activity was calculated using the ratios between the activities of α-mannosidase (Man) and any other enzyme activity (X) in the vacuolar (vac) and protoplast (prot) preparations (relative activity of X= ((Man, prot × X, vac)/(Man, vac ×X, prot)) × 100%). Peroxisomes were isolated using a sucrose gradient (26.Holtman W.L. Heistek J.C. Mattern K.A. Bakhuizen R. Douma A. Plant Sci. (Shannon). 1994; 99: 43-53Crossref Scopus (39) Google Scholar). Data presented are mean values of three independent experiments. In vivo SGD activity staining was performed using cells and protoplasts of C. roseus and cells of Tabernaemontana divaricata, Cinchona officinalis, and Nicotiana tabacum. Cells, mounted on a microscope slide, were incubated with 2 mm strictosidine (with or without 100 mmd-gluconic acid δ-lactone) and visualized under a Nikon Diaphot-TMD-EF inverted using white light and blue light excitation. This was achieved with a B2 filter system, consisting of a DM 510 dichroic mirror block, a 450–490-nm excitation filter, and a barrier filter of 520 nm. For electron microscopy, the sample was prepared by incubating cells ofC. roseus with strictosidine (2 mm final concentration) for 20 min, followed by fixation in 2% glutaraldehyde and 2% formaldehyde in 0.1 m sodium cacodylate buffer (pH 7.4). After fixation, the cells were embedded by spinning in 2% low melting point agar. Sections of 70 nm were prepared with a Reichert Ultracut microtome and stained with lead and uranyl. The sections were examined with a JEOL 1010 transmission electron microscope, and pictures were taken on a Fine Grain Positive film (Eastman Kodak Co.). A total of 192 μg of SGD was purified from 850 g of C. roseuscultured cells, following in part a previously reported method (7.Luijendijk T.J.C. Stevens L.H. Verpoorte R. Plant Physiol. Biochem. 1998; 36: 419-425Crossref Scopus (47) Google Scholar). Using SGD activity staining on nitrocellulose, the SGD-containing fractions obtained after the chromatography steps were identified within 15 min, allowing purification within 1 day. Native polyacrylamide gel electrophoresis in combination with SGD activity staining of crude protein extract showed that most of the activity was present in the stacking gel (Fig.1 C), suggesting that SGD is membrane-associated. After protein purification on native polyacrylamide gel, three different protein bands (∼250, 500, and 630 kDa) were observed (Fig. 1 B), all three of which contained SGD activity. Under denaturing conditions, only one protein band of 63 kDa was observed (Fig. 1 A), indicating that the purified SGD preparation consisted of aggregates of 4, 8, or 12 monomers. These different SGD aggregate isoforms were formed only during the last purification step (fast protein liquid chromatography on a Mono-Q column). Probably the high salt strength on this column partly disrupted SGD from the membranes, resulting in smaller SGD isoforms. Like many other β-glucosidases, SGD was found to be glycosylated (data not shown). Whether glycosylation is important for activity is unknown. Using the purified protein, antibodies were raised against SGD. Although these antibodies were able to immunoprecipitate SGD, they were not very specific (data not shown). Attempts to obtain internal amino acid sequences of SGD were not successful due to poor cleavage of the protein by chemical reagents or proteinases. For cDNA cloning ofSgd, another strategy was followed. Alignment of several amino acid sequences of plant β-glucosidases (18.Hughes M.A. Am. Chem. Soc. Symp. Ser. 1992; 533: 151-169Google Scholar) identified two highly conserved regions (VT(L/I)FHWD and KG(Y/F)(Y/F)AWS). Degenerate PCR primers based on these conserved regions gave a PCR product of the expected size of 1 kilobase. With this PCR product as a probe, aC. roseus cDNA library was screened. This procedure led to a complete cDNA clone of 1875 bp encoding a protein with high homology to β-glucosidases (Fig. 2). Since an in-frame stop codon is present upstream of the start codon, this cDNA clone is full-length, which was confirmed by the estimated mRNA size of ∼1900 bp. To determine whether the clone encoded