FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1996804832> ?p ?o ?g. }

• W1996804832 endingPage "37951" @default.
• W1996804832 startingPage "37942" @default.
• W1996804832 abstract "Neisseria gonorrhoeae is a sexually transmitted pathogen that initiates infections in humans by adhering to the mucosal epithelium of the urogenital tract. The bacterium then enters the apical region of the cell and traffics across the cell to exit into the subepithelial matrix. Mutations in the fast intracellular trafficking (fitAB) locus cause the bacteria to transit a polarized epithelial monolayer more quickly than the wild-type parent and to replicate within cells at an accelerated rate. Here, we describe the crystal structure of the toxin-antitoxin heterodimer, FitAB, bound to a high affinity 36-bp DNA fragment from the fitAB promoter. FitA, the antitoxin, binds DNA through its ribbon-helix-helix motif and is tethered to FitB, the toxin, to form a heterodimer by the insertion of a four turn α-helix into an extensive FitB hydrophobic pocket. FitB is composed of a PIN (PilT N terminus) domain, with a central, twisted, 5-stranded parallel β-sheet that is open on one side and flanked by five α-helices. FitB in the context of the FitAB complex does not display nuclease activity against tested PIN substrates. The FitAB complex points to the mechanism by which antitoxins with RHH motifs can block the activity of toxins with PIN domains. Interactions between two FitB molecules result in the formation of a tetramer of FitAB heterodimers, which binds to the 36-bp DNA fragment and provides an explanation for how FitB enhances the DNA binding affinity of FitA. Neisseria gonorrhoeae is a sexually transmitted pathogen that initiates infections in humans by adhering to the mucosal epithelium of the urogenital tract. The bacterium then enters the apical region of the cell and traffics across the cell to exit into the subepithelial matrix. Mutations in the fast intracellular trafficking (fitAB) locus cause the bacteria to transit a polarized epithelial monolayer more quickly than the wild-type parent and to replicate within cells at an accelerated rate. Here, we describe the crystal structure of the toxin-antitoxin heterodimer, FitAB, bound to a high affinity 36-bp DNA fragment from the fitAB promoter. FitA, the antitoxin, binds DNA through its ribbon-helix-helix motif and is tethered to FitB, the toxin, to form a heterodimer by the insertion of a four turn α-helix into an extensive FitB hydrophobic pocket. FitB is composed of a PIN (PilT N terminus) domain, with a central, twisted, 5-stranded parallel β-sheet that is open on one side and flanked by five α-helices. FitB in the context of the FitAB complex does not display nuclease activity against tested PIN substrates. The FitAB complex points to the mechanism by which antitoxins with RHH motifs can block the activity of toxins with PIN domains. Interactions between two FitB molecules result in the formation of a tetramer of FitAB heterodimers, which binds to the 36-bp DNA fragment and provides an explanation for how FitB enhances the DNA binding affinity of FitA. Neisseria gonorrhoeae (GC) 3The abbreviations used are: GC, N. gonorrhoeae; FitAB, fast intracellular trafficking; FitcAB, the FitAB complex in which the RHH domain of FitAB has been removed by limited proteolysis; RHH, ribbon-helix-helix; PIN, PilT N terminus; SeMet, selenomethionine; PEG, polyethylene glycol; RMSD, root mean-square deviation. 3The abbreviations used are: GC, N. gonorrhoeae; FitAB, fast intracellular trafficking; FitcAB, the FitAB complex in which the RHH domain of FitAB has been removed by limited proteolysis; RHH, ribbon-helix-helix; PIN, PilT N terminus; SeMet, selenomethionine; PEG, polyethylene glycol; RMSD, root mean-square deviation. is the agent of the sexually transmitted disease, gonorrhea. The mechanisms used by GC to initiate infection have been very well characterized. Gonococci adhere via a multistep cascade and subsequently enter cells forming the epithelial barrier of the urogenital tract, traffic across these cells and exit into the subepithelial matrix (1Apicella M.A. Ketterer M. Lee F.K. Zhou D. Rice P.A. Blake M.S. J. Infect. Dis. 1996; 173: 636-646Crossref PubMed Scopus (83) Google Scholar, 2Merz A.J. So M. Annu. Rev. Cell Dev. Biol. 2000; 16: 423-457Crossref PubMed Scopus (261) Google Scholar). Although studies have identified many of the molecular mechanisms used by GC to adhere to and enter cells, our knowledge of the mechanisms that operate in the later stages of infection is limited.GC are able to survive and grow within epithelial cells (3Hopper S. Wilbur J.S. Vasquez B.L. Larson J. Clary S. Mehr I.J. Seifert H.S. So M. Infect. Immun. 