FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1997195556> ?p ?o ?g. }

• W1997195556 endingPage "11409" @default.
• W1997195556 startingPage "11397" @default.
• W1997195556 abstract "A hyperadrenergic state is a seminal aspect of chronic heart failure. Also, “Takotsubo stress cardiomyopathy,” is associated with increased plasma catecholamine levels. The mechanisms of myocyte damage secondary to excess catecholamine exposure as well as the consequence of this neurohumoral burst on cardiac stem cells (CSCs) are unknown. Cardiomyocytes and CSCs were exposed to high doses of isoproterenol (ISO), in vivo and in vitro. Male Wistar rats received a single injection of ISO (5 mg kg-1) and were sacrificed 1, 3, and 6 days later. In comparison with controls, LV function was impaired in rats 1 day after ISO and started to improve at 3 days. The fraction of dead myocytes peaked 1 day after ISO and decreased thereafter. ISO administration resulted in significant ryanodine receptor 2 (RyR2) hyperphosphorylation and RyR2-calstabin dissociation. JTV519, a RyR2 stabilizer, prevented the ISO-induced death of adult myocytes in vitro. In contrast, CSCs were resistant to the acute neurohumoral overload. Indeed, CSCs expressed a decreased and inverted complement of β1/β2-adrenoreceptors and absence of RyR2, which may explain their survival to ISO insult. Thus, a single injection of ISO causes diffuse myocyte death through Ca2+ leakage secondary to the acutely dysfunctional RyR2. CSCs are resistant to the noxious effects of an acute hyperadrenergic state and through their activation participate in the response to the ISO-induced myocardial injury. The latter could contribute to the ability of the myocardium to rapidly recover from acute hyperadrenergic damage. A hyperadrenergic state is a seminal aspect of chronic heart failure. Also, “Takotsubo stress cardiomyopathy,” is associated with increased plasma catecholamine levels. The mechanisms of myocyte damage secondary to excess catecholamine exposure as well as the consequence of this neurohumoral burst on cardiac stem cells (CSCs) are unknown. Cardiomyocytes and CSCs were exposed to high doses of isoproterenol (ISO), in vivo and in vitro. Male Wistar rats received a single injection of ISO (5 mg kg-1) and were sacrificed 1, 3, and 6 days later. In comparison with controls, LV function was impaired in rats 1 day after ISO and started to improve at 3 days. The fraction of dead myocytes peaked 1 day after ISO and decreased thereafter. ISO administration resulted in significant ryanodine receptor 2 (RyR2) hyperphosphorylation and RyR2-calstabin dissociation. JTV519, a RyR2 stabilizer, prevented the ISO-induced death of adult myocytes in vitro. In contrast, CSCs were resistant to the acute neurohumoral overload. Indeed, CSCs expressed a decreased and inverted complement of β1/β2-adrenoreceptors and absence of RyR2, which may explain their survival to ISO insult. Thus, a single injection of ISO causes diffuse myocyte death through Ca2+ leakage secondary to the acutely dysfunctional RyR2. CSCs are resistant to the noxious effects of an acute hyperadrenergic state and through their activation participate in the response to the ISO-induced myocardial injury. The latter could contribute to the ability of the myocardium to rapidly recover from acute hyperadrenergic damage. Heart failure (HF), 3The abbreviations used are: HF, heart failure; LV, left ventricle; AR, adrenoreceptor; PKA, protein kinase A; RyR2, ryanodine receptor 2; ISO, isoproterenol; ARVM, adult rat ventricular myocyte; EKG, electrocardiogram; TdT, terminal deoxynucleotidyltransferase; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PARP, poly(ADP-ribose) polymerase; CTRL, control; MHC, myosin heavy chain; CaMKII, calcium/calmodulin-dependent protein kinase II; DAPI, 4′,6-diamidino-2-phenylindole; cTnI, cardiac troponin I. the complex clinical syndrome characterized by impaired ability of the ventricle to fill with or eject blood, is the leading cause of death in the United States (1Rosamond W. Flegal K. Friday G. Furie K. Go A. Greenlund K. Haase N. Ho M. Howard V. Kissela B. Kittner S. Lloyd-Jones D. McDermott M. Meigs J. Moy C. Nichol G. O'Donnell C.J. Roger V. Rumsfeld J. Sorlie P. Steinberger J. Thom T. Wasserthiel-Smoller S. Hong Y. American Heart Association Statistics CommitteeStroke Statistics SubcommitteeCirculation. 