SGD, the cDNA clone was expressed in S. cerevisiae. This yeast culture was found to have a high SGD activity (2.52 ± 0.05 millikatals/g fresh weight), whereas a control culture did not have any SGD activity. Therefore, this cDNA encodes SGD since, in C. roseus, no other glucosidases have been found that can accept strictosidine as a substrate (6.Stevens L.H. Formation and Conversion of Strictosidine in the Biosynthesis of Monoterpenoid Indole and Quinoline Alkaloids..in: Ph.D. Thesis. Leiden University, Leiden, The Netherlands1994Google Scholar, 27.Hemscheidt T. Zenk M.H. FEBS Lett. 1980; 110: 187-191Crossref PubMed Scopus (63) Google Scholar). The introduction and expression of Sgd did not affect the nonspecific glucosidase activity of the yeast strain. This is explained by the fact that SGD does not acceptp-nitrophenyl-β-d-glucopyranoside, a nonspecific substrate for certain β-glucosidases (27.Hemscheidt T. Zenk M.H. FEBS Lett. 1980; 110: 187-191Crossref PubMed Scopus (63) Google Scholar). SGD expressed in yeast behaved in a way similar to that of the native plant enzyme. The product of strictosidine hydrolysis catalyzed by SGD expressed in yeast was cathenamine as determined by HPLC with diode array detection. As in C. roseus, SGD formed large complexes in S. cerevisiae, as visualized on activity-stained native polyacrylamide gel. On this native polyacrylamide gel of crude protein extract, part of the activity was found to be present in the stacking gel, and part was found to be present in a high molecular mass complex (Fig. 1 D). Based on the deduced amino acid sequence of SGD, the highest homology was found with plant β-glucosidases (60% with prunasin hydrolase and amygdalin hydrolase from Prunus serotina and cyanogenic β-glucosidase from Trifolium repens). SGD has a predicted molecular mass of 63.0 kDa. This theoretical mass corresponds well to the estimated mass of SGD as found after protein purification, indicating that the degree of glycosylation must be low. Furthermore, computer analysis predicted a possible subcellular localization in the ER. Southern blotting was performed to estimate the gene copy number ofSgd (Fig. 3). The presence of one (BglI), two (EcoRI), and three (EcoRV) bands visible on this blot can be explained since the Sgd coding sequence contains zero, one, and two recognition sites for BglI, EcoRI, andEcoRV, respectively. EcoRV digestion yielded a band of ∼1200 bp, which is similar to what would be expected based on the nucleotide sequence of Sgd. These results demonstrate that SGD is most likely encoded by a single-copy gene. The Sgd gene expression in different parts of the plant is shown in Fig. 4. The highestSgd expression was found in the leaf, followed by the root (76% compared with the leaf), the stem (34%), and the flower (3%). The mRNA expression is in accordance with the SGD enzyme activity measured in the same samples from the different tissues (leaf, 360 ± 24 picokatals/mg of protein; root, 221 ± 30 picokatals/mg; stem, 164 ± 22 picokatals/mg; and flower, 62 ± 8 picokatals/mg). The plant stress signaling hormone MeJA coordinately induces the expression of the Tdc and Str genes (3.Menke F.L.H. Parchmann S. Mueller M.J. Kijne J.W. Memelink J. Plant Physiol. (Bethesda). 1999; 119: 1289-1296Crossref PubMed Scopus (212) Google Scholar) and leads to increased TIA production in cell suspension culture (4.Gantet P. Imbault N. Thiersault M. Doireau P. Plant Cell Physiol. 1998; 39: 220-225Crossref Scopus (96) Google Scholar) and seedlings (5.Aerts R.J. Gisi D. De Carolis E. De Luca V. Baumann T.W. Plant J. 1994; 5: 635-643Crossref Scopus (189) Google Scholar). Consequently, we studied the jasmonate responsiveness ofSgd to see if this step of the alkaloid biosynthetic pathway is similarly regulated. The effect of the addition of 50 μm MeJA on the expression of Sgd is shown in Fig.5. MeJA transiently inducedSgd expression with maximum expression levels at 2–8 h and decreased mRNA level at 24 h. The kinetics of mRNA accumulation for Sgd were similar to those of Tdc andStr in the same RNA samples. The level of Rps9mRNA, encoding the 40 S ribosomal protein S9, was not affected by the addition of MeJA, indicating that gene expression in general was not affected. Thus, the results presented here demonstrate thatSgd expression is induced by MeJA with kinetics similar to those of two other genes acting prior to Sgd in TIA biosynthesis. Strictosidine synthase is a vacuolar protein (2.McKnight T.D. Bergey D.R. Burnett R.J. Nessler C.L. Planta (Heidelb.). 