FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1996314558> ?p ?o ?g. }

• W1996314558 endingPage "6727" @default.
• W1996314558 startingPage "6717" @default.
• W1996314558 abstract "V(D)J recombination is a process integral to lymphocyte development. However, this process is not always benign, since certain lymphoid malignancies exhibit recurrent chromosomal abnormalities, such as translocations and deletions, that harbor molecular signatures suggesting an origin from aberrant V(D)J recombination. Translocations involving LMO2, TAL1, Ttg-1, and Hox11, as well as a recurrent interstitial deletion at 1p32 involving SIL/SCL, are cited examples of illegitimate V(D)J recombination. Previous studies using extrachromosomal substrates reveal that cryptic recombination signal sequences (cRSSs) identified near the translocation breakpoint in these examples support V(D)J recombination with efficiencies ranging from about 30- to 20,000-fold less than bona fide V(D)J recombination signals. To understand the molecular basis for these large differences, we investigated the binding and cleavage of these cRSSs by the RAG1/2 proteins that initiate V(D)J recombination. We find that the RAG proteins comparably bind all cRSSs tested, albeit more poorly than a consensus RSS. We show that four cRSSs that support levels of V(D)J recombination above background levels in cell culture (LMO2, TAL1, Ttg-1, and SIL) are also cleaved by the RAG proteins in vitro with efficiencies ranging from 18 to 70% of a consensus RSS. Cleavage of LMO2 and Ttg-1 by the RAG proteins can also be detected in cell culture using ligation-mediated PCR. In contrast, Hox11 and SCL are nicked but not cleaved efficiently in vitro, and cleavage at other adventitious sites in plasmid substrates may also limit the ability to detect recombination activity at these cRSSs in cell culture. V(D)J recombination is a process integral to lymphocyte development. However, this process is not always benign, since certain lymphoid malignancies exhibit recurrent chromosomal abnormalities, such as translocations and deletions, that harbor molecular signatures suggesting an origin from aberrant V(D)J recombination. Translocations involving LMO2, TAL1, Ttg-1, and Hox11, as well as a recurrent interstitial deletion at 1p32 involving SIL/SCL, are cited examples of illegitimate V(D)J recombination. Previous studies using extrachromosomal substrates reveal that cryptic recombination signal sequences (cRSSs) identified near the translocation breakpoint in these examples support V(D)J recombination with efficiencies ranging from about 30- to 20,000-fold less than bona fide V(D)J recombination signals. To understand the molecular basis for these large differences, we investigated the binding and cleavage of these cRSSs by the RAG1/2 proteins that initiate V(D)J recombination. We find that the RAG proteins comparably bind all cRSSs tested, albeit more poorly than a consensus RSS. We show that four cRSSs that support levels of V(D)J recombination above background levels in cell culture (LMO2, TAL1, Ttg-1, and SIL) are also cleaved by the RAG proteins in vitro with efficiencies ranging from 18 to 70% of a consensus RSS. Cleavage of LMO2 and Ttg-1 by the RAG proteins can also be detected in cell culture using ligation-mediated PCR. In contrast, Hox11 and SCL are nicked but not cleaved efficiently in vitro, and cleavage at other adventitious sites in plasmid substrates may also limit the ability to detect recombination activity at these cRSSs in cell culture. The antigen binding domains of immunoglobulins and T cell receptors are encoded in germ line arrays of V, D, and J gene segments that are assembled into functional variable exons by V(D)J recombination during lymphocyte development (1Bassing C.H. Swat W. Alt F.W. Cell. 2002; 109: 45-55Abstract Full Text Full Text PDF PubMed Scopus (669) Google Scholar). The site of recombination is directed by a recombination signal sequence (RSS) 2The abbreviations used are:RSSrecombination signal sequencecRSScryptic RSSEMSAelectrophoretic mobility shift assaySEBsignal end breakRICrecombination information contentMOPSmorpholinepropanesulfonic acidLM-PCRligation-mediated PCRWTwild type.2The abbreviations used are:RSSrecombination signal sequencecRSScryptic RSSEMSAelectrophoretic mobility shift assaySEBsignal end breakRICrecombination information contentMOPSmorpholinepropanesulfonic acidLM-PCRligation-mediated PCRWTwild type. that flanks each receptor gene segment and consists of a conserved heptamer (consensus 5′-CACAGTG-3′) and nonamer (consensus 5′-ACAAAAACC-3′) separated by either 12 or 23 ± 1 nucleotides of more highly varied sequence. V(D)J recombination can be conceptually divided into two phases, a cleavage phase and a joining phase (2Fugmann S.D. Lee A.I. Shockett P.E. Villey I.J. Schatz D.G. Annu. Rev. Immunol. 