2000; 68: 896-905Crossref PubMed Scopus (56) Google Scholar); they also traverse the epithelial monolayer to infect the stromal tissue of the subepithelium (2Merz A.J. So M. Annu. Rev. Cell Dev. Biol. 2000; 16: 423-457Crossref PubMed Scopus (261) Google Scholar). The immune response to bacteria in the subepithelium produces the inflammation and purulent discharge characteristic of gonorrhea (4Edwards J.L. Apicella M.A. Clin. Microbiol. Rev. 2004; 17: 965-981Crossref PubMed Scopus (216) Google Scholar, 5Holmes K.K. Counts G.W. Beaty H.N. Ann. Intern. Med. 1971; 74: 979-993Crossref PubMed Scopus (242) Google Scholar). On occasion, GC establish a carrier state in which an asymptomatic individual harbors culturable and transmissible bacteria. These carriers are key to the spread of gonococcal disease, as humans are the only known reservoir for GC (6Turner C.F. Rogers S.M. Miller H.G. Miller W.C. Gribble J.N. Chromy J.R. Leone P.A. Cooley P.C. Quinn T.C. Zenilman J.M. J. Am. Med. Assoc. 2002; 287: 726-733Crossref PubMed Scopus (170) Google Scholar). The mechanisms by which GC maintains this persistent state are unknown. One hypothesis is that the organism resides within the epithelial cells instead of crossing into the subepithelium, thus evading the host immune response. The gene product(s) that affect GC intracellular growth and transcytosis are therefore important for the maintenance of gonococci in the human population.The fitAB operon was identified in a screen for GC mutants with a fast intracellular trafficking phenotype across polarized epithelial monolayers (3Hopper S. Wilbur J.S. Vasquez B.L. Larson J. Clary S. Mehr I.J. Seifert H.S. So M. Infect. Immun. 2000; 68: 896-905Crossref PubMed Scopus (56) Google Scholar). A GC mutant that lacks fitAB grows normally extracellularly, but has an accelerated rate of intracellular replication with a concomitant increase in the rate at which this mutant traverses a monolayer of polarized epithelial cells. Thus, either FitA or FitB, or their complex, is hypothesized to slow intracellular replication and intracellular trafficking of GC.FitA is an 8.4-kDa protein with a predicted N-terminal ribbon-helix-helix (RHH) DNA binding motif (7Raumann B.E. Rould M.A. Pabo C.O. Sauer R.T. Nature. 1994; 367: 754-757Crossref PubMed Scopus (256) Google Scholar, 8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar). FitB is a 15.3-kDa protein with a predicted PIN (PilT-N terminus) domain according to the BLAST search tool (9Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69141) Google Scholar). The function of the PIN domain is unknown; however many proteins that contain a PIN domain are thought to perform roles in nucleic acid metabolism including synthesis and remodeling. In genome studies on Archaea and thermophilic bacteria, sequences predicted to encode PIN domain-containing proteins are found in regions predicted to encode DNA polymerases, helicases, and nucleases (10Makarova K.S. Aravind L. Grishin N.V. Rogozin I.B. Koonin E.V. Nucleic Acids Res. 2002; 30: 482-496Crossref PubMed Scopus (267) Google Scholar). In addition, the Dis3p exonucleases from Saccharomyces cerevisiae and nonsense-mediated mRNA decay (NMD) proteins in Caenorhabditis elegans are predicted to have PIN domains (11Clissold P.M. Ponting C.P. Curr. Biol. 2000; 10: R888-R890Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar, 12Makarova K.S. Aravind L. Galperin M.Y. Grishin N.V. Tatusov R.L. Wolf Y.I. Koonin E.V. Genome. Res. 1999; 9: 608-628PubMed Google Scholar). Bicistronic operons where an RHH DNA-binding protein is juxtaposed with a PIN domain have been proposed to form one family of toxin/antitoxin systems (13Pandey D.P. Gerdes K. Nucleic Acids Res. 2005; 33: 966-976Crossref PubMed Scopus (713) Google Scholar). The PIN domain containing protein is thus predicted to act as a toxin; this is in agreement with the role of FitB in slowing GC replication when the bacteria are within epithelial cells (3Hopper S. Wilbur J.S. Vasquez B.L. Larson J. Clary S. Mehr I.J. Seifert H.S. So M. Infect. Immun. 