FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1997204703> ?p ?o ?g. }

• W1997204703 endingPage "15786" @default.
• W1997204703 startingPage "15779" @default.
• W1997204703 abstract "Phosphatidylinositol 4,5-biphosphate (PtdIns(4,5)P2), an important element in eukaryotic signal transduction, is synthesized either by phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5K) from phosphatidylinositol 4-phosphate (PtdIns(4)P) or by phosphatidylinositol-5-phosphate 4-kinase (PtdIns(5)P 4K) from phosphatidylinositol 5-phosphate (PtdIns(5)P). Two Saccharomyces cerevisiae genes, MSS4 and FAB1, are homologous to mammalian PtdIns(4)P 5Ks and PtdIns(5)P 4Ks. We show here that MSS4 is a functional homolog of mammalian PtdIns(4)P 5K but not of PtdIns(5)P 4K in vivo. We constructed a hemagglutinin epitope-tagged form of Mss4p and found that Mss4p has PtdIns(4)P 5K activity. Immunofluorescent and fractionation studies of the epitope-tagged Mss4p suggest that Mss4p is localized on the plasma membrane, whereas Fab1p is reportedly localized on the vacuolar membrane. A temperature-sensitive mss4-1 mutant was isolated, and its phenotypes at restrictive temperatures were found to include increased cell size, round shape, random distribution of actin patches, and delocalized staining of cell wall chitin. Thus, biochemical and genetic analyses on Mss4p indicated that yeast PtdIns(4)P 5K localized on the plasma membrane is required for actin organization. Phosphatidylinositol 4,5-biphosphate (PtdIns(4,5)P2), an important element in eukaryotic signal transduction, is synthesized either by phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5K) from phosphatidylinositol 4-phosphate (PtdIns(4)P) or by phosphatidylinositol-5-phosphate 4-kinase (PtdIns(5)P 4K) from phosphatidylinositol 5-phosphate (PtdIns(5)P). Two Saccharomyces cerevisiae genes, MSS4 and FAB1, are homologous to mammalian PtdIns(4)P 5Ks and PtdIns(5)P 4Ks. We show here that MSS4 is a functional homolog of mammalian PtdIns(4)P 5K but not of PtdIns(5)P 4K in vivo. We constructed a hemagglutinin epitope-tagged form of Mss4p and found that Mss4p has PtdIns(4)P 5K activity. Immunofluorescent and fractionation studies of the epitope-tagged Mss4p suggest that Mss4p is localized on the plasma membrane, whereas Fab1p is reportedly localized on the vacuolar membrane. A temperature-sensitive mss4-1 mutant was isolated, and its phenotypes at restrictive temperatures were found to include increased cell size, round shape, random distribution of actin patches, and delocalized staining of cell wall chitin. Thus, biochemical and genetic analyses on Mss4p indicated that yeast PtdIns(4)P 5K localized on the plasma membrane is required for actin organization. Phosphatidylinositol 4,5-biphosphate (PtdIns(4,5)P2) 1The abbreviations used are: PtdIns(4,5)P2, phosphatidylinositol 4,5-biphosphate; PtdIns(4)P 5K, phosphatidylinositol-4-phosphate 5-kinase; IP3, inositol 1,4,5-triphosphate; PLD, phospholipase D; PIPK, phosphatidylinositol phosphokinase; FOA, 5-fluoroorotic acid; kb, kilobase(s); anti-HA, anti-hemagglutinin. has been recognized as an important element in eukaryotic signal transduction. Hydrolysis of PtdIns(4,5)P2 by phospholipase C produces two second messengers, inositol 1,4,5-triphosphate (IP3) and diacylglycerol. IP3 mobilizes Ca2+ from intracellular stores, such as the endoplasmic reticulum in animal cells (1Berridge M.J. Irvine R.F. Nature. 1984; 312: 315-321Crossref PubMed Scopus (4254) Google Scholar) and vacuoles in plants (2Schumaker K.S. Sze H. J. Biol. Chem. 1987; 262: 3944-3946Abstract Full Text PDF PubMed Google Scholar) and yeast (3Belde P.J.M. Vossen J.H. Borst-Pauwels G.W.F.H. Theuvenet A.P.R. FEBS Lett. 1993; 323: 113-118Crossref PubMed Scopus (66) Google Scholar). It is well known that the elevated intracellular Ca2+stimulates a variety of calcium-modulating signaling enzymes, including calmodulin-dependent protein kinases and calcineurin, a type II B phosphoprotein phosphatase (4Clapham D.E. Cell. 1995; 80: 259-268Abstract Full Text PDF PubMed Scopus (2272) Google Scholar). Diacylglycerol, on the other hand, activates the conventional isoforms of protein kinase C, which in turn play a critical role in the regulation of a number of cellular functions in mammalian cells (5Nishizuka Y. Nature. 