2000; 18: 495-527Crossref PubMed Scopus (496) Google Scholar). In the cleavage phase, the lymphoid cell-specific RAG1 and RAG2 (recombination activating gene-1 and -2, respectively) proteins assemble a multiprotein synaptic complex with two RSSs (generally one 12-RSS and one 23-RSS) and introduce a DNA double strand break at each RSS between the heptamer and adjacent coding segment via a nick-hairpin mechanism to yield a blunt 5′-phosphorylated signal end and a coding end terminating in a covalently sealed DNA hairpin structure. In the joining phase, the signal ends are generally joined precisely to form signal joints, and the coding ends are processed and joined to form coding joints that typically contain nucleotide additions or deletions at the junction. These processes are normally mediated by components of the nonhomologous end-joining DNA repair pathway. recombination signal sequence cryptic RSS electrophoretic mobility shift assay signal end break recombination information content morpholinepropanesulfonic acid ligation-mediated PCR wild type. recombination signal sequence cryptic RSS electrophoretic mobility shift assay signal end break recombination information content morpholinepropanesulfonic acid ligation-mediated PCR wild type. Although V(D)J recombination is normally limited to antigen receptor loci, the RAG proteins may mediate illegitimate V(D)J recombination events outside antigen receptor loci (3Kuppers R. Dalla-Favera R. Oncogene. 2001; 20: 5580-5594Crossref PubMed Scopus (487) Google Scholar, 4Lieber M.R. Yu K. Raghavan S.C. DNA Repair (Amst.). 2006; 5: 1234-1245Crossref PubMed Scopus (149) Google Scholar, 5Marculescu R. Vanura K. Montpellier B. Roulland S. Le T. Navarro J.M. Jager U. McBlane F. Nadel B. DNA Repair (Amst.). 2006; 5: 1246-1258Crossref PubMed Scopus (86) Google Scholar). This may occur by any of several mechanisms, including mistakenly binding and cleaving a DNA sequence that resembles an authentic RSS by a standard nick-hairpin mechanism, by targeting non-B form DNA structures and cleaving them through the introduction of staggered nicks (6Raghavan S.C. Swanson P.C. Wu X. Hsieh C.L. Lieber M.R. Nature. 2004; 428: 88-93Crossref PubMed Scopus (203) Google Scholar), by mobilizing signal ends or episomal signal joints generated after initial RSS cleavage and promoting their integration elsewhere in the genome (either by direct transposition, end donation, or trans-V(D)J recombination) (7Reddy Y.V. Perkins E.J. Ramsden D.A. Genes Dev. 2006; 20: 1575-1582Crossref PubMed Scopus (55) Google Scholar, 8Vanura K. Montpellier B. Le T. Spicuglia S. Navarro J.M. Cabaud O. Roulland S. Vachez E. Prinz I. Ferrier P. Marculescu R. Jager U. Nadel B. PLoS Biol. 2007; 5: e43Crossref PubMed Scopus (27) Google Scholar, 9Chatterji M. Tsai C.L. Schatz D.G. Mol. Cell. Biol. 2006; 26: 1558-1568Crossref PubMed Scopus (40) Google Scholar, 10Messier T.L. O'Neill J.P. Hou S.M. Nicklas J.A. Finette B.A. EMBO J. 2003; 22: 1381-1388Crossref PubMed Scopus (77) Google Scholar), or through repair failures that allow DNA breaks to become illegitimately joined to DNA ends produced by RAG-mediated cleavage at antigen receptor loci (5Marculescu R. Vanura K. Montpellier B. Roulland S. Le T. Navarro J.M. Jager U. McBlane F. Nadel B. DNA Repair (Amst.). 2006; 5: 1246-1258Crossref PubMed Scopus (86) Google Scholar). The first type of mechanism is commonly suggested whenever an RSS-like motif (a cryptic RSS (cRSS)) is identified in the germ line sequence of a proto-oncogene near the chromosomal breakpoint, particularly if recombination involves an immunoglobulin or T cell receptor locus. In these cases, the location of the cRSS has generally been based on the position of a CAC motif (the first three residues of the consensus heptamer) nearest the recombination breakpoint that contains the highest number of additional residues that match the consensus heptamer and nonamer. However, since even authentic RSSs exhibit some degree of sequence variability in the heptamer and nonamer, and since mutations in the heptamer, nonamer, and spacer motifs have position-dependent and possibly synergistic effects on recombination efficiency (11Nadel B. Tang A. Lugo G. Love V. Escuro G. Feeney A.J. J. Immunol. 