2000; 68: 896-905Crossref PubMed Scopus (56) Google Scholar).FitA and FitB form a heterodimer, and copurify after overexpression in Escherichia coli. The FitAB complex binds DNA from the fitAB upstream region with high affinity (8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar). In our current model the FitAB complex binds to the fitAB promoter when GC are in an extracellular environment. This results in both sequestration of FitAB and repression of fitAB transcription. Upon invasion, FitAB may be released from the DNA and subsequently dissociate to slow both GC replication and transcytosis by an as yet undefined mechanism.To understand the structural basis of the DNA binding specificity and possible nuclease function of the FitAB complex, the x-ray crystallographic structure of a FitAB complex bound to a high affinity 36-base pair DNA fragment from the fitAB upstream region was determined. Four FitA and four FitB proteins form a unique tetramer of heterodimers structure that explains the ability of FitAB to bind DNA with higher affinity than FitA alone (8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar). Furthermore, the structure suggests that FitB could slow intracellular GC replication by acting as a “toxin” when the FitA (“the antitoxin”)-mediated inhibition of FitB nuclease activity is relieved upon complex dissociation.EXPERIMENTAL PROCEDURESProtein Preparation, Crystallization, and X-ray Intensity Data Collection—FitA and FitB were overexpressed in E. coli using a pET28b vector (Invitrogen) that encodes the intact FitAB operon (8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar). This vector incorporates a T7 promoter at the 5′-end of fitA and sequences encoding six histidine residues at the 3′-end of fitB. The C-terminal amino acid sequence of FitB was also slightly altered by the addition of an XhoI restriction site, changing from... NPWHD to... NPWHLEHHHHHH. The overexpressed FitAB complex was purified using nickel affinity chromatography (Qiagen). Purified FitAB complex was concentrated to 5 mg/ml in 25 mm Tris, pH 7.5, 500 mm NaCl, 200 mm imidazole.The intact FitAB complex did not crystallize despite numerous attempts. Therefore, limited proteolysis was done on the FitAB complex in order to generate a stabile core that might be more amenable to crystallization. Using 0.1 mg/ml trypsin (Sigma) the complex was digested for 30 min at 22 °C before crystallization trials. Trypsin inhibitor cross-linked to agarose beads (Sigma) was used to remove trypsin from the FitAB solution after digestion. Polyacrylamide gel electrophoresis and mass spectrometry analysis revealed that this treatment removed the ribbon-helix-helix motif of FitA and the resulting complex, termed FitcAB, does not bind DNA (data not shown). Crystallization was carried out using hanging drop-vapor diffusion where FitcAB was mixed 1:1 (v:v) with a reservoir solution of 0.26 m sodium phosphate/citrate pH 4.7 and 2.0 m ammonium sulfate. Crystals appeared overnight and grew to final dimensions of 0.1 mm × 0.1 mm × 0.02 mm in ∼3 days.To generate selenomethionine (SeMet)-substituted FitcAB complex, the expression vector described above was used as a template for standard PCR mutagenesis (Stratagene) of FitB, which contains no methionines, to yield a construct encoding FitAB where residues Leu43, Leu63, and Leu116 of FitB were substituted with methionines (FitAB3(LxM)). The FitAB3(LxM) protein was purified as described above. DNA binding assays confirmed that the FitAB3(LxM) complex has the same affinity for DNA as wild-type FitAB (data not shown). For overexpression of SeMet-substituted FitAB3(LxM), E. coli harboring the expression vector were grown in minimal medium lacking methionine with added SeMet as described (14Doublie S. Methods Enzymol. 