1988; 334: 661-665Crossref PubMed Scopus (3537) Google Scholar). In the budding yeastSaccharomyces cerevisiae, a protein kinase C-homologous gene (PKC1) was isolated (6Levin D.E. Fields F.O. Kunisawa R. Bishopp J.M. Thorner J. Cell. 1990; 62: 213-224Abstract Full Text PDF PubMed Scopus (312) Google Scholar), whose product was shown to function in cell wall integrity and cell cycle progression (7Levin D.E. Bartlettt-Heubusch E. J. Cell Biol. 1992; 116: 1221-1229Crossref PubMed Scopus (303) Google Scholar, 8Yoshida S. Ikeda E. Uno I. Mitsuzawa H. Mol. Gen. Genet. 1992; 231: 337-344Crossref PubMed Scopus (71) Google Scholar). In vitro studies of Pkc1p, however, indicated that Pkc1p is strongly activated by phosphatidylserine in the presence of Rho1p, but not by diacylglycerol (9Kamada Y. Qadota H. Python C.P. Anraku Y. Ohya Y. Levin D.E. J. Biol. Chem. 1996; 271: 9193-9196Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). The stimulation by phosphatidylserine alone is characteristic of the atypical ζ isoform of protein kinase C, which is stimulated by phosphatidylserine alone. Since the biochemical property of Pkc1p is different from that of the conventional isoforms of mammalian protein kinase C, it remains unclear whether and how diacylglycerol acts as an important second messenger in S. cerevisiae. PtdIns(4,5)P2 is also known to function as a regulator of actin-binding proteins (10Janmey P.A. Annu. Rev. Physiol. 1994; 56: 169-191Crossref PubMed Scopus (475) Google Scholar) such as profilin (11Lassing I. Lindberg U. Nature. 1985; 314: 472-474Crossref PubMed Scopus (639) Google Scholar), gelsolin (12Janmey P.A. Stossel T. Nature. 1987; 325: 362-364Crossref PubMed Scopus (499) Google Scholar), and α-actinin of vertebrates (13Fukami K. Furuhashi K. Inagaki M. Endo T. Hatano S. Takenawa T. Nature. 1992; 359: 150-152Crossref PubMed Scopus (305) Google Scholar). Recently, profilin was reported to be localized both in the plasma membrane and cytosolic fractions inS. cerevisiae, with the membrane association presumably facilitated by its interaction with phosphatidylinositol metabolites (14Ostrander D.B. Gorman J.A. Carman G.M. J. Biol. Chem. 1995; 270: 27045-27050Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Therefore, it is likely that through its regulation of actin-binding proteins, phosphatidylinositol metabolites affect the cytoskeleton in yeast. Moreover, PtdIns(4,5)P2 stimulates GDP to GTP exchange of ADP-ribosylation factor 1 (ARF1) (15Terui T. Kahn R.A. Randazzo P.A. J. Biol. Chem. 1994; 269: 28130-28135Abstract Full Text PDF PubMed Google Scholar). As the GTP-bound form of ARF1 triggers the attachment of the coat proteins (16Donaldson J.G. Cassel D. Kahn R.A. Klausner R.D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6408-6412Crossref PubMed Scopus (380) Google Scholar, 17Donaldson J.G. Finazzi D. Klausner R.D. Nature. 1992; 360: 350-352Crossref PubMed Scopus (596) Google Scholar, 18Helms J.B. Rothman J.E. Nature. 1992; 360: 352-354Crossref PubMed Scopus (585) Google Scholar), PtdIns(4,5)P2 may play a critical role in coat assembly. Interestingly, PtdIns(4,5)P2 was found to work as a cofactor for brain membrane phospholipase D (PLD) (19Liscovitch M. Chalifa V. Pertile P. Chen C.-S. Cantley L.C. J. Biol. Chem. 1994; 269: 21403-21406Abstract Full Text PDF PubMed Google Scholar). These findings led to the proposal that PLD and phosphatidylinositol 4-phosphate 5-kinase (PtdIns(4)P 5-kinase) with their respective products, PtdIns(4,5)P2 and phosphatidic acid, form a positive feedback loop that causes a vesicle fusion with the acceptor membrane (19Liscovitch M. Chalifa V. Pertile P. Chen C.