1998; 161: 6068-6073PubMed Google Scholar), determining whether a given cRSS can support V(D)J recombination is problematic in the absence of functional testing. Therefore, several laboratories have applied a well established extrachromosomal V(D)J recombination assay to assess the functionality of various cRSSs in cell culture (12Marculescu R. Le T. Simon P. Jaeger U. Nadel B. J. Exp. Med. 2002; 195: 85-98Crossref PubMed Scopus (126) Google Scholar, 13Kitagawa Y. Inoue K. Sasaki S. Hayashi Y. Matsuo Y. Lieber M.R. Mizoguchi H. Yokota J. Kohno T. J. Biol. Chem. 2002; 277: 46289-46297Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 14Raghavan S.C. Kirsch I.R. Lieber M.R. J. Biol. Chem. 2001; 276: 29126-29133Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), including those suspected of mediating chromosomal translocations involving LMO2 (t(11;14)(p13; q11)) (15Cheng J.T. Yang C.Y. Hernandez J. Embrey J. Baer R. J. Exp. Med. 1990; 171: 489-501Crossref PubMed Scopus (24) Google Scholar, 16Yoffe G. Schneider N. Dyk Van L. Yang C.Y. Siciliano M. Buchanan G. Capra J.D. Baer R. Blood. 1989; 74: 374-379Crossref PubMed Google Scholar), TAL1 (t(1;14)(p34;q11)) (17Chen Q. Yang C.Y. Tsan J.T. Xia Y. Ragab A.H. Peiper S.C. Carroll A. Baer R. J. Exp. Med. 1990; 172: 1403-1408Crossref PubMed Scopus (72) Google Scholar), Ttg-1 (t(11; 14)(p15;q11) (18Boehm T. Baer R. Lavenir I. Forster A. Waters J.J. Nacheva E. Rabbitts T.H. EMBO J. 1988; 7: 385-394Crossref PubMed Scopus (199) Google Scholar, 19Boehm T. Foroni L. Kaneko Y. Perutz M.F. Rabbitts T.H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4367-4371Crossref PubMed Scopus (323) Google Scholar), and Hox11 (t(10;14)(q24;q11) (20Kagan J. Finger L.R. Letofsky J. Finan J. Nowell P.C. Croce C.M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4161-4165Crossref PubMed Scopus (61) Google Scholar, 21Zutter M. Hockett R.D. Roberts C.W. McGuire E.A. Bloomstone J. Morton C.C. Deaven L.L. Crist W.M. Carroll A.J. Korsmeyer S.J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3161-3165Crossref PubMed Scopus (52) Google Scholar) as well as interstitial deletions involving SIL/SCL (1p32) (22Brown L. Cheng J.T. Chen Q. Siciliano M.J. Crist W. Buchanan G. Baer R. EMBO J. 1990; 9: 3343-3351Crossref PubMed Scopus (287) Google Scholar, 23Aplan P.D. Lombardi D.P. Ginsberg A.M. Cossman J. Bertness V.L. Kirsch I.R. Science. 1990; 250: 1426-1429Crossref PubMed Scopus (236) Google Scholar) and MTAP/p14–16 (9p21) (13Kitagawa Y. Inoue K. Sasaki S. Hayashi Y. Matsuo Y. Lieber M.R. Mizoguchi H. Yokota J. Kohno T. J. Biol. Chem. 2002; 277: 46289-46297Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 24Cayuela J.M. Gardie B. Sigaux F. Blood. 1997; 90: 3720-3726Crossref PubMed Google Scholar). Perhaps not surprisingly, the putative cRSSs studied to date exhibit a spectrum of activities in these assays, supporting V(D)J recombination at levels from ∼30-fold to over 20,000-fold less than a consensus RSS. The molecular basis for these differences remains unclear, because the binding and cleavage of these cRSSs by the RAG proteins has not been formally investigated. To address this issue, we have conducted extensive in vitro RAG cleavage and binding assays using cRSS substrates that have been characterized using extrachromosomal V(D)J recombination assays. We find that all intact oligonucleotide cRSS substrates tested show at least some level of RAG-mediated nicking at the 5′-end of the putative heptamer and some degree of RAG-mediated hairpin formation when the cRSS substrate is nicked. Interestingly, all intact cRSS substrates tested that support detectable levels of V(D)J recombination in cell culture support hairpin formation to levels ≥18% of a consensus 23-RSS in an in vitro cleavage assay. In contrast, cRSSs that fail to support detectable levels of V(D)J recombination