2007; 115: e69-e171Crossref PubMed Scopus (2684) Google Scholar). Left ventricular (LV) dysfunction is usually a progressive process, and the main morphological manifestation of such progression is a poorly understood process known as cardiac remodeling. The latter is a rather complex phenomenon secondary to, as well as responsible for, anatomical, cellular, molecular, and humoral changes (2Anversa P. Nadal-Ginard B. Nature. 2002; 415: 240-243Crossref PubMed Scopus (449) Google Scholar, 3Wehrens X.H.T. Marks A.R. Nat. Rev. Drug Discov. 2004; 3: 565-573Crossref PubMed Scopus (108) Google Scholar). Recent data have added new pieces to the puzzle of cardiac remodeling. We and others (see Ref. 4Torella D. Ellison G.M. Karakikes I. Nadal-Ginard B. Cell. Mol. Life Sci. 2007; 64: 661-673Crossref PubMed Scopus (73) Google Scholar) have identified a population of cells with stem and progenitor cell characteristics in the hearts of adult mammals, including humans. These cardiac stem/progenitor cells, hereafter identified together as CSCs, are essential for maintaining normal cardiac cellular homeostasis throughout life by regenerating myocardial cells lost by wear and tear (5Nadal-Ginard B. Kajstura J. Leri A. Anversa P. Circ. Res. 2003; 92: 139-150Crossref PubMed Scopus (431) Google Scholar). CSCs, when injected into an infarcted myocardium, give rise to new functionally competent myocytes and vascular structures (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar). In addition, CSCs participate in the pathologic remodeling of hearts from aortic stenosis, myocardial infarction, and end stage cardiomyopathy (7Beltrami A.P. Urbanek K. Kajstura J. Yan S.M. Finato N. Bussani R. Nadal-Ginard B. Silvestri F. Leri A. Beltrami C.A. Anversa P. N. Engl. J. Med. 2001; 344: 1750-1757Crossref PubMed Scopus (1300) Google Scholar, 8Urbanek K. Quaini F. Tasca G. Torella D. Castaldo C. Nadal-Ginard B. Leri A. Kajstura J. Quaini E. Anversa P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10440-10445Crossref PubMed Scopus (451) Google Scholar, 9Torella D. Ellison G.M. Mendez-Ferrer S. Ibanez B. Nadal-Ginard B. Nat. Clin. Pract. Cardiovasc. Med. 2006; 3: S8-S13Crossref PubMed Scopus (145) Google Scholar). However, the role, if any, of CSCs during cardiac adaptation to stress remains unclear. Also unknown is whether cardiac insults that severely damage myocytes also affect the CSCs. In HF, cardiac contractility is impaired by abnormalities in the structure and/or function of molecules responsible for calcium (Ca2+) handling within the myocytes (3Wehrens X.H.T. Marks A.R. Nat. Rev. Drug Discov. 2004; 3: 565-573Crossref PubMed Scopus (108) Google Scholar, 10Wehrens X.H. Lehnart S.E. Marks A.R. Annu. Rev. Physiol. 2005; 67: 69-98Crossref PubMed Scopus (298) Google Scholar). Chronically elevated concentrations of catecholamines are a hallmark of chronic HF and contribute to the alterations in intracellular Ca2+ handling (11Cohn J.N. Levine T.B. Olivari M.T. Garberg V. Lura D. Francis G.S. Simon A.B. Rector T. N. Engl. J. Med. 1984; 311: 819-823Crossref PubMed Scopus (2797) Google Scholar). Indeed, chronic hyperactivity of the β-adrenoreceptor (AR) signaling pathway in HF leads to PKA-mediated hyperphosphorylation of the ryanodine receptor 2 (RyR2) of the sarcoplamic reticulum, which in turn results in continuous intracellular Ca2+ leakage (12Marx S.O. Reiken S. Hisamatsu Y. Jayaraman T. Burkhoff D. Rosemblit N. Marks A.R. Cell. 2000; 101: 365-376Abstract Full Text Full Text PDF PubMed Scopus (1686) Google Scholar). Moreover, acute increased levels of catecholamines are cardio-toxic (13Goldspink D.F. Burniston J.G. Ellison G.M. Clark W.A. Tan L.B. Exp. Physiol. 2004; 89: 407-416Crossref PubMed Scopus (77) Google Scholar, 14Reiken S. Gaburjakova M. Guatimosim S. Gomez A.M. D'Armiento J. Burkhoff D. Wang J. Vassort G. Lederer W.J. Marks A.R. J. Biol. Chem. 2003; 278: 444-453Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 15Teerlink J.R. Pfeffer J.M. Pfeffer M.A. Circ. Res. 1994; 75: 105-113Crossref PubMed Google Scholar, 16Shizukuda Y. Buttrick P.M. Geenen D.L. Borczuk A.C. Kitsis R.N. Sonnenblick E.H. Am. J. Physiol. 