-S. Cantley L.C. J. Biol. Chem. 1994; 269: 21403-21406Abstract Full Text PDF PubMed Google Scholar). Since PtdIns(4,5)P2 as well as phosphatidic acid activates an ARF GTPase-activating protein (20Randazzo P.A. Kahn R.A. J. Biol. Chem. 1994; 269: 10758-10763Abstract Full Text PDF PubMed Google Scholar), they further postulated that the positive feedback loop is halted by the conversion of active ARF-GTP to ARF-GDP. Thus, PtdIns(4,5)P2 may work as a crucial factor in membrane trafficking. Ins(4,5)P2 is synthesized either from PtdIns(4)P by the phosphorylation on the fifth hydroxyl group of themyo-inositol ring or from PtdIns(5)P by the phosphorylation on the fourth hydroxyl group (21Rameh L.E. Tolias K.F. Duckworth B.C. Cantley L.C. Nature. 1997; 390: 192-196Crossref PubMed Scopus (372) Google Scholar). Phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5K) and phosphatidylinositol-5-phosphate 4-kinase (PtdIns(5)P 4K), both of which catalyze PtdIns(4,5)P2synthesis, are functionally different (22Zhang X. Loijens J.C. Boronenkov I.V. Parker G.J. Norris F.A. Chen J. Thum O. Prestwich G.D. Majerus P.W. Anderson R.A. J. Biol. Chem. 1997; 272: 17756-17761Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar) but structurally similar to each other (23Boronenkov I. Anderson R.A. J. Biol. Chem. 1995; 270: 2881-2884Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 24Divecha N. Truong O. Huan J.J. Hinchliffe K.A. Irvine R.F. Biochem. J. 1995; 309: 715-719Crossref PubMed Scopus (73) Google Scholar, 25Ishihara H. Shibasaki Y. Kizuki N. Katagiri H. Yazaki Y. Asano T. Oka Y. J. Biol. Chem. 1996; 271: 23611-23614Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 26Loijens J.C. Anderson R.A. J. Biol. Chem. 1996; 271: 32937-32943Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). Although mammalian PtdIns(5)P 4K was previously known as type II PtdIns(4)P 5K (23Boronenkov I. Anderson R.A. J. Biol. Chem. 1995; 270: 2881-2884Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 24Divecha N. Truong O. Huan J.J. Hinchliffe K.A. Irvine R.F. Biochem. J. 1995; 309: 715-719Crossref PubMed Scopus (73) Google Scholar, 25Ishihara H. Shibasaki Y. Kizuki N. Katagiri H. Yazaki Y. Asano T. Oka Y. J. Biol. Chem. 1996; 271: 23611-23614Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 26Loijens J.C. Anderson R.A. J. Biol. Chem. 1996; 271: 32937-32943Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar), it was reidentified as PtdIns(5)P 4K by careful examination (21Rameh L.E. Tolias K.F. Duckworth B.C. Cantley L.C. Nature. 1997; 390: 192-196Crossref PubMed Scopus (372) Google Scholar). Physiological functions of mammalian PtdIns(5)P 4K and PtdIns(4)P 5K, however, remain to be elucidated. The sequences of mammalian PtdIns(4)P 5K and PtdIns(5)P 4K isoforms have homology to those of two yeast gene products, Fab1p and Mss4p (23Boronenkov I. Anderson R.A. J. Biol. Chem. 1995; 270: 2881-2884Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 24Divecha N. Truong O. Huan J.J. Hinchliffe K.A. Irvine R.F. Biochem. J. 1995; 309: 715-719Crossref PubMed Scopus (73) Google Scholar, 25Ishihara H. Shibasaki Y. Kizuki N. Katagiri H. Yazaki Y. Asano T. Oka Y. J. Biol. Chem. 1996; 271: 23611-23614Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 26Loijens J.C. Anderson R.A. J. Biol. Chem. 1996; 271: 32937-32943Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). Though the FAB1 gene is not essential, the product, localized on the vacuolar membrane, is required for the vacuolar function and morphology (27Yamamoto A. DeWald D.B. Boronenkov I.V. Anderson R.A. Emr S.D. Koshland D. Mol. Biol. Cell. 1995; 6: 525-539Crossref PubMed Scopus (236) Google Scholar). MSS4 was originally identified as a multicopy suppressor of the temperature-sensitive mutation in the STT4 gene (28Yoshida S. Ohya Y. Goebl M. Nakano A. Anraku Y. J. Biol. Chem. 1994; 269: 1166-1171Abstract Full Text PDF PubMed Google Scholar), which encodes an PtdIns 4-kinase, suggesting involvement of Mss4p in PtdIns(4)P metabolism (29Yoshida S. Ohya Y. Nakano A. Anraku Y. Mol. Gen. Genet. 