in vivo show only ∼1% conversion to hairpins in the same assay. Electrophoretic mobility shift assays reveal that the RAG proteins bind all cRSSs tested more poorly than a consensus RSS, but there is little correlation between how well a given cRSS is cleaved by the RAG proteins and how well it is bound by them. We have also characterized RAG-mediated cleavage of plasmid V(D)J recombination substrates using ligation-mediated PCR (LM-PCR) to detect signal end breaks (SEBs) at a cRSS. SEBs were readily detected at cRSSs in vivo that support recombination efficiencies within ∼500-fold of a consensus RSS. LM-PCR can also detect SEBs generated at even less efficient cRSSs in vitro, but competition with adventitious cRSSs elsewhere in the plasmid backbone probably reduces recombination activity to undetectable levels. We also show that a recently identified gain-of-function RAG1 mutant cleaves these cRSSs with greater efficiency than wild-type RAG1, raising the possibility that mutations in RAG1 or other factors that regulate RAG-mediated synapsis and cleavage may promote illegitimate V(D)J recombination in vivo. The predictive value of these in vitro assays in assessing the in vivo recombination potential of a cRSS compared with in silico methods is discussed. Oligonucleotide and Plasmid Substrates—Oligonucleotides containing a consensus or cryptic RSS were synthesized and gel-purified using a commercial vendor (IDT Inc., Coralville, IA). Signal end oligonucleotides used to assemble nicked substrates included a 5′-phosphate introduced during chemical synthesis. Sequences for the substrates used in this study are shown in Table 1 (top strand only). To prepare intact or nicked duplex substrates, the top or bottom strand oligonucleotides were radiolabeled with [γ-32P]ATP using T4 polynucleotide kinase, annealed to their unlabeled complementary strand(s), and the duplex was purified on a native polyacrylamide gel as described previously (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). Plasmid V(D)J recombination substrates containing either consensus or cryptic recombination signals were generously provided by Michael Lieber and are indicated in Table 1 (14Raghavan S.C. Kirsch I.R. Lieber M.R. J. Biol. Chem. 2001; 276: 29126-29133Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar).TABLE 1Consensus and cryptic RSSs used in this studyRSS or cRSS (functionality)5′-FlankHeptameraNonconsensus nucleotides are underlined.SpacerNonameraNonconsensus nucleotides are underlined.3′-FlankRelative recombination efficiency (plasmid)bBased on data published by Rhaghavan et al. (14); TAL1 recombination efficiency estimated from data published by Marculescu et al. (12) and determined using the formula, (average number of colonies per transfection TAL1/Ddelta2 (18)/average number of colonies per transfection VkA2.27/JK1 (3700)) × recombination efficiency for consensus RSS (20,000) × percentage of cleavage at specific RSS (0.05).12-RSSGATCTGGCCTGTCTTACACAGTGGTAGTAGGCTGTACAAAAACCCTGCAG20,000 (pGG49)23-RSSGATCTGGCCTGTCTTACACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACCCTGCAG20,000 (pGG49)LMO2 (12-RSS)GTTCCAATGCTATGTAACACACACAGTATTGTCTTACCCAGCAATAATTTCGGTGCACGG760 (pSCR19)TAL1 (23-RSS)GCAGATCGCCCAGGACCACACCGCAGCGTAACTGCAGGCCTCTCAGCGAAAAAGGGGGAAAGCAAAG5 (TAL1/Ddelta2)Ttg-1 (23-RSS)CCCACCCTTGTCTTGAGCTCACACAGTGGCTCACCACCCCACACAGCCCTCACTCTGGCATGCGGACACACA38 (pSCR8)SIL (12-RSS)CACAATTTCTGGCTCACACTCTGCTACGTAGTAAGGGATCAGTTAATGTTTGAAGTTCATGGACTAC<0.8 (pSCR12)SIL (23-RSS)CACAATTTCTGGCTCACACTCTGCTACGTAGTAAGGGATCAGTTAATGTTTGAAGTTCATGGACTAC27 (pSCR15)SCL (12-RSS)AGAAATGAAAACCAACCACAGCCTCGCGCATTTCTGTATATTGCGTAAGGAAAAGGGGGAAGGAAGG<0.7 (pSCR10)SCL (23-RSS)AGAAATGAAAACCAACCACAGCCTCGCGCATTTCTGTATATTGCGTAAGGAAAAGGGGGAAGGAAGG<1.2 (pSCR13)Hox11 (12-RSS)CCCGCTCCTCTCCGCGCACAGCCAATGGAGAGACCCAGTCGAAACCGCGAAGCTCTCTTGCACCGGG<1 (pSCR29)Hox11 (23-RSS)CCCGCTCCTCTCCGCGCACAGCCAATGGAGAGACCCAGTCGAAACCGCGAAGCTCTCTTGCACCGGG<0.9 (pSCR17)a Nonconsensus nucleotides are underlined.b Based on data published by Rhaghavan et al. (14Raghavan S.C. Kirsch I.R. Lieber M.R. J. Biol. Chem. 2001; 276: 29126-29133Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar); TAL1 recombination efficiency estimated from data published by Marculescu et al. (12Marculescu R. Le T. Simon P. Jaeger U. Nadel B. J. Exp. Med. 