1997; 276: 523-530Crossref PubMed Scopus (791) Google Scholar). Using nickel affinity column chromatography, SeMet-containing FitA and FitB3(LxM) copurify as do the wild-type proteins. The SeMet-containing heterodimer was concentrated and trypsinized as described for wild-type FitAB. Crystallization of the SeMet-FitcAB3(LxM) complex employed 0.26 m sodium citrate pH 5.6 and 2.0 m ammonium sulfate. Crystals with dimensions 0.2 mm × 0.2 mm × 0.2 mm were obtained after 4 weeks.To crystallize the FitAB-DNA complex, 5 mg/ml of purified native FitAB3(LxM) was mixed in a 4:1 molar ratio with IR36 DNA (8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar), where two of the thymine bases were replaced with 5-iodouracil (I) (top strand, 5′-AGATTGCTATCATTTTTTTTATTTTGATAGCATITG; bottom strand, 5′-CAAATGCTATCAAAAIAAAAAAAATGATAGCAATCT). The protein-DNA complex was then mixed 1:1 (v/v) with a reservoir solution of 0.1 m sodium acetate, pH 4.0, 0.27 m sodium acetate, pH 7.0, 7.2% PEG 20,000, 7.2% PEG monomethyl ether 550. Crystals with dimensions 0.02 × 0.1 × 0.5 mm were obtained after 1 week.Cryoprotection conditions for crystals of both native and SeMet-substituted FitcAB were established by soaking crystals in 20% glycerol, 0.26 m sodium phosphate/citrate, pH 4.7, and 2.2 m ammonium sulfate for ∼30 s. Cryoprotection was achieved for FitAB-IR36 crystals by soaking the crystals in 20% 2-methyl-2,4-pentanediol, 0.1 m sodium acetate, pH 4.0, 0.27 m sodium acetate, pH 7.0, 7.2% PEG 20,000, 7.2% PEG monomethyl ether 550 for 30 s. All crystals were flash-frozen in a nitrogen stream at 100 K. x-ray intensity data were collected at the Advanced Light Source beamline 8.2.1 (Berkeley, CA) and processed using MOSFLM (15Powell H.R. Acta Crystallogr. D. Biol. Crystallogr. 1999; 55: 1690-1695Crossref PubMed Scopus (304) Google Scholar) as implemented in the CCP4 suite (16Potterton E. Briggs P. Turkenburg M. Dodson E. Acta Crystallogr. D. Biol. Crystallogr. 2003; 59: 1131-1137Crossref PubMed Scopus (1056) Google Scholar).Structure Determinations and Refinements—The structure of SeMet-FitcAB3(LxM) was solved by multiple wavelength anomalous diffraction (MAD) methods using the SeMet-FitcAB3(LxM) data collected at three wavelengths (Table 1). Seven selenium sites were located and initial phases were calculated with SOLVE (17Terwilliger T.C. Berendzen J. Acta Crystallogr. D. Biol. Crystallogr. 1999; 55: 849-861Crossref PubMed Scopus (3219) Google Scholar) using data from 20.0 to 3.0 Å resolution and improved by solvent flipping (with 45% solvent content) as implemented in the crystallography and NMR system (CNS) (18Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. D. Biol. Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16930) Google Scholar). The handedness was determined by inspection of electron density maps where the initial phases were derived either from the selenium atom sites found by SOLVE or sites with the coordinates inverted. Electron density maps for the entire resolution range (58.0-2.0 Å) were then calculated using CNS. FitB and amino acid residues 46-65 of FitA were built into the map using O (19Jones T.A. Zou J.Y. Kjeldgaard Cowan S.W. Acta Crystallogr. A. 1991; 47: 110-119Crossref PubMed Scopus (13004) Google Scholar), and the location of the selenomethionine residues as reference points. 66 water molecules were added to the model and simulated annealing (SA), positional, and thermal parameter refinement using CNS were performed, followed by rebuilding of the model in O. When the Rwork and Rfree were 28.2 and 29.7%, respectively, the coordinates were used to solve the structure of the wild-type, native FitcAB molecule by molecular replacement using MOLREP (20Vagin A. Teplyakov A. Acta Crystallogr. D. Biol. Crystallogr. 2000; 56: 1622-1624Crossref PubMed Scopus (690) Google Scholar). Multiple rounds of positional and thermal parameter refinement in CNS followed by model rebuilding in O were done using the native data to the limiting resolution of 1.8 Å until the Rfree converged to 22.4%.TABLE 1Selected crystallographic statisticsSeMet-FitcAB3(L×M)Native FitcAB wild typeNative FitAB - IR36 DNASpace groupP212121P21Cell constants (Å)a = 49.1a = 70.0a = 75.0b = 68.5b = 50.7b = 82.4c = 104.5c = 48.3c = 135.5β = 118.5°β = 94.2°Wavelength (Å)0.97960.96860.97941.00001.0332Resolution (Å)57.74-2.0057.74-2.0057.74-2.0042.26-1.8081.65-3.00Overall Rsym (%)aRsym = ∑/∑|Ihkl-Ihkl(j)|/∑Ihkl, where Ihkl(j) is observed intensity