1994; 242: 631-640Crossref PubMed Scopus (77) Google Scholar). Since a deletion of the MSS4 gene is lethal, characterization of conditional-lethal mutants of mss4 is useful for understanding the function of MSS4. We report here that Mss4p has PtdIns(4)P 5K activity in vitro and that expression of murine type Iβ PtdIns(4)P 5K functionally replaces MSS4 in vivo. Unlike Fab1p, Mss4p is located primarily on the plasma membrane. Analyses of a temperature-sensitive mss4mutant revealed that Mss4p is involved in the establishment of cell morphology. The yeast strains used are listed in Table I. The complete and minimal yeast media as well as the sporulation medium and procedures of tetrad analysis were as described (30Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar). YPGS medium contains 2% galactose, 0.1% sucrose, 1% Bacto-yeast extract, and 2% polypepton, whereas YPA medium for pre-sporulation consists of 1% Bacto-yeast extract, 2% polypepton, and 1% potassium acetate (Wako Pure Chemical Industries, Osaka, Japan). Yeast transformation was carried out with lithium acetate (31Ito H. Fukuda Y. Murata K. Kimura A. J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar). Plates containing 0.2% 5-fluoroorotic acid (FOA, Sigma) were used to select yeast cells capable of losing a URA3 marked plasmid. E. colistrains, DH5α (Life Technologies, Inc.) and SCS1 (Stratagene), were used for gene manipulation. DNA sequencing was carried out with an automated DNA sequencer (model 373A, Applied Biosystems, Foster City, CA).Table IStrains used in this studyStrainGenotypeRef.YPH501MATa/Mata ade2/ade2 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura348Rose K. Rudge S.A. Frohman M.A. Morris A.J. Engebrecht J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12151-12155Crossref PubMed Scopus (197) Google ScholarYOC801MATa/Mata ade2/ade2 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3 mss4::HIS3/MSS4This studyYOC802MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 (pYO1962)This studyYOC803MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 (pYO1965)This studyYOC804MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 (pYO1966)This studyYOC806MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 (pYO1960)This studyYOC807MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 ade3::MSS4:LEU2This studyYOC808MATa ade2 leu2 lys2 trp1 ura3 mss4::HIS3 ade3::mss4–1:LEU2This studyYOC823MATα ade2 his3 leu2 lys2 trp1 ura3 mss4::HIS3 (YEpT-3HA:mss4-1)This study Open table in a new tab The plasmids used in this study are described in Table II. Plasmid pYO1953 was cloned from the YEp13 genomic library (32Yoshihisa T. Anraku Y. Biochem. Biophys. Res. Commun. 1989; 163: 908-915Crossref PubMed Scopus (78) Google Scholar). The insertion of the 3.9-kb BamHI-XhoI fragment ofMSS4 into the vector pBluescript SK+ resulted in pYO1956, which was used for the construction of otherMSS4-containing plasmids and as a template for error-prone polymerase chain reaction. pYO1958, which was designed to aidMSS4 gene disruption, mss4::HIS3, was constructed by ligation of the 5.0-kb EcoRI-EcoRI fragment of pYO1956 and the 1.3-kb BamHI-XhoI fragment of pJJ215 containing the HIS3 gene. pYO1959, pYO1960, and pYO1962 were made by inserting the 3.9-kbBamHI-XhoI fragment of pYO1956 containingMSS4 into the BamHI-XhoI gap of pRS315, pRS314, and pRS316, respectively. pYO1964 was formed by replacing the 1.2-kb NdeI-KpnI fragment of pYO1960 with the NdeI-KpnI linker, which was made by annealing the oligomers TATGTGAGATCTGGTAC and CAGATCTCACA. The murine PtdIns(4)P 5K type Iβ and human PtdIns(5)P 4K genes were obtained by polymerase chain reaction using the published sequences (25Ishihara H. Shibasaki Y. Kizuki N. Katagiri H. Yazaki Y. Asano T. Oka Y. J. Biol. Chem. 1996; 271: 23611-23614Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 23Boronenkov I. Anderson R.A. J. Biol. Chem. 1995; 270: 2881-2884Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar) with the BamHI and BclI restriction sites, respectively, attached at both ends.Table IIPlasmids used in this studyPlasmidParent plasmidMarkersRef.pJJ215pUC18HIS3(49Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Crossref PubMed Scopus (327) Google Scholar)pRS314CEN6, ARSH4, TRP1, f1 origin(50Sikorski R.S. Hieter P. Genetics. 