2002; 195: 85-98Crossref PubMed Scopus (126) Google Scholar) and determined using the formula, (average number of colonies per transfection TAL1/Ddelta2 (18Boehm T. Baer R. Lavenir I. Forster A. Waters J.J. Nacheva E. Rabbitts T.H. EMBO J. 1988; 7: 385-394Crossref PubMed Scopus (199) Google Scholar)/average number of colonies per transfection VkA2.27/JK1 (3700)) × recombination efficiency for consensus RSS (20,000) × percentage of cleavage at specific RSS (0.05). Open table in a new tab Protein Expression and Purification—Wild-type, catalytically inactive (D600A) or hyperactive (E649A) forms of core (residues 384–1040) RAG1 and core (residues 1–387) RAG2 were coexpressed in 293 cells as maltose-binding protein fusion proteins (cMR1 and cMR2, respectively) and purified as described previously (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). The yields of wild-type and mutant RAG proteins were all similar. In some experiments, preparations of core RAG1 and full-length RAG2 or full-length RAG1 and core RAG2 were used (cMR1/FLMR2 or FLMR1/cMR2, respectively) (26Swanson P.C. Volkmer D. Wang L. J. Biol. Chem. 2004; 279: 4034-4044Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Full-length HMGB1 (high mobility group box 1) was expressed in Escherichia coli strain BL21(DE3)pLysS and purified using a combination of immobilized metal affinity chromatography and ion exchange chromatography as described previously (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). Oligonucleotide Cleavage and Binding Assays—RAG-mediated cleavage of oligonucleotide substrates was analyzed using an in vitro cleavage assay performed under permissive conditions containing Me2SO to promote RSS cleavage as described (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). Briefly, coexpressed wild-type or mutant RAG1/RAG2 proteins (100 ng) and HMGB1 (300 ng, where indicated) were incubated with substrate DNA (∼0.02 pmol) in a 10-μl reaction containing sample buffer (25 mm MOPS-KOH (pH 7.0), 60 mm potassium glutamate, 100 μg/ml bovine serum albumin, 20% Me2SO, and 1 mm MgCl2). In some experiments, reactions were further supplemented with cold partner RSS (0.1, 1, or 10 pmol, as indicated). Samples were incubated at 37 °C for 1 h, and the reaction products were visualized and quantified from dried sequencing gels using a Molecular Dynamics Storm 860 PhosphorImager running the ImageQuant software. Direct RAG binding to cRSS substrates was analyzed by electrophoretic mobility shift assay (EMSA) using the same buffer conditions as those used in the in vitro cleavage assay, except that CaCl2 replaced MgCl2 in the binding reaction to avoid substrate cleavage (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). For competition experiments shown in Fig. 1, binding reactions were supplemented with unlabeled intact consensus or cRSS substrate (0.1, 1, or 10 pmol, as indicated) before the addition of the RAG proteins. Cleavage of Plasmid Substrates in Vitro and in Vivo—RAG-mediated cleavage of plasmid V(D)J recombination substrates was analyzed using LM-PCR to detect signal end breaks at either the 12- or 23-RSS. For in vitro cleavage experiments, the various plasmid substrates in Table 1 (100 ng; linearized with AatII or BglII) were incubated with the cMR1/cMR2 and HMGB1 proteins under the same reaction conditions as used to assess cleavage of oligonucleotide substrates. The cleaved DNA was ligated to linker DNA assembled from oligonucleotides DR19 and DR20 as described previously (27Kriatchko A.N. Anderson D.K. Swanson P.C. Mol. Cell. Biol. 2006; 26: 4712-4728Crossref PubMed Scopus (14) Google Scholar), and then the ligation reaction was terminated by incubation at 65 °C for 30 min. Signal ends generated at the 12-RSS or 23-RSS positions were detected from one-tenth of the ligation reaction by PCR using recombinant TaqDNA polymerase (Invitrogen) and primer DR20 and either 12P (5′-TATTGTCTCATGAGCGGATAC-3′) or 23P (5′-GGTACATTGAGCAACTGACTG-3′), respectively. Initial denaturation was performed at 94 °C for 2 min, followed by 25 cycles of amplification (94 °C for 15 s, 54 °C for 30 s, and 72 °C for 30 s) and a final extension (72 °C for 10 min). LM-PCR products were fractionated on a 1.5% agarose gel and visualized by staining with ethidium bromide. For in vivo cleavage