1998; 275: H961-H968PubMed Google Scholar) and cause significant myocyte death and hypertrophy in the long term (14Reiken S. Gaburjakova M. Guatimosim S. Gomez A.M. D'Armiento J. Burkhoff D. Wang J. Vassort G. Lederer W.J. Marks A.R. J. Biol. Chem. 2003; 278: 444-453Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 15Teerlink J.R. Pfeffer J.M. Pfeffer M.A. Circ. Res. 1994; 75: 105-113Crossref PubMed Google Scholar, 16Shizukuda Y. Buttrick P.M. Geenen D.L. Borczuk A.C. Kitsis R.N. Sonnenblick E.H. Am. J. Physiol. 1998; 275: H961-H968PubMed Google Scholar). In human HF, this increased myocyte death is accompanied by increased new myocyte formation (4Torella D. Ellison G.M. Karakikes I. Nadal-Ginard B. Cell. Mol. Life Sci. 2007; 64: 661-673Crossref PubMed Scopus (73) Google Scholar, 7Beltrami A.P. Urbanek K. Kajstura J. Yan S.M. Finato N. Bussani R. Nadal-Ginard B. Silvestri F. Leri A. Beltrami C.A. Anversa P. N. Engl. J. Med. 2001; 344: 1750-1757Crossref PubMed Scopus (1300) Google Scholar, 8Urbanek K. Quaini F. Tasca G. Torella D. Castaldo C. Nadal-Ginard B. Leri A. Kajstura J. Quaini E. Anversa P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10440-10445Crossref PubMed Scopus (451) Google Scholar, 9Torella D. Ellison G.M. Mendez-Ferrer S. Ibanez B. Nadal-Ginard B. Nat. Clin. Pract. Cardiovasc. Med. 2006; 3: S8-S13Crossref PubMed Scopus (145) Google Scholar) produced by the differentiation of the CSCs. Interestingly, spikes of excessive circulating catecholamines correlate with acute episodes of heart failure (i.e.“Takotsubo stress” cardiomyopathy) (17Wittstein I.S. Thiemann D.R. Lima J.A. Baughman K.L. Schulman S.P. Gerstenblith G. Wu K.C. Rade J.J. Bivalacqua T.J. Champion H.C. N. Engl. J. Med. 2005; 10: 539-548Crossref Scopus (2414) Google Scholar). Despite its biological and clinical significance, the mechanism(s) by which acute cathecolaminergic overload causes LV impairment remains unknown. Furthermore, regardless of the mechanism mediating myocyte damage and dysfunction, the effects of adrenergic overload on CSCs remain to be elucidated. Therefore, in the present study, a single injection of isoproterenol (ISO) was employed to induce acute diffuse myocyte damage and RyR2 expression and function in adult rat ventricular myocytes (ARVMs) were assessed in vivo and in vitro.We show here that acute β-cathecolaminergic overload causes significant myocyte apoptosis and necrosis, leading to acute but reversible cardiac failure, resembling “stress cardiomyopathy.” In addition, our data suggest that the acute ISO-induced myocyte damage is mediated by Ca2+ leakage through transiently dysfunctional RyR2 protein complex. The differentiation stage-specific pattern of expression of β1- and β2-ARs and the absence of RyR2 in the CSCs partially accounts for the resistance of these cells to ISO damage. Thus, CSCs are available to potentially contribute to cardiac recovery following acute neurohumoral stress damage. Animals—Male Wistar adult rats (336 ± 18 g) received a single injection (subcutaneously) of 5 mg kg-1 ISO or saline (CTRL), and they were killed (n = 7 per group) 1, 3, and 6 days later. Cardiac Hemodynamics and Echocardiography—Rats were anesthetized with 30% chloral hydrate (400 mg kg-1, intraperitoneally). A Millar microtip pressure transducer (Houston, TX) was advanced into the LV cavity through the right carotid artery, and LV end-diastolic and end-systolic pressures, LV developed pressure, and dP/dtmax and dP/dtmin were measured (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar, 18Torella D. Rota M. Nurzynska D. Musso E. Monsen A. Shiraishi I. Zias E. Walsh K. Rosenzweig A. Sussman M.A. Urbanek K. Nadal-Ginard B. Kajstura J. Anversa P. Leri A. Circ. Res. 2004; 94: 514-524Crossref PubMed Scopus (472) Google Scholar). EKG tracing was obtained in anesthetized rats by PowerLab/16e (ADInstruments, Australia). Also, parasternal long and short axis views were obtained with both M-mode and