1989; 112: 19-27Google Scholar)pRS315CEN6, ARSH4, LEU2, f1 origin(50Sikorski R.S. Hieter P. Genetics. 1989; 112: 19-27Google Scholar)pRS316CEN6, ARSH4, URA3, f1 origin(50Sikorski R.S. Hieter P. Genetics. 1989; 112: 19-27Google Scholar)pYO324TRP1,2-μ originY. Ohya (unpublished)pYO761pRS314TRP1, CEN, pGAL1H. Qadota and Y. Ohya (unpublished)pYO767pYO324TRP1, 2 μ origin, pGAL1H. Qadota and Y. Ohya (unpublished)pYO885pBluescript KS+ade3::LEU2H. Qadota and Y. Ohya (unpublished)pYO1365pRS314CLS2:3HA(51Takita Y. Ohya Y. Anraku Y. Mol. Gen. Genet. 1995; 246: 269-281Crossref PubMed Scopus (35) Google Scholar)pYO1953YEp135.2-kb genomic DNA fragment containingMSS4This studypYO1956pBluescript SK+3.9-kbBamHI-XhoI fragment of pYO1953This studypYO1958pBluescript SK+mss4::IIIS3This studypYO1959pRS3153.9-kb BamHI-XhoI fragment of pYO1953This studypYO1960pRS3143.9-kbBamHI-XhoI fragment of pYO1953This studypYO1962pRS3163.9-kb BamHI-XhoI fragment of pYO1953This studypYO1964pRS3141.2-kbNdeI-KpnI fragment of pYO1960 was replaced with a linkerThis studypYO1965pRS3143HA:MSS4This studypYO1966pYO3243HA:MSS4This studypYO1970pRS314mss4–1This studypYO1974pYO885ade3:MSS4:LEU2This studypYO1975pYO885ade3:mss4:LEU2This studypYO2116pYO761pGAL1: murine PtdIns(4)P 5K Iβ gene, CENThis studypYO2117pYO761pGAL1: human PtdIns(5)P 4K gene,CENThis studypYO2118pYO767pGAL1: murine PtdIns(4)P 5K Iβ gene, 2-μ originThis studypYO2119pYO767pGAL1: human PtdIns(5)P 4K gene, 2-μ originThis studypYO2141pGAP, CENThis studypYO2142pYO2141pGAP: murine PtdIns(4)P 5K Iβ gene, CENThis studypYO2143pYO2141pGAP: human PtdIns(5)P 4K gene,CENThis studypYO2144pGAP, 2-μ originThis studypYO2145pYO2144pGAP: murine PtdIns(4)P 5K Iβ gene, 2-μ originThis studypYO2146pYO2144pGAP: human PtdIns(5)P 4K gene, 2-μ originThis studyYEp13REP3, LEU2,2-μ origin(52Broach J.R. Strathern J.N. Hicks J.B. Gene (Amst.). 1979; 8: 121-133Crossref PubMed Scopus (672) Google Scholar)Unless otherwise stated, all of the markers in the parent plasmid are present in the plasmid. Open table in a new tab Unless otherwise stated, all of the markers in the parent plasmid are present in the plasmid. The PtdIns(4)P 5K and PtdIns(5)P 4K genes were then inserted to theBglII site of a single-copy plasmid with the GAL1promoter (pYO761) to yield pYO2116 and pYO2117, respectively, and to a multicopy counterpart (pYO767) to produce pYO2118 and pYO2119, respectively. We also inserted the murine and human PIPK genes to theBglII site of a single copy plasmid with the GAPpromoter (pYO2141) to get pYO2142 and pYO2143, respectively. Similar insertions of the PIPK genes to a multicopy plasmid with theGAP promoter (pYO2144) resulted in pYO2145 and pYO2146. We selected and used only those plasmids with the genes whose sequences agreed with the published ones and inserted in the right direction. A 3HA tag was introduced to the N terminus of Mss4p as follows. AnAvrII adaptor was made by annealing the two oligonucleotides, CCGGATCCTAGG and CCGGCCTAGGAT, and was inserted to the AccIII site of pYO1959. After checking the direction of insertion by DNA sequencing, we digested the plasmid withAvrII and ligated it with the NheI-digested 3HA tag of pYO1365. The SphI-XhoI fragment of the resultant plasmid carrying 3HA-tagged MSS4 was inserted to the SphI-XhoI gap of pRS314 and pQR324 to produce plasmids pYO1965 and pYO1966, respectively. Cell lysates were made in RIPA buffer (50 mm Tris-HCl, pH 8.0, 1% Nonidet P-40, 0.15 m NaCl, 5 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, 2 μg/ml aprotinin, and 1 mm sodium orthovanadate) by vortexing six times for 30 s each with acid-washed glass beads (425–600 μm in diameter, Sigma). After preadsorption with protein A cellulofine (Seikagaku-kogyo, Tokyo), the samples (300 μg of protein, assayed by Bio-Rad protein assay kit) were subjected to immunoprecipitation with saturating amounts of 16B12 anti-HA monoclonal antibody (Berkeley Antibody, Richmond, CA) and then adsorbed to protein A cellulofine. The adsorbed immunoprecipitates were then washed four times with RIPA buffer and four times further with buffer T (50 mm Tris-HCl, pH 7.5, 1 mm EDTA, 50 μm ATP, 0.25 m sucrose, and 0.15m NaCl). To determine the PtdIns(4)P 5K activity in the immunoprecipitates, we incubated 10 μl of sample in 50 mmTris-HCl, pH 7.5, 1 mm EGTA, 10 mmMgCl2, 50 μm ATP, 80 μmPtdIns(4)P (Sigma), and 5.0 or 0.5 μCi of [γ-32P]ATP (Amersham Pharmacia Biotech) in the presence or absence of 50 μm phosphatidic acid in a total volume of 50 μl. After 60 min, the reaction was terminated by the addition of 0.4 ml of chloroform/methanol/12 n HCl (100:200:1 by volume). The lipids were extracted by the method of Bligh and Dyer (33Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (43133) Google Scholar), dried, and, together with PtdIns(4,5)P2, which was used as standard, were spotted on Merck Silica gel 60 TLC plates impregnated with 1.2% potassium oxalate, with the exception of the experiment whose result is shown in lanes 4 and 5 of Fig. 1 C, in which a similarly treated Whatman 60A plate was utilized. The samples were separated with the solvent system of chloroform/methanol/acetone/acetic acid/water (42:30:12:12:12 by volume), and [32P]Ins(4,5)P2 was visualized by autoradiography except for the product on the Whatman plate, which was processed by BAS2000 Fuji bioImaging analyzer. We first made an mss4 strain carrying the mutant gene on a centromer plasmid; the 3.1-kb BamHI-XhoI fragment of pYO1958 carrying the mss4::HIS3 gene was used to transform the diploid strain, YPH501. His+transformants were selected, and the disruption of one of the chromosomal MSS4 gene copies was confirmed by Southern hybridization. The MSS4/mss4::HIS3 diploid strain, named YOC801, was transformed with pYO1962 carryingMSS4 and URA3, and the transformants were subjected to tetrad dissection. His+ Ura+ asci were selected and designated YOC802 (mss4::HIS3(pYO1962)). Random mutations were introduced by error-prone polymerase chain reaction mutagenesis (34Cadwell R.C. Joyce G.F. PCR Methods Appl. 1992; 2: 28-33Crossref PubMed Scopus (843) Google Scholar) in the PI(4)P 5-kinase-conserved region ofMSS4 using the two synthetic oligonucleotides, CCTTCTCAAAAGTCAAAGCA and TCGTACTACCGTTCCGGTA, corresponding to bases 841–860 and 2055–2025, respectively. The amplified 1.2-kb fragment was purified, digested with NdeI and KpnI, and then inserted to the NdeI-KpnI gap of pYO1964. Approximately 4,000 independent clones were made, and DNA of the plasmid pool was employed for transformation of YOC802 strain. The transformants that grew on SD-Trp medium at 23 °C were streaked on FOA (−Trp) plates and grown at 23 or 37 °C so that theMSS4-URA3 plasmid is eliminated. Out of 496 transformants that grew in SD-Trp, 15 strains grew on FOA plates at 23 °C but not at 37 °C. Finally, one temperature-sensitive mutation (mss4-1) on plasmid (pYO1970) was further analyzed. The mss4-1 mutation and the wild-type MSS4 gene were integrated into the genome by one-step plasmid integration strategy. We utilized plasmids pYO1974 and pYO1975 digested withSacI and AvrII to transform YOC802 and selected the integrants for the LEU2 marker. After being incubated at 23 °C for 2 days, the cells were streaked on FOA plates and were incubated at 23 °C for 3 days so that theMSS4-URA3 plasmid was eliminated. Single colonies were picked up and were tested for temperature sensitivity. A temperature-sensitive mss4-1 strain was thus obtained and designated YOC808, whereas the MSS4 gene integrated in the same locus was labeled YOC807. Immunofluorescent staining of yeast cells was carried out according to Pringle et al.