experiments, each 10-cm dish of 293 cells was cotransfected with one of the plasmid V(D)J recombination substrates listed in Table 1 (5 μg) and pcDNA1 expression constructs encoding WT, D600A, or E649A cMR1 (2.5 mg/dish) and WT cMR2 (2.5 mg) using 30 μg of polyethyleneimine as described previously (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). Cells were harvested 72 h post-transfection, and plasmid DNA was isolated from the cells using a QiaPrep Spin miniprep kit. SEBs at the 12- or 23-RSS were detected from 40 ng of recovered plasmid DNA using LM-PCR as described above. Characterization of cRSS Cleavage by the RAG1-RAG2 Complex—In previous studies (12Marculescu R. Le T. Simon P. Jaeger U. Nadel B. J. Exp. Med. 2002; 195: 85-98Crossref PubMed Scopus (126) Google Scholar, 14Raghavan S.C. Kirsch I.R. Lieber M.R. J. Biol. Chem. 2001; 276: 29126-29133Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), the functionality of several cRSSs identified from lymphoid malignancies were tested using an extrachromosomal substrate assay (Table 1). Some cRSSs supported relatively robust recombination activity, whereas others did not. Because the V(D)J recombination assay measures the culmination of both the cleavage and joining phases of V(D)J recombination, we wondered whether those cRSSs that did not support efficient recombination may be cleaved by the RAG proteins but not efficiently joined. The most straightforward way to begin testing this possibility is to compare RAG-mediated cleavage of consensus and cryptic RSSs in a standard in vitro cleavage assay. Toward this end, we prepared radiolabeled intact or nicked oligonucleotide substrates containing a consensus 12- or 23-RSS or a cRSS (LMO2, TAL1, Ttg-1, Hox11, SIL, and SCL) (Table 1). The substrates were incubated with a purified truncated “core” wild-type (WT) or catalytically inactive (D600A) RAG1-RAG2 complex (RAGs) in reaction buffer containing Mg2+ and Me2SO for 1 h at 37°C. The addition of Me2SO enhances RAG cleavage activity, which is otherwise low in Mg2+, and models the stimulation afforded by synapsis ((25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar) (supplemental Fig. 1A). Avoiding the need for adding partner RSS to promote synapsis simplifies the reaction scheme and is advantageous technically, because in most cases, the addition of a consensus partner RSS to reactions containing a labeled cRSS substrate reduces cRSS cleavage due to competitive inhibition of RAG binding (supplemental Fig. 1B; see below). Selected cleavage reactions were additionally supplemented with purified HMGB1, because this architectural DNA binding/bending protein is known to stimulate RAG binding and cleavage activity in vitro (particularly on 23-RSS substrates) and reduce aberrant nicking, even in the presence of Me2SO (25Bergeron S. Anderson D.K. Swanson P.C. Methods Enzymol. 2006; 408: 511-528Crossref PubMed Scopus (34) Google Scholar). Reaction products generated from RAG-mediated cleavage in vitro were analyzed after fractionation on sequencing gels. Based on previous studies (12Marculescu R. Le T. Simon P. Jaeger U. Nadel B. J. Exp. Med. 2002; 195: 85-98Crossref PubMed Scopus (126) Google Scholar, 14Raghavan S.C. Kirsch I.R. Lieber M.R. J. Biol. Chem. 2001; 276: 29126-29133Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), the cRSSs examined here fall into three groups: those that function as a 12-RSS (LMO2), those that function as a 23-RSS (Ttg-1, TAL1, and SIL), and those for which functionality could not be unambiguously determined (Hox11 and SCL). As expected from previous studies (28Swanson P.C. Mol. Cell. Biol. 2002; 22: 7790-7801Crossref PubMed Scopus (69) Google Scholar), no cleavage of intact RSS or cRSS substrates was observed by the D600A RAGs (Fig. 1, A–D). In contrast, WT RAGs convert most of the intact 12- and 23-RSS substrates into nicked and hairpin products; supplementing the cleavage reaction with HMGB1 slightly suppresses RAG-mediated cleavage and selectively diminishes aberrant nicking of the 23-RSS under these conditions. In the absence of HMGB1, all intact cRSSs tested are nicked by WT RAGs to some degree at the 5′-end of the putative heptamer. In some of the cRSSs (e.g. TAL1, Ttg-1, and Hox11), adventitious nicks are also introduced elsewhere in the substrate and accumulate