two-dimensional echocardiography. LV dimensions (LVEDD and LVESD) were measured perpendicular to the long axis of the ventricle at the midchordal level. Fractional shortening and LV ejection fraction were calculated (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar). Myocyte Death and Hypertrophy—At the time of sacrifice, the rat heart was excised, and LV and RV were separated and weighed. In separate experiments, after obtaining LV wet weights, the LV dried weights were obtained by drying the cardiac tissue at 70 °C for 72 h. Heart tissue was fixed and embedded in paraffin before 5-μm LV cross-sections were prepared using a cryotome (Sakura). Total myocyte mass was extrapolated through morphometric analysis (18Torella D. Rota M. Nurzynska D. Musso E. Monsen A. Shiraishi I. Zias E. Walsh K. Rosenzweig A. Sussman M.A. Urbanek K. Nadal-Ginard B. Kajstura J. Anversa P. Leri A. Circ. Res. 2004; 94: 514-524Crossref PubMed Scopus (472) Google Scholar). Myocyte-specific necrotic damage was detected using a mouse anti-myosin monoclonal antibody injected in vivo (13Goldspink D.F. Burniston J.G. Ellison G.M. Clark W.A. Tan L.B. Exp. Physiol. 2004; 89: 407-416Crossref PubMed Scopus (77) Google Scholar). All animals received 1mgkg-1 of the anti-myosin (intraperitoneally) 1 h before ISO injection and 3 h prior to euthanasia at 1, 3, and 6 days. To detect cellular apoptosis, LV sections were stained with rabbit anti-caspase-3 primary antibody (R&D Systems) as well as using the Terminal deoxynucleotidyltransferase (TdT) assay (Roche Applied Science). Dead myocytes were detected and quantified using fluorescent and confocal microscopy. Myocyte diameter was measured across the nucleus in transverse hematoxylin and eosin sections of the subendocardium layer. Myocyte volume was calculated assuming a spherical cross-section. Blood samples were obtained from animals sacrificed 1 day after ISO injection. The measurement of cardiac troponin I (cTnI) plasma level was performed using the Access 2 immunochemiluminometric assay (Beckman Coulter). Myocyte and CSC Isolation, Immunocytochemistry, and Histochemistry—ARVMs and CSCs were isolated from hearts of male Wistar rats (268 ± 30 g) by enzymatic dissociation (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar, 18Torella D. Rota M. Nurzynska D. Musso E. Monsen A. Shiraishi I. Zias E. Walsh K. Rosenzweig A. Sussman M.A. Urbanek K. Nadal-Ginard B. Kajstura J. Anversa P. Leri A. Circ. Res. 2004; 94: 514-524Crossref PubMed Scopus (472) Google Scholar). CSCs were identified, in vivo or in vitro, using an antibody against c-Kit (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar). More specifically, c-Kitpos CSCs were obtained by magnetic immunobead sorting (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar), and the purity of the preparation was assessed by flow cytometry. CSCs were identified as lineage-negative (Linneg), by staining negative for markers of hematopoietic, neural, and skeletal muscle lineages (6Beltrami A.P. Barlucchi L. Torella D. Baker M. Limana F. Chimenti S. Kasahara H. Rota M. Musso E. Urbanek K. Leri A. Kajstura J. Nadal-Ginard B. Anversa P. Cell. 2003; 114: 763-776Abstract Full Text Full Text PDF PubMed Scopus (3008) Google Scholar). β1-ARs and β2-ARs on CSCs were detected with rabbit polyclonal antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). In Vitro Response of CSCs And ARVMs to ISO—ARVMs were maintained in α-MEM medium for 16 h (19Communal C. Singh K. Sawyer D.B. Colucci W.S. Circulation. 1999; 100: 2210-2212Crossref PubMed Scopus (507) Google Scholar) and then were supplemented with fresh ascorbic acid (0.1 mmol/liter) before being treated with 10 nm, 100 nm, 1 μm, or 10 μm ISO. The 1,4-benzothiazepine derivative, JTV519 (100 nm or 1.0 μm;a kind gift of Dr. Andrew Marks, Center for Molecular Cardiology, Columbia University, New York) was added 45 min before ISO. In separate dishes, the L-type Ca2+ channel blockers, verapamil (20 μm) or diltiazem (20 μm), were added 30 min before ISO. ARVMs were fixed with 3.7% paraformaldehyde, and TdT staining was performed. The percentage of apoptotic TdT-positive (TdTpos) myocytes was