and Ikhl is the final average value of intensity.9.0 (32.5)bValues in parentheses are for the highest resolution shell, 1.80 Å-1.99 Å for FitcAB, 3.00-3.14 Å for FitAB-IR36.9.5 (33.2)9.8 (33.5)5.5 (22.2)17.8 (44.0)Overall I/σ(I)3.7 (2.3)3.4 (2.2)3.1 (2.2)9.7 (3.1)3.1 (1.5)Total reflections (#)1968431979091970723100233243Unique reflections (#)2453924542245371334016708Completeness (%)96.5 (95.3)99.9 (99.9)Phasing resolution (Å)20.00-3.00Selenium sites (#)7Overall Figure of MeritcFigure of Merit = 〈|∑P(α)eiα/∑P(α)| 〉, where α is the phase and P(α) is the phase probability distribution.0.720RefinementRwork/Rfree (%)dRwork = ∑||Fobs|-|Fcalc||/∑Fobs| and Rfree = ∑|Fobs|-|Fcalc||/∑|Fobs|; where all reflections belong to a test set of 10% randomly selected data.19.1/22.421.2/26.9RmsdBond angles (°)1.281.27Bond lengths (Å)0.0070.008B values (Å2)1.901.60Average B-values (Å2)Overall2541Protein2538DNAn/aen/a, not applicable.51A-tractn/a42Ramachandran analysisMost favored (%/#)94.2/12988.5/655Additional allowed (%/#)5.8/811.2/83Generously allowed (%/#)0/00.3/2Disallowed (%/#)0/00/0a Rsym = ∑/∑|Ihkl-Ihkl(j)|/∑Ihkl, where Ihkl(j) is observed intensity and Ikhl is the final average value of intensity.b Values in parentheses are for the highest resolution shell, 1.80 Å-1.99 Å for FitcAB, 3.00-3.14 Å for FitAB-IR36.c Figure of Merit = 〈|∑P(α)eiα/∑P(α)| 〉, where α is the phase and P(α) is the phase probability distribution.d Rwork = ∑||Fobs|-|Fcalc||/∑Fobs| and Rfree = ∑|Fobs|-|Fcalc||/∑|Fobs|; where all reflections belong to a test set of 10% randomly selected data.e n/a, not applicable. Open table in a new tab The final model contains residues 1-139 of FitB, 46-64 of FitA, 92 water molecules, 1 acetate ion, 2 sulfate ions, and 3 magnesium ions. The final model was verified by inspection of 2Fo - Fc simulated annealing-composite omit maps.The high resolution FitcAB structure was used as a model to solve the structure of the FitAB-IR36 complex by molecular replacement using MOLREP (20Vagin A. Teplyakov A. Acta Crystallogr. D. Biol. Crystallogr. 2000; 56: 1622-1624Crossref PubMed Scopus (690) Google Scholar). The remainder of the FitA sequence and the DNA was built into the map using O (19Jones T.A. Zou J.Y. Kjeldgaard Cowan S.W. Acta Crystallogr. A. 1991; 47: 110-119Crossref PubMed Scopus (13004) Google Scholar). After simulated annealing (SA) and extensive positional and thermal parameter refinement using CNS followed by model rebuilding in O, the Rwork and Rfree converged to 21.2% and 26.9%, respectively, at 3.0 Å resolution. The model was verified by inspection of the 2Fo - Fc simulated annealing-composite omit maps. The final model contains four molecules of FitA (residues 2-69, 2-65, 2-68, 2-64), four molecules of FitB (residues 1-143, 1-140, 1-143, 1-140), the complete 36 base pair double-stranded IR36 DNA fragment and 54 water molecules. Figures were made using Swiss-PDB Viewer (21Guex N. Peitsch M.C. Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9472) Google Scholar) and POV-Ray.RESULTS AND DISCUSSIONStructure of the FitAB Heterodimer—The structure of the FitB protein complexed with a C-terminal fragment of FitA (FitcAB) was determined to 1.8 Å resolution by multiple wavelength anomalous diffraction using selenomethionine substituted proteins (“Experimental Procedures” and Table 1). This structure was used as a model to solve the structure of the full-length FitAB complex bound to a 36-bp DNA molecule to 3.0 Å resolution by molecular replacement (“Experimental Procedures” and Table 1).The FitA monomer has an extended structure, with the topology β1 (residues 4-7), α1 (residues 11-23), α2 (residues 28-43), α3 (residues 48-59) (Fig. 1a). Electron density is visible for the intact N terminus of FitA, beginning at Ala2. Met1 is not present in our preparation, as determined by N-terminal sequencing of the protein (data not shown). At the C-terminal end, variable electron density is seen for the four molecules of the asymmetric unit, the final 9-14 residues are not visible (depending upon the monomer). The first 45 residues of this protein (β1-α1-α2) are highly homologous to the RHH class of DNA-binding proteins, which includes the bacteriophage P22 proteins Mnt and Arc (Fig. 1b) (7Raumann B.E. Rould M.A. Pabo C.O. Sauer R.T. Nature. 