1991; 185: 148-152Crossref PubMed Scopus (91) Google Scholar), indicating that strictosidine is synthesized inside the vacuole. It has been suggested that SGD is localized outside the vacuole, loosely bound to the tonoplast (28.Stevens L.H. Blom T.J.M. Verpoorte R. Plant Cell Rep. 1993; 12: 573-576Crossref PubMed Scopus (78) Google Scholar). The predicted amino acid sequence of SGD shows a C-terminal KKXKX sequence. Jackson et al. (29.Jackson M.R. Nilsson T. Peterson P.A. EMBO J. 1990; 9: 3153-3162Crossref PubMed Scopus (720) Google Scholar) showed that lysine residues at the C terminus may act as a retention signal for type I transmembrane ER proteins. Moreover, two internal sequences (SKL and SRL) were found in the amino acid sequence of SGD that may direct proteins to the peroxisomes. Although these sequences normally are present at the C terminus, they can also be found as internal sequences (30.Olsen J.L. Harada J.J. Ann. Rev. Plant Physiol. Plant Mol. Biol. 1995; 46: 123-146Crossref Scopus (69) Google Scholar). To experimentally test the functional significance of the predicted signal sequences, subcellular localization studies were performed with a C. roseus cell line. First, vacuoles were isolated to test the hypothesis that SGD is bound to the tonoplast. Table I shows the relative activities of different marker proteins and SGD found in the vacuolar preparation. α-Mannosidase was used as a vacuolar marker. Some SGD activity was found in the vacuolar preparations, although it was only 12% of the SGD activity present in the protoplasts. No contamination with cytosolic, mitochondrial, or ER marker enzymes could be found in the vacuoles. However, catalase (peroxisomal marker) was found in the vacuolar preparations. The presence of SGD in the vacuolar preparations might be due to contamination by other organelles and in particular by peroxisomes. Peroxisomes were therefore isolated using a sucrose gradient that resulted in two protein peaks at 53% (fraction I) and 47% (fraction II) sucrose. The activities of the marker enzymes for peroxisomes, mitochondria, and ER and the SGD activities of these two protein peaks are given in Table II. Other protein peaks at lower sucrose densities did not contain any concentrated marker enzyme activities. Fractions I and II had protein characteristics of peroxisomes, mitochondria, and the ER. Based on the ratios of the occurrence in these fractions, it is obvious that the peroxisomes are more concentrated in fraction I. As SGD is more abundant in fraction II, it is conclu" @default.
• W1995522818 created "2016-06-24" @default.
• W1995522818 creator A5003066069 @default.
• W1995522818 creator A5029943656 @default.
• W1995522818 creator A5032001335 @default.
• W1995522818 creator A5041767960 @default.
• W1995522818 creator A5071347626 @default.
• W1995522818 date "2000-02-01" @default.
• W1995522818 modified "2023-10-10" @default.
• W1995522818 title "Molecular Cloning and Analysis of Strictosidine β-d-Glucosidase, an Enzyme in Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus" @default.
• W1995522818 cites W1964021154 @default.
• W1995522818 cites W1975492718 @default.
• W1995522818 cites W1977120796 @default.
• W1995522818 cites W1994704939 @default.
• W1995522818 cites W2000041893 @default.
• W1995522818 cites W2008399824 @default.
• W1995522818 cites W2012182835 @default.
• W1995522818 cites W2015477824 @default.
• W1995522818 cites W2024556021 @default.
• W1995522818 cites W2031094779 @default.
• W1995522818 cites W2038437217 @default.
• W1995522818 cites W2038853975 @default.
• W1995522818 cites W2042366988 @default.
• W1995522818 cites W2053658458 @default.
• W1995522818 cites W2055043387 @default.
• W1995522818 cites W2058584183 @default.
• W1995522818 cites W2075774117 @default.