determined and quantified using confocal microscopy. The same experiments were repeated using freshly isolated ARVMs. CSCs were plated on 35-mm dishes in modified F12K medium supplemented with 3% fetal calf serum (Invitrogen) and were treated with ISO at the same concentrations as ARVMs (see above). All dishes were supplemented with ascorbic acid (0.1 mmol/liter). The β1- and β2-AR blockers, CGP20172A (0.3 μm) and ICI 118551 (0.1 μm), were added 30 min before ISO, respectively. Eight hours after ISO treatment, cells were fixed and stained, and the percentage of apoptotic TdTpos CSCs was determined (18Torella D. Rota M. Nurzynska D. Musso E. Monsen A. Shiraishi I. Zias E. Walsh K. Rosenzweig A. Sussman M.A. Urbanek K. Nadal-Ginard B. Kajstura J. Anversa P. Leri A. Circ. Res. 2004; 94: 514-524Crossref PubMed Scopus (472) Google Scholar). Quantitative Real Time RT-PCR Analysis—Total RNA was extracted from ARVMs and CSCs using the FastTrack® MAG kit (Invitrogen). Real time RT-PCR was performed using the Taqman detection protocol in an ABI Prism 7700 thermocycler (Applied Biosystems, Foster City, CA). The results for β1-AR, β2-AR, and RyR2 real time RT-PCR assays were averaged and normalized to product produced by the housekeeping gene, GAPDH, providing a relative quantitation value. Primers were designed using the Primer Express™ program (Applied Biosystems), and the specific sequences were as follows: AAGTCCTCCCTCAAGCTCCTAAGT (forward) and TTGCTTTGCCTTTGCCC (reverse) for β-MHC; 5′-CCCGCCTCGCTGCTGCCTCC-3′ (forward) and 5′-AGCCAGCAGAGCGTGAAC-3′ (reverse) for β1-AR; 5′-ACGAGCTCAGTGTGCAGGACGCGCC-3′ (forward) and 5′-TCAAATCCCTGCCTACAACACTCCA-3′ (reverse) for β2-AR; 5′-GCAAACTTGGAGTTCTTGTCAGGCAT-3′ (forward) and 5′-TCGTTGACGTCAACAGAACTT-3′ (reverse) for RyR2; 5′-ATTGCTCTCAATGACAACTT-3′ (forward) and 5′-GAACTTTATTGATGGTATTCG-3′ (reverse) for GAPDH. Western Blot Analysis—Immunoblots and immunoprecipitations were carried out using protein lysates obtained from freshly isolated CSCs or ARVMs (18Torella D. Rota M. Nurzynska D. Musso E. Monsen A. Shiraishi I. Zias E. Walsh K. Rosenzweig A. Sussman M.A. Urbanek K. Nadal-Ginard B. Kajstura J. Anversa P. Leri A. Circ. Res. 2004; 94: 514-524Crossref PubMed Scopus (472) Google Scholar). Generally, the equivalent of ∼50 μg of proteins were separated on gradient (6-15%) SDS-polyacrylamide gels. After electrophoresis, proteins were transferred onto nitrocellulose filters, blocked with either 5% dry milk or 5% bovine serum albumin, and incubated with rabbit polyclonal Abs against β1-AR (Santa Cruz Biotechnology), β2-AR (Santa Cruz Biotechnology), calstabin, RyR2-5029, phospho-Ser2808-RyR2 (PKA site of RyR2-phosphorylation), phospho-Ser2814-RyR2 (CaMKII site of RyR2-phosphorylation) (a kind gift of Dr. A. R. Marks), CaMKII, phospho-CaMKII, cleaved caspase-3, cleaved poly(ADP-ribose) polymerase (PARP) (Cell Signaling), PKA, phospho-PKAα (Abcam) at dilutions suggested by the manufacturers. Proteins were detected by chemiluminescence using horseradish peroxidase-conjugated anti-rabbit secondary antibodies and the Chemidoc XRS system (Bio-Rad). Statistical Analysis—Data are reported as mean ± S.D. Significance between two groups was determined by Student's t test and in multiple comparisons by the analysis of variance. The Bonferroni post hoc method was used to locate the differences. Significance was set at p < 0.05. ISO Produces Acute but Transient Cardiac Failure—Subcutaneous administration of 5 mg kg-1 ISO resulted in ∼20% mortality of the treated animals. In these ISO-treated rats, the EKG showed ST ischemic changes followed by rapid sustained ventricular tachycardia, which developed into ventricular fibrillation and death of the animal (Fig. 1, A-F). In the majority of the rats treated with ISO (n = 21), ST changes were evident, and periods of short bursts of ventricular tachycardia were registered during the EKG monitoring immediately after ISO administration (Fig. 1, G and H). Blood pressure of ISO-treated animals was lower than in CTRL at 1 day but returned to normal values at 3-6 days after ISO injection (Table 1). Heart rates in ISO-treated rats were significantly higher at 