1994; 367: 754-757Crossref PubMed Scopus (256) Google Scholar, 8Wilbur J.S. Chivers P.T. Mattison K. Potter L. Brennan R.G. So M. Biochemistry. 2005; 44: 12515-12524Crossref PubMed Scopus (27) Google Scholar, 22Burgering M.J. Boelens R. Gilbert D.E. Breg J.N. Knight K.L. Sauer R.T. Kaptein R. Biochemistry. 1994; 33: 15036-15045Crossref PubMed Scopus (56) Google Scholar). An overlay of the FitA and Arc repressor structures results in a root mean-squared deviation (RMSD) of 1.1 Å over the first 45 residues (23Holm L. Sander C. Trends Biochem. Sci. 1995; 20: 478-480Abstract Full Text PDF PubMed Scopus (1276) Google Scholar). An arginine found in β1 of the RHH proteins is conserved in FitA (Fig. 1b, highlighted in blue).FitB forms a compact domain with an α/β/α-fold (Fig. 1a). This protein consists of a central 5-stranded parallel β-sheet with four α-helices packed on one side of the sheet and three α helices on its other side. The topology is β1 (residues 1-5), α1 (residues 7-12), α2 (residues 19-26), β2 (residues 32-36), α3 (residues 38-48), α4 (residues 55-65), β3 (residues 74-76), α5 (residues 80-94), α6 (residues 102-112), β4 (residues 117-120), α7 (residues 124-128), β5 (residues 132-134) (Fig. 1a). Electron density for the entire FitB protein is visible, with only engineered histidine residues at the C terminus not observed in the structure (missing 3/6 His in 2 monomers and 6/6 His in 2 monomers). Searches, using both the DALI server (23Holm L. Sander C. Trends Biochem. Sci. 1995; 20: 478-480Abstract Full Text PDF PubMed Scopus (1276) Google Scholar) and the protein structure comparison service SSM (24Krissinel E. Henrick K. Acta Crystallogr. D. Biol. Crystallogr. 2004; 60: 2256-2268Crossref PubMed Scopus (3102) Google Scholar) at the European Bioinformatics Institute, found structural homologues of FitB in PIN-domain containing proteins. Using the BLAST server, none of these PIN domain-containing proteins were found to have significant similarity at the primary structure level to FitB (9Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69141) Google Scholar). The archetypical PIN domain is found in the PilT N terminus, and the closest FitB structural homologue is PAE2754 from Pyrobaculum aerophilim (Fig. 1b) (25Arcus V.L. Backbro K. Roos A. Daniel E.L. Baker E.N. J. Biol. Chem. 2004; 279: 16471-16478Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 26Wall D. Kaiser D. Mol. Microbiol. 1999; 32: 1-10Crossref PubMed Scopus (339) Google Scholar). The functional significance of this domain is unknown. However, the PIN domain is found in a wide variety of systems, from bacterial FitB-like genes that are thought to be involved in plasmid maintenance, to the yeast Dis3p exonucleases (11Clissold P.M. Ponting C.P. Curr. Biol. 2000; 10: R888-R890Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar, 27Freiberg C. Fellay R. Bairoch A. Broughton W.J. Rosenthal A. Perret X. Nature. 1997; 387: 394-401Crossref PubMed Scopus (583) Google Scholar, 28Hanekamp T. Kobayashi D. Hayes S. Stayton M.M. FEBS Lett. 1997; 415: 40-44Crossref PubMed Scopus (22) Google Scholar). Despite a lack of sequence similarity, the four acidic residues absolutely conserved among PIN domains are present in FitB (Fig. 1b, highlighted in red).In addition to the RHH and PIN domain-containing proteins, there is a group of prokaryotic proteins with a high level of sequence homology to FitAB (Fig. 1b). These typically consist of both a FitA and a FitB homologue in a conserved operon organization and little is understood about their biochemical function, although they are known to play a general role in plasmid stability and/or partition (27Freiberg C. Fellay R. Bairoch A. Broughton W.J. Rosenthal A. Perret X. Nature. 1997; 387: 394-401Crossref PubMed Scopus (583) Google Scholar, 31Pullinger G.D. Lax A.J. Mol. Microbiol. 