• W1995522818 cites W2089693063 @default.
• W1995522818 cites W2105945817 @default.
• W1995522818 cites W2106238858 @default.
• W1995522818 cites W2108253576 @default.
• W1995522818 cites W2111924003 @default.
• W1995522818 cites W2128813939 @default.
• W1995522818 cites W2141684349 @default.
• W1995522818 cites W2154062107 @default.
• W1995522818 cites W2169333620 @default.
• W1995522818 cites W2396581225 @default.
• W1995522818 cites W4293247451 @default.
• W1995522818 cites W86630917 @default.
• W1995522818 doi "https://doi.org/10.1074/jbc.275.5.3051" @default.
• W1995522818 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10652285" @default.
• W1995522818 hasPublicationYear "2000" @default.
• W1995522818 type Work @default.
• W1995522818 sameAs 1995522818 @default.
• W1995522818 citedByCount "167" @default.
• W1995522818 countsByYear W19955228182012 @default.
• W1995522818 countsByYear W19955228182013 @default.
• W1995522818 countsByYear W19955228182014 @default.
• W1995522818 countsByYear W19955228182015 @default.
• W1995522818 countsByYear W19955228182016 @default.
• W1995522818 countsByYear W19955228182017 @default.
• W1995522818 countsByYear W19955228182018 @default.
• W1995522818 countsByYear W19955228182019 @default.
• W1995522818 countsByYear W19955228182020 @default.
• W1995522818 countsByYear W19955228182021 @default.
• W1995522818 countsByYear W19955228182022 @default.
• W1995522818 countsByYear W19955228182023 @default.
• W1995522818 crossrefType "journal-article" @default.
• W1995522818 hasAuthorship W1995522818A5003066069 @default.
• W1995522818 hasAuthorship W1995522818A5029943656 @default.
• W1995522818 hasAuthorship W1995522818A5032001335 @default.
• W1995522818 hasAuthorship W1995522818A5041767960 @default.
• W1995522818 hasAuthorship W1995522818A5071347626 @default.
• W1995522818 hasBestOaLocation W19955228181 @default.
• W1995522818 hasConcept C121050878 @default.
• W1995522818 hasConcept C181199279 @default.
• W1995522818 hasConcept C185592680 @default.
• W1995522818 hasConcept C192527728 @default.
• W1995522818 hasConcept C199360897 @default.
• W1995522818 hasConcept C206103511 @default.
• W1995522818 hasConcept C2776734949 @default.
• W1995522818 hasConcept C2777667214 @default.
• W1995522818 hasConcept C2779906556 @default.
• W1995522818 hasConcept C2780007248 @default.
• W1995522818 hasConcept C41008148 @default.
• W1995522818 hasConcept C553450214 @default.
• W1995522818 hasConcept C55493867 @default.
• W1995522818 hasConcept C59822182 @default.
• W1995522818 hasConcept C86803240 @default.
• W1995522818 hasConceptScore W1995522818C121050878 @default.
• W1995522818 hasConceptScore W1995522818C181199279 @default.
• W1995522818 hasConceptScore W1995522818C185592680 @default.
• W1995522818 hasConceptScore W1995522818C192527728 @default.
• W1995522818 hasConceptScore W1995522818C199360897 @default.
• W1995522818 hasConceptScore W1995522818C206103511 @default.
• W1995522818 hasConceptScore W1995522818C2776734949 @default.
• W1995522818 hasConceptScore W1995522818C2777667214 @default.
• W1995522818 hasConceptScore W1995522818C2779906556 @default.
• W1995522818 hasConceptScore W1995522818C2780007248 @default.
• W1995522818 hasConceptScore W1995522818C41008148 @default.
• W1995522818 hasConceptScore W1995522818C553450214 @default.
• W1995522818 hasConceptScore W1995522818C55493867 @default.
• W1995522818 hasConceptScore W1995522818C59822182 @default.
• W1995522818 hasConceptScore W1995522818C86803240 @default.
• W1995522818 hasIssue "5" @default.
• W1995522818 hasLocation W19955228181 @default.
• W1995522818 hasOpenAccess W1995522818 @default.
• W1995522818 hasPrimaryLocation W19955228181 @default.

• next