6-24 h but returned to normal at 3 days after ISO injection (Table 1). Since the plasma half-time for ISO is typically in the range of 4-5 min, the presence of tachycardia at 1 day after ISO is mainly the result of the pathophysiological adaptation of LV mechanics to the acute and temporary decompensated functional state secondary to the ISO injection (see below).TABLE 1Hemodynamic, echocardiographic, and anatomical measurementsCTRLISO 1 dayISO 3 daysISO 6 daysSBPaSystolic blood pressure. (mm Hg)93 ± 481 ± 5bp < 0.05 versus CTRL.94 ± 495 ± 4DBPcDiastolic blood pressure. (mm Hg)70 ± 159 ± 5bp < 0.05 versus CTRL.69 ± 972 ± 8HRdHeart rate. (beats/min)402 ± 20446 ± 20bp < 0.05 versus CTRL.408 ± 23405 ± 15LVDDeLeft ventricular diastolic diameter. (mm)4.7 ± 0.45.8 ± 0.1bp < 0.05 versus CTRL.NDfND, not determined.5.1 ± 0.3gp < 0.05 versus ISO 1 day.LVSDhLeft ventricular systolic diameter. (mm)2.6 ± 0.44.3 ± 0.3bp < 0.05 versus CTRL.ND3.1 ± 0.4gp < 0.05 versus ISO 1 day.Fractional shortening (%)45 ± 426 ± 3bp < 0.05 versus CTRL.ND40 ± 4gp < 0.05 versus ISO 1 day.Ejection fraction (%)78 ± 657 ± 6bp < 0.05 versus CTRL.ND72 ± 5gp < 0.05 versus ISO 1 day.LVEDPiLV end-diastolic pressure. (mm Hg)3.8 ± 1.521.0 ± 4.2bp < 0.05 versus CTRL.15.4 ± 7.4bp < 0.05 versus CTRL.10.4 ± 2.1bp < 0.05 versus CTRL.gp < 0.05 versus ISO 1 day.LVDevPjLV developed pressure. (mm Hg)88.5 ± 8.264.3 ± 12.7bp < 0.05 versus CTRL.81.7 ± 9.1gp < 0.05 versus ISO 1 day.86.7 ± 7.9gp < 0.05 versus ISO 1 day.dP/dtmax (mm Hg/s)8124 ± 10276546 ± 888bp < 0.05 versus CTRL.7576 ± 3658116 ± 722gp < 0.05 versus ISO 1 day.dP/dtmin (mm Hg/s)7889 ± 12405730 ± 625bp < 0.05 versus CTRL.6739 ± 9647906 ± 743gp < 0.05 versus ISO 1 day.LV wet weight (mg)767 ± 32830 ± 58873 ± 43bp < 0.05 versus CTRL.825 ± 26LV dry weight (mg)165 ± 7153 ± 9192 ± 7bp < 0.05 versus CTRL.gp < 0.05 versus ISO 1 day.181 ± 6bp < 0.05 versus CTRL.gp < 0.05 versus ISO 1 day.Myocyte volume (mm3)12,827 ± 161213,360 ± 260020,213 ± 3664bp < 0.05 versus CTRL.gp < 0.05 versus ISO 1 day.17,132 ± 2248bp < 0.05 versus CTRL.a Systolic blood pressure.b p < 0.05 versus CTRL.c Diastolic blood pressure.d Heart rate.e Left ventricular diastolic diameter.f ND, not determined.g p < 0.05 versus ISO 1 day.h Left ventricular systolic diameter.i LV end-diastolic pressure.j LV developed pressure. Open table in a new tab Indeed, ventricular function parameters document that the single ISO injection caused marked changes in LV performance (Table 1). At 1 day after injection, when compared with CTRL, ISO-treated animals exhibited a significantly decreased (p < 0.05) LV developed pressure, dP/dtmax and dP/dtmin and increased LV end-diastolic pressure, uncovering acute and severe LV failure in all treated animals. These parameters started to improve 3 days after treatment and had returned to control values by day 6 except for end-systolic pressure, which still was lower than at 1 day after ISO (Table 1). Echo data confirmed that ISO caused acute LV failure at 1 day and that LV function spontaneously recovered at 6 days (Fig. 1I and Table 1). ISO Causes Myocyte Death through both Necrosis and Apoptosis—In the rat heart with patent coronary circulation, ISO exposure caused diffuse necrotic and apoptotic myocyte death throughout the myocardium (Figs. 2 and 3). Hematoxylin and eosin cross-sections from ISO-treated hearts displayed myocytes with disrupted sarcolemmal membranes and pale cytoplasmic staining, implicating focal necrosis. This was most evident in the subendocardium (Fig. 2A). Furthermore, 3 days after ISO-induced damage, an increased inflammatory reaction was evident (Fig. 2A). Myocyte-specific necrosis was detected by injecting in vivo a mouse anti-myosin monoclonal antibody, which exclusively tags necrotic myocytes (13Goldspink D.F. Burniston J.G. Ellison G.M. Clark W.A. Tan L.B. Exp. Physiol. 