(35Pringle J.R. Preston R.A. Adams A.E.M. Stearns T. Drubin D.G. Haarer B.K. Jones E.W. Methods Cell Biol. 1989; 31: 357-435Crossref PubMed Scopus (436) Google Scholar). Cells were grown to early exponential phase at 30 °C in YPD medium. HA-tagged Mss4p was visualized by indirect immunofluorescence using 16B12 anti-HA mouse monoclonal antibody as the first antibody and an fluorescein isothiocyanate-conjugated goat anti-mouse IgG (Wako Pure Chemical Industries, Osaka, Japan) as the second antibody. DNA, actin, and chitin were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride, rhodamine-phalloidin (Molecular Probes), and calcofluor white M2R new (Sigma), respectively. Cell morphology and fluorescent staining were observed and photographed using a BX60 microscope (Olympus, Tokyo). Cell fractionation experiments were performed using the previously described techniques (36Ohya Y. Caplin B.E. Qadota H. Tibbetts M.F. Anraku Y. Pringle J.R. Marshall M.S. Mol. Gen. Genet. 1996; 252: 1-10Crossref PubMed Scopus (13) Google Scholar). A BLAST search of protein sequence data bases revealed that yeast Mss4p has 36, 33, and 31% identity with murine type Iα, type Iβ PtdIns(4)P 5K, and human PtdIns(5)P 4K, respectively, in agreement with previous reports. To examine whether Mss4p is a functional homolog of any of the mammalian phosphatidylinositol phosphokinases (PIPKs) in yeast, we constructed plasmids carrying the genes encoding murine type Iβ PtdIns(4)P 5K and human PtdIns(5)P 4K hooked up to either the constitutive GAP promoter or the galactose-inducible GAL1 promoter. After these expression plasmids were introduced to YOC802 strain carryingmss4::HIS3 and a URA3-MSS4 plasmid, the growth on FOA plates was examined. We found that all the transformants expressing the type Iβ PtdIns(4)P 5K gene were capable of growing on FOA plates (Fig. 1 A,panels b and c). On the other hand, expression of the PtdIns(5)P 4K gene failed to complement the MSS4 gene disruption, irrespective of copy number or the promoters used (Fig. 1 A, panels b and c). We next made a temperature-sensitive MSS4 mutant and tested the suppression of the temperature sensitivity by mammalian PIPKs. Mutations were introduced into the conserved region for PIPK within theMSS4 gene, and one of the mutants that grew at 23 °C but not at 37.5 °C (mss4-1) was studied (see “Materials and Methods”). The temperature-sensitive mss4-1 strain was transformed with plasmids containing the two mammalian PIPK genes under the control of the two different promoters to test if the temperature sensitivity is suppressed. When murine type Iβ PtdIns(4)P 5K was expressed under the GAL1 promoter on either the single copy or multicopy plasmid, the strain grew on a galactose-containing plate at the restrictive temperature (Fig. 1 A, panels eand f). On a glucose-containing plate on which the expression of type Iβ PtdIns(4)P 5K under the GAL1promoter is reduced, however, suppression of mss4-1 was observed only with the multicopy plasmid, indicating the failure of suppression when expression is greatly reduced. When the same gene was placed on plasmids under the GAP promoter, the plasmid-harboring strains grew at the restrictive temperature irrespective of the copy number (Fig. 1 A, panels e and f). Murine type Iβ PtdIns(4)P 5K therefore suppresses the temperature sensitivity of mss4-1. In contrast, human PtdIns(5)P 4K failed to suppress the temperature sensitivity in any of the combinations of the plasmids and the promoters tested. Therefore, the functional complementation analysis with the deletion and the temperature-sensitive mutations ofmss4 suggest that MSS4 encodes PtdIns(4)P 5K. To analyze the Mss4p functions, we inserted the 3HA-epitope tag at the N-terminal of Mss4p. Introduction of the 3HA-epitope tag preserves its essential function because the tagged MSS4 with a single copy plasmid can fully complement mss4::HIS3 at all the temperatures examined (23, 30, and 37 °C). These results indicate that the 3HA-tagged Mss4p is functional in vivo. Western blotting analysis of the cells expressing the tagged Mss4p has shown