with reaction kinetics similar to the appropriately sited nick (data not shown). Interestingly, hairpin products are observed in cleavage reactions containing LMO2, TAL1, SIL, and Ttg-1 substrates but are virtually undetectable in comparable reactions containing Hox11 and SCL substrates. The efficiency of hairpin formation using LMO2, TAL1, SIL, and Ttg-1 substrates compared with the 23-RSS ranges from 18 to 70% in the absence of HMGB1, whereas for Hox11 and SCL, these values are around 1% (Table 2). The addition of HMGB1 has variable effects on nicking and hairpin formation, depending on the substrate tested. In some cases (e.g. TAL1), aberrant nicking is reduced and hairpin formation is stimulated; in others (e.g. SIL), hairpin formation is suppressed. The molecular basis for these distinct outcomes remains unclear but, in the case of SIL, may be correlated with altered cRSS binding by the RAGs in the presence of HMGB1 (see below).TABLE 2Summary of cleavage and recombination data for consensus and cryptic RSSsIntact substrate (RAGs only)bPercentage conversion to total nicked (NT) and/or hairpin (HP) products for cRSSs relative to consensus 23-RSS calculated from at least three independent experiments.RSS or cRSS (functionality)HeptamerNonamerRelative recombination efficiencyRIC scoreaCalculated using the Recombination Signal Searching program available on the World Wide Web by the Duke University Laboratory of Computational Immunology using DNA sequence provided in Table 1. RIC scores greater than threshold values established to indicate functionality (≥-40 for 12-RSS and ≥-60 for 23-RSS; see Ref. 32) are given a pass (P) designation; those between the threshold value and the lower limit for a mouse immunologic RSS (RIC12 = -48.16; RIC23 = -69.69) are given a pass/fail (P/F) designation; those below the lower limit for a mouse immunologic RSS are given a fail (F) designation.cRSS percentage (NT + HP)/23-RSS percentage (NT + HP) × 100cRSS percentage (HP)/23-RSS percentage (HP) × 100SEBs in vitroSEBs in vivo12-RSSCACAGTGACAAAAACC20,000-22.06 (P)116148++++++23-RSSCACAGTGACAAAAACC20,000-27.09 (P)100100++++++LMO2 (12-RSS)CACAGTAGCAATAATT760-42.00 (P/F)117 ± 1140 ± 5.2++++TAL1 (23-RSS)CACACCGCGAAAAAGG5-56.49 (F)62 ± 2218 ± 1.8NDcND, not determined.NDTtg-1 (23-RSS)CACAGTGACTCTGGCA38-48.92 (P)65 ± 2170 ± 36+++SIL (12-RSS)CACTCTGGGATCAGTT<0.8-59.12 (F)67 ± 2626 ± 15+/--SIL (23-RSS)CACTCTGTGTTTGAAG27-73.66 (F)67 ± 2626 ± 15+++/-SCL (12-RSS)CACAGCCGTATATTGC<0.7-52.97 (F)8.5 ± 5.31.2 ± 1.2+/--SCL (23-RSS)CACAGCCAAGGAAAAG<1.2-65.81 (F)8.5 ± 5.31.2 ± 1.2NDNDHox11 (12-RSS)CACAGCCCAGTCGAAA<1-59.84 (F)8.5 ± 1.71.1 ± 0.9--Hox11 (23-RSS)CACAGCCGCGAAGCTC<0.9-74.23 (F)8.5 ± 1.71.1 ± 0.9+/-+/-a Calculated using the Recombination Signal Searching program available on the World Wide Web by the Duke University Laboratory of Computational Immunology using DNA sequence provided in Table 1. RIC scores greater than threshold values established to indicate functionality (≥-40 for 12-RSS and ≥-60 for 23-RSS; see Ref. 32Lee A.I. Fugmann S.D. Cowell L.G. Ptaszek L.M. Kelsoe G. Schatz D.G. PLoS Biol. 2003; 1: E1Crossref PubMed Scopus (57) Google Scholar) are given a pass (P) designation; those between the threshold value and the lower limit for a mouse immunologic RSS (RIC12 = -48.16; RIC23 = -69.69) are given a pass/fail (P/F) designation; those below the lower limit for a mouse immunologic RSS are given a fail (F) designation.b Percentage conversion to total nicked (NT) and/or hairpin (HP) products for cRSSs relative to consensus 23-RSS calculated from at least three independent e" @default.
• W1996314558 created "2016-06-24" @default.
• W1996314558 creator A5025226546 @default.
• W1996314558 creator A5080733133 @default.
• W1996314558 date "2008-03-01" @default.
• W1996314558 modified "2023-10-16" @default.
• W1996314558 title "V(D)J Recombinase Binding and Cleavage of Cryptic Recombination Signal Sequences Identified from Lymphoid Malignancies" @default.
• W1996314558 cites W1482882106 @default.
• W1996314558 cites W1484480328 @default.
• W1996314558 cites W1725765893 @default.
• W1996314558 cites W1968813490 @default.
• W1996314558 cites W1972940798 @default.
• W1996314558 cites W1981912835 @default.
• W1996314558 cites W1983894431 @default.
• W1996314558 cites W1986456445 @default.