2004; 89: 407-416Crossref PubMed Scopus (77) Google Scholar) (Fig. 2B). The fraction of necrotic myocytes was 8 ± 2% at 1 day in the subendocardial layer (p < 0.001 versus CTRL; 0 ± 0%; Fig. 2C). The other two layers were less affected by ISO (data not shown).FIGURE 3Isoproterenol caused acute myocyte apoptosis along with RyR2 dysfunction and reactive myocyte hypertrophy in the LV. A-D, representative picture of apoptotic myocytes stained by activated caspase-3 (A) (green) and TdT (B) (TdT (green), MHC (red), and DAPI (blue)). C and D, apoptotic (caspase-3- and TdT-positive) myocytes were significantly increased at 1 day in the LV and progressively decreased over time. *, p < 0.05 versus CTRL. E, representative Western blots of cleaved caspase-3 and PARP in isolated myocytes after ISO injection. Changes to caspase-3 and PARP progressively decreased over 6 days. F, distribution of myocyte sizes (open bars) at 1 day after ISO showing the fraction of dead myocytes (necrotic and apoptotic; solid bars) only in the largest myocytes. G, LV dry weight was slightly decreased at 1 day but significantly increased at 3 days, indicating net loss of myocytes followed by reactive cardiac hypertrophy at days 1-3 after ISO injection. *, p < 0.05 versus CTRL. H, quantitative real-time RT-PCR showed increased mRNA transcripts of β-MHC in ARVMs isolated from ISO-treated hearts at 3 days when compared with CTRL and 1 day. Data are presented as the ratio between numbers of β-MHC and GAPDH mRNA molecules per μg of RNA. *, p < 0.01. I and J, representative Western blots of phospho-PKA, PKAα, phospho-CaMKII, CaMKII, total RyR2, and PKA- and CaMKII-mediated RyR2 phosphorylation levels in ARVMs isolated from hearts of rats at 1, 3, and 6 days after ISO or saline vehicle (CTRL). K, the levels of calstabin were not affected by ISO injection, whereas calstabin was displaced from the RyR2 complex at 1 day as shown by the immunoprecipitation with RyR2 and the Western blot for calstabin.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Necrotic myocytes progressively decreased from day 3 to 6 but were still higher than CTRL (p < 0.05; Fig. 2C). All evidence indicates that most, if not all, of the cardiac damage occurred during the first 24 h, but the scavenger system was overloaded to efficiently remove the cell debris. To confirm myocyte necrosis after ISO injection, we measured cTnI in blood samples taken from the animals sacrificed 1 day after ISO. Increased plasma levels of cTnI or cardiac troponin T are highly specific for and correlate with the size of the damaged myocardium (20Jaffe A.S. Ravkilde J. Roberts R. Naslund U. Apple F.S. Galvani M. Katus H. Circulation. 2000; 102: 1216-1220Crossref PubMed Scopus (570) Google Scholar). ISO treatment resulted in a significant increase (p < 0.001) in blood cTnI (Fig. 2D), reaching 93 ± 10 ng/ml, which in humans corresponds to large infarct sizes (20Jaffe A.S. Ravkilde J. Roberts R. Naslund U. Apple F.S. Galvani M. Katus H. Circulation. 2000; 102: 1216-1220Crossref PubMed Scopus (570) Google Scholar). These values are in agreement with the loss of 17 ± 4% of myocyte mass 1 day after ISO administration (see below). ISO-induced myocyte apoptosis was identified by labeling for caspase-3 and was confirmed using the TdT (terminal dUTP nick-end labeling) assay with dUTP (Fig. 3, A-D). The number of apoptotic myocytes in CTRL animals was minimal (caspase-3-labeled myocytes, 0.02 ± 0.01%; TdT-labeled myocyte nuclei, 0.01 ± 0.01%). In contrast, the percentage of apoptotic myocytes in the LV of ISO-treated animals was significantly (p < 0.05) increased at 1 day (caspase-3, 0.4 ± 0.16%; TdT, 0.7 ± 0.29%) in the severely damaged subendocardial layer (Fig. 3, C and D), being less in the midwall and subepicardial layers (data not shown), compared with CTRL. Like necrotic myocytes, the myocyte apoptosis rate had decreased by 3-6 days after ISO but was still significantly greater than CTRL (Fig." @default.
• W1997195556 created "2016-06-24" @default.
• W1997195556 creator A5004219222 @default.
• W1997195556 creator A5022550984 @default.
• W1997195556 creator A5029382158 @default.
• W1997195556 creator A5040206715 @default.
• W1997195556 creator A5054698530 @default.
• W1997195556 creator A5063747611 @default.
• W1997195556 creator A5065683887 @default.
• W1997195556 creator A5068281952 @default.
• W1997195556 creator A5075839695 @default.
• W1997195556 creator A5077265250 @default.
• W1997195556 date "2007-04-01" @default.