1992; 6: 1631-1643Crossref PubMed Scopus (78) Google Scholar). These have been proposed to act as toxin/antitoxin pairs, with the RHH protein acting as the antitoxin, repressing the toxic activity of the PIN domain-containing protein (32Anantharaman V. Aravind L. Genome. Biol. 2003; 4: R81Crossref PubMed Google Scholar). The structure of the FitAB complex is likely to predict the structures of these toxin/antitoxin proteins. The biochemical function of this group of proteins within prokaryotic cells is likely to be similar as that performed by FitAB. Sequence alignments of FitA and FitB with two examples of such systems (Y4jJ/K and StbCB) are shown in Fig. 1b.The FitA-FitB Interface—The FitA and FitB proteins form a tightly associated dimer and the FitAB structure reveals the heterodimerization interface, which is formed predominantly by contacts between α3 and the C-terminal extended coil region of FitA and helices α1, α2, and α4 of FitB (Fig. 1, a and c). The interface buries 1900 Å2 accessible surface area in which the FitA helix fills a large exposed hydrophobic groove on FitB resulting in a globular heterodimeric domain (Fig. 1, a and c). Much of the interface is hydrophobic. For example, the nonpolar side chain of residue Leu52 of the FitA helix sits between Ile9 and Pro12 of FitB α1 (Fig. 1c). At the C terminus of FitA, outside of the helical region, the side chains of residue Ile59 contacts the side chains of residues Val58 and Leu59 from α4 of FitB (Fig. 1c). Other residues of the α4 and α4-β3 turn of FitB that are important components of the dimer interface are Ile67, Leu70, and Phe71, which contact Leu 48, Met51, and Ile55 of FitA (Fig. 1c).FitA helix α3 binding to FitB is also stabilized by four ionic interactions, which serve to orient and buttress the two molecules, thereby facilitating a tight association between the complementary hydrophobic surfaces (Fig. 1c). Interestingly, two of these electrostatic interactions are analogous to the charge clamp described in structures of the human nuclear receptors bound to helices of coactivators (33Nolte R.T. Wisely G.B. Westin S. Cobb J.E. Lambert M.H. Kurokawa R. Rosenfeld M.G. Willson T.M. Glass C.K. Milburn M.V. Nature. 1998; 395: 137-143Crossref PubMed Scopus (1660) Google Scholar, 34Watkins R.E. Maglich J.M. Moore L.B. Wisely G.B. Noble S.M. Davis-Searles P.R. Lambert M.H. Kliewer S.A. Redinbo M.R. Biochemistry. 2003; 42: 1430-1438Crossref PubMed Scopus (299) Google Scholar). In the charge clamp, charged residues engage in favorable electrostatic interactions with the oppositely charged dipole of the helical termini. The guanidinium group of FitA residue Arg47 interacts with the backbone carbonyl of residue Asp26 at the C-terminal end of the FitB α2-helix. The Nζ atom of FitB residue Lys55 interacts with a backbone carbonyl oxygens of residues Glu60 and Glu61 at the C-terminal end of the FitA helix. Other stabilizing electrostatic interactions occur between the side chains of FitA Glu58 and FitB Arg62 and FitA Glu63 and FitB Arg14 (Fig. 1c).Structure of the FitAB-IR36 Complex—Four FitAB heterodimers form a unique tetramer structure that binds to one 36-base pair DNA fragment (Fig. 2). The FitA subunits from complexes I and IV form a tightly associated domain that binds to one of the inverted repeat half-sites while the corresponding FitA portions of complexes II and III bind to the other inverted repeat (Fig. 2a). By contrast, the FitB-FitB dimer interfaces are formed between subunits from complexes I and II and complexes III and IV (Fig. 2a). Such mixing and matching of dimer interfaces is novel for the RHH family and results in the formation of the tetramer of heterodimers. Other toxin-antitoxin pairs have also been shown to form various higher order structures. For example, the MazE-MazF complex forms an extended heterohexamer (MazF2-MazE2-MazF2), and the RelE-RelB complex is a single globular domain that assembles into a heterotetramer (RelE2-RelB2) (35Takagi H. Kakuta Y. Okada T. Yao M. Tanaka I. Kimura M. Nat. Struct. Mol. Biol. 2005; 12: 327-331Cros" @default.
• W1996804832 created "2016-06-24" @default.
• W1996804832 creator A5011884853 @default.
• W1996804832 creator A5012858241 @default.
• W1996804832 creator A5045847541 @default.
• W1996804832 creator A5048996316 @default.
• W1996804832 date "2006-12-01" @default.
• W1996804832 modified "2023-10-03" @default.
• W1996804832 title "Structure of FitAB from Neisseria gonorrhoeae Bound to DNA Reveals a Tetramer of Toxin-Antitoxin Heterodimers Containing Pin Domains and Ribbon-Helix-Helix Motifs" @default.
• W1996804832 cites W1523335288 @default.
• W1996804832 cites W1726597626 @default.