• W1996314558 cites W1990903254 @default.
• W1996314558 cites W2010184646 @default.
• W1996314558 cites W2011330486 @default.
• W1996314558 cites W2012329498 @default.
• W1996314558 cites W2022372517 @default.
• W1996314558 cites W2022668368 @default.
• W1996314558 cites W2042119073 @default.
• W1996314558 cites W2048350311 @default.
• W1996314558 cites W2051077589 @default.
• W1996314558 cites W2066927043 @default.
• W1996314558 cites W2072149435 @default.
• W1996314558 cites W2072623685 @default.
• W1996314558 cites W2083170703 @default.
• W1996314558 cites W2088692721 @default.
• W1996314558 cites W2103425962 @default.
• W1996314558 cites W2107769824 @default.
• W1996314558 cites W2115073099 @default.
• W1996314558 cites W2118077304 @default.
• W1996314558 cites W2122161903 @default.
• W1996314558 cites W2148094532 @default.
• W1996314558 cites W2160186676 @default.
• W1996314558 cites W2163811249 @default.
• W1996314558 cites W2167216803 @default.
• W1996314558 cites W4236503412 @default.
• W1996314558 cites W4313343486 @default.
• W1996314558 cites W91665723 @default.
• W1996314558 doi "https://doi.org/10.1074/jbc.m710301200" @default.
• W1996314558 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18187418" @default.
• W1996314558 hasPublicationYear "2008" @default.
• W1996314558 type Work @default.
• W1996314558 sameAs 1996314558 @default.
• W1996314558 citedByCount "53" @default.
• W1996314558 countsByYear W19963145582012 @default.
• W1996314558 countsByYear W19963145582013 @default.
• W1996314558 countsByYear W19963145582014 @default.
• W1996314558 countsByYear W19963145582015 @default.
• W1996314558 countsByYear W19963145582016 @default.
• W1996314558 countsByYear W19963145582017 @default.
• W1996314558 countsByYear W19963145582020 @default.
• W1996314558 countsByYear W19963145582021 @default.
• W1996314558 countsByYear W19963145582022 @default.
• W1996314558 countsByYear W19963145582023 @default.
• W1996314558 crossrefType "journal-article" @default.
• W1996314558 hasAuthorship W1996314558A5025226546 @default.
• W1996314558 hasAuthorship W1996314558A5080733133 @default.
• W1996314558 hasBestOaLocation W19963145581 @default.
• W1996314558 hasConcept C102414288 @default.
• W1996314558 hasConcept C104317684 @default.
• W1996314558 hasConcept C113646796 @default.
• W1996314558 hasConcept C151730666 @default.
• W1996314558 hasConcept C153911025 @default.
• W1996314558 hasConcept C156695909 @default.
• W1996314558 hasConcept C157402786 @default.
• W1996314558 hasConcept C175156509 @default.
• W1996314558 hasConcept C2780254951 @default.
• W1996314558 hasConcept C43369102 @default.
• W1996314558 hasConcept C54355233 @default.
• W1996314558 hasConcept C86803240 @default.
• W1996314558 hasConcept C95444343 @default.
• W1996314558 hasConceptScore W1996314558C102414288 @default.
• W1996314558 hasConceptScore W1996314558C104317684 @default.
• W1996314558 hasConceptScore W1996314558C113646796 @default.
• W1996314558 hasConceptScore W1996314558C151730666 @default.
• W1996314558 hasConceptScore W1996314558C153911025 @default.
• W1996314558 hasConceptScore W1996314558C156695909 @default.
• W1996314558 hasConceptScore W1996314558C157402786 @default.
• W1996314558 hasConceptScore W1996314558C175156509 @default.
• W1996314558 hasConceptScore W1996314558C2780254951 @default.
• W1996314558 hasConceptScore W1996314558C43369102 @default.
• W1996314558 hasConceptScore W1996314558C54355233 @default.
• W1996314558 hasConceptScore W1996314558C86803240 @default.
• W1996314558 hasConceptScore W1996314558C95444343 @default.
• W1996314558 hasIssue "11" @default.
• W1996314558 hasLocation W19963145581 @default.
• W1996314558 hasOpenAccess W1996314558 @default.
• W1996314558 hasPrimaryLocation W19963145581 @default.
• W1996314558 hasRelatedWork W2025592993 @default.
• W1996314558 hasRelatedWork W2052774548 @default.
• W1996314558 hasRelatedWork W2056985143 @default.
• W1996314558 hasRelatedWork W2084354924 @default.
• W1996314558 hasRelatedWork W2087523985 @default.
• W1996314558 hasRelatedWork W2108082319 @default.
• W1996314558 hasRelatedWork W2140336226 @default.

• next