• W1997195556 modified "2023-10-16" @default.
• W1997195556 title "Acute β-Adrenergic Overload Produces Myocyte Damage through Calcium Leakage from the Ryanodine Receptor 2 but Spares Cardiac Stem Cells" @default.
• W1997195556 cites W1542955217 @default.
• W1997195556 cites W1923017003 @default.
• W1997195556 cites W1971671142 @default.
• W1997195556 cites W1993830765 @default.
• W1997195556 cites W2001261561 @default.
• W1997195556 cites W2010688793 @default.
• W1997195556 cites W2022185139 @default.
• W1997195556 cites W2028036560 @default.
• W1997195556 cites W2033250271 @default.
• W1997195556 cites W2035033869 @default.
• W1997195556 cites W2036525653 @default.
• W1997195556 cites W2057491896 @default.
• W1997195556 cites W2063654473 @default.
• W1997195556 cites W2089007506 @default.
• W1997195556 cites W2110333181 @default.
• W1997195556 cites W2112844674 @default.
• W1997195556 cites W2116297568 @default.
• W1997195556 cites W2116351152 @default.
• W1997195556 cites W2117576954 @default.
• W1997195556 cites W2120062223 @default.
• W1997195556 cites W2127815897 @default.
• W1997195556 cites W2138803501 @default.
• W1997195556 cites W2140313980 @default.
• W1997195556 cites W2144744611 @default.
• W1997195556 cites W2146592576 @default.
• W1997195556 cites W2147343486 @default.
• W1997195556 cites W2154034443 @default.
• W1997195556 cites W2156802607 @default.
• W1997195556 cites W2158197581 @default.
• W1997195556 cites W2168275634 @default.
• W1997195556 cites W2169268511 @default.
• W1997195556 cites W2338638760 @default.
• W1997195556 cites W235951334 @default.
• W1997195556 cites W2417847580 @default.
• W1997195556 cites W2615043561 @default.
• W1997195556 cites W4251099544 @default.
• W1997195556 doi "https://doi.org/10.1074/jbc.m607391200" @default.
• W1997195556 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2276680" @default.
• W1997195556 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17237229" @default.
• W1997195556 hasPublicationYear "2007" @default.
• W1997195556 type Work @default.
• W1997195556 sameAs 1997195556 @default.
• W1997195556 citedByCount "151" @default.
• W1997195556 countsByYear W19971955562012 @default.
• W1997195556 countsByYear W19971955562013 @default.
• W1997195556 countsByYear W19971955562014 @default.
• W1997195556 countsByYear W19971955562015 @default.
• W1997195556 countsByYear W19971955562016 @default.
• W1997195556 countsByYear W19971955562017 @default.
• W1997195556 countsByYear W19971955562018 @default.
• W1997195556 countsByYear W19971955562019 @default.
• W1997195556 countsByYear W19971955562020 @default.
• W1997195556 countsByYear W19971955562021 @default.
• W1997195556 countsByYear W19971955562022 @default.
• W1997195556 countsByYear W19971955562023 @default.
• W1997195556 crossrefType "journal-article" @default.
• W1997195556 hasAuthorship W1997195556A5004219222 @default.
• W1997195556 hasAuthorship W1997195556A5022550984 @default.
• W1997195556 hasAuthorship W1997195556A5029382158 @default.
• W1997195556 hasAuthorship W1997195556A5040206715 @default.
• W1997195556 hasAuthorship W1997195556A5054698530 @default.
• W1997195556 hasAuthorship W1997195556A5063747611 @default.
• W1997195556 hasAuthorship W1997195556A5065683887 @default.
• W1997195556 hasAuthorship W1997195556A5068281952 @default.
• W1997195556 hasAuthorship W1997195556A5075839695 @default.
• W1997195556 hasAuthorship W1997195556A5077265250 @default.
• W1997195556 hasBestOaLocation W19971955561 @default.
• W1997195556 hasConcept C113217602 @default.
• W1997195556 hasConcept C12554922 @default.
• W1997195556 hasConcept C126322002 @default.
• W1997195556 hasConcept C139719470 @default.
• W1997195556 hasConcept C162324750 @default.
• W1997195556 hasConcept C164705383 @default.
• W1997195556 hasConcept C170493617 @default.
• W1997195556 hasConcept C185592680 @default.
• W1997195556 hasConcept C190712762 @default.
• W1997195556 hasConcept C207200792 @default.
• W1997195556 hasConcept C2777042071 @default.
• W1997195556 hasConcept C28328180 @default.
• W1997195556 hasConcept C3017732790 @default.
• W1997195556 hasConcept C3018686881 @default.
• W1997195556 hasConcept C40465926 @default.
• W1997195556 hasConcept C519063684 @default.

• next