• W1996804832 cites W1820567505 @default.
• W1996804832 cites W1963592098 @default.
• W1996804832 cites W1965277349 @default.
• W1996804832 cites W1979136121 @default.
• W1996804832 cites W1989869773 @default.
• W1996804832 cites W1994342014 @default.
• W1996804832 cites W1995017064 @default.
• W1996804832 cites W1997757535 @default.
• W1996804832 cites W2010724194 @default.
• W1996804832 cites W2013083986 @default.
• W1996804832 cites W2015442594 @default.
• W1996804832 cites W2015642465 @default.
• W1996804832 cites W2017727500 @default.
• W1996804832 cites W2018078151 @default.
• W1996804832 cites W2018201383 @default.
• W1996804832 cites W2022758791 @default.
• W1996804832 cites W2029841749 @default.
• W1996804832 cites W2036681286 @default.
• W1996804832 cites W2043995349 @default.
• W1996804832 cites W2055043387 @default.
• W1996804832 cites W2066653631 @default.
• W1996804832 cites W2067853474 @default.
• W1996804832 cites W2069506825 @default.
• W1996804832 cites W2071765639 @default.
• W1996804832 cites W2076424249 @default.
• W1996804832 cites W2076809355 @default.
• W1996804832 cites W2078652488 @default.
• W1996804832 cites W2084894372 @default.
• W1996804832 cites W2087642630 @default.
• W1996804832 cites W2092190477 @default.
• W1996804832 cites W2094820755 @default.
• W1996804832 cites W2099690719 @default.
• W1996804832 cites W2099770698 @default.
• W1996804832 cites W2101809821 @default.
• W1996804832 cites W2102086460 @default.
• W1996804832 cites W2106882534 @default.
• W1996804832 cites W2107454133 @default.
• W1996804832 cites W2107986672 @default.
• W1996804832 cites W2111719241 @default.
• W1996804832 cites W2113456624 @default.
• W1996804832 cites W2122386566 @default.
• W1996804832 cites W2126573196 @default.
• W1996804832 cites W2131206962 @default.
• W1996804832 cites W2135819136 @default.
• W1996804832 cites W2144998676 @default.
• W1996804832 cites W2152448366 @default.
• W1996804832 cites W2157717263 @default.
• W1996804832 doi "https://doi.org/10.1074/jbc.m605198200" @default.
• W1996804832 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16982615" @default.
• W1996804832 hasPublicationYear "2006" @default.
• W1996804832 type Work @default.
• W1996804832 sameAs 1996804832 @default.
• W1996804832 citedByCount "115" @default.
• W1996804832 countsByYear W19968048322012 @default.
• W1996804832 countsByYear W19968048322013 @default.
• W1996804832 countsByYear W19968048322014 @default.
• W1996804832 countsByYear W19968048322015 @default.
• W1996804832 countsByYear W19968048322016 @default.
• W1996804832 countsByYear W19968048322017 @default.
• W1996804832 countsByYear W19968048322018 @default.
• W1996804832 countsByYear W19968048322019 @default.
• W1996804832 countsByYear W19968048322020 @default.
• W1996804832 countsByYear W19968048322021 @default.
• W1996804832 countsByYear W19968048322023 @default.
• W1996804832 crossrefType "journal-article" @default.
• W1996804832 hasAuthorship W1996804832A5011884853 @default.
• W1996804832 hasAuthorship W1996804832A5012858241 @default.
• W1996804832 hasAuthorship W1996804832A5045847541 @default.
• W1996804832 hasAuthorship W1996804832A5048996316 @default.
• W1996804832 hasBestOaLocation W19968048321 @default.
• W1996804832 hasConcept C12554922 @default.
• W1996804832 hasConcept C159985019 @default.
• W1996804832 hasConcept C181199279 @default.
• W1996804832 hasConcept C185592680 @default.
• W1996804832 hasConcept C18903297 @default.
• W1996804832 hasConcept C192562407 @default.
• W1996804832 hasConcept C2777367657 @default.
• W1996804832 hasConcept C2778530040 @default.
• W1996804832 hasConcept C2778886173 @default.
• W1996804832 hasConcept C2778973234 @default.
• W1996804832 hasConcept C2779166590 @default.
• W1996804832 hasConcept C2779965526 @default.
• W1996804832 hasConcept C2780392137 @default.
• W1996804832 hasConcept C54355233 @default.
• W1996804832 hasConcept C552990157 @default.
• W1996804832 hasConcept C55493867 @default.
• W1996804832 hasConcept C71240020 @default.

• next