that the anti-HA monoclonal antibody recognized a single band with a molecular mass of 86 kDa, which matched the predicted molecular weight of Mss4p (data not shown). To examine PtdIns(4)P 5K activity of the MSS4gene product, we immunoprecipitated the 3HA-tagged MSS4protein expressed in yeast with the anti-HA monoclonal antibody and determined the kinase activity in the immunoprecipitate (Fig. 1 B). The immunoprecipitate from the YOC804 cells carrying the tagged MSS4 gene on a multicopy plasmid had the highest PtdIns(4)P 5K activity, followed by that from the YOC803 cells, which harbored the same gene on a single copy plasmid, whereas that from the cells with untagged Mss4p (YOC806) exhibited little activity. Furthermore, the PtdIns(4)P 5K activity in the immunoprecipitates was found to be stimulated by the addition of 50 μmphosphatidic acid (Fig. 1 B), a characteristic property of PtdIns(4)P 5K but not of PtdIns(5)P 4K (37Jenkins G.H. Fisette P.L. Anderson R.A. J. Biol. Chem. 1993; 269: 11547-11554Abstract Full Text PDF Google Scholar). These results demonstrate that the tagged Mss4p possesses PtdIns(4)P 5K activity and that the amount of the kinase activity is copy number-dependent. We examined whether the PtdIns(4)P 5K activity of the mss4-1 mutant changes at the restrictive temperature. We first made a strain with the MSS4 gene disrupted but harboring a 3HA-tagged mss4-1 gene on a multicopy plasmid and designated it YOC823. The strain was cultured at 23 °C, was transferred to 38 °C at early exponential growth phase, and was further cultivated for 0, 2, 4, 6, or 8 h before being harvested. The" @default.
• W1997204703 created "2016-06-24" @default.
• W1997204703 creator A5019230318 @default.
• W1997204703 creator A5034075082 @default.
• W1997204703 creator A5042371488 @default.
• W1997204703 creator A5051115252 @default.
• W1997204703 creator A5051850457 @default.
• W1997204703 creator A5060486921 @default.
• W1997204703 creator A5071962035 @default.
• W1997204703 date "1998-06-01" @default.
• W1997204703 modified "2023-10-17" @default.
• W1997204703 title "Phosphatidylinositol-4-phosphate 5-Kinase Localized on the Plasma Membrane Is Essential for Yeast Cell Morphogenesis" @default.
• W1997204703 cites W1486424890 @default.
• W1997204703 cites W1508167890 @default.
• W1997204703 cites W1540989796 @default.
• W1997204703 cites W1567005075 @default.
• W1997204703 cites W1596168632 @default.
• W1997204703 cites W1695245462 @default.
• W1997204703 cites W1916002325 @default.
• W1997204703 cites W1963676316 @default.
• W1997204703 cites W1970705112 @default.
• W1997204703 cites W1973782344 @default.
• W1997204703 cites W1976302801 @default.
• W1997204703 cites W1976731691 @default.
• W1997204703 cites W1992274725 @default.
• W1997204703 cites W1993282564 @default.
• W1997204703 cites W2007898433 @default.
• W1997204703 cites W2008597859 @default.
• W1997204703 cites W2009671832 @default.
• W1997204703 cites W2014715442 @default.
• W1997204703 cites W2022538712 @default.
• W1997204703 cites W2038792215 @default.
• W1997204703 cites W2040264973 @default.
• W1997204703 cites W2043769210 @default.
• W1997204703 cites W2050611086 @default.
• W1997204703 cites W2050759207 @default.
• W1997204703 cites W2051109754 @default.
• W1997204703 cites W2060649120 @default.
• W1997204703 cites W2064700155 @default.
• W1997204703 cites W2064787601 @default.
• W1997204703 cites W2068432705 @default.
• W1997204703 cites W2068877244 @default.
• W1997204703 cites W2075171680 @default.
• W1997204703 cites W2076606604 @default.
• W1997204703 cites W2080229333 @default.
• W1997204703 cites W2090306001 @default.
• W1997204703 cites W2092000023 @default.
• W1997204703 cites W2106012226 @default.
• W1997204703 cites W2107937825 @default.
• W1997204703 cites W2111444829 @default.
• W1997204703 cites W2114934533 @default.
• W1997204703 cites W2130099579 @default.
• W1997204703 cites W2135636849 @default.
• W1997204703 cites W2145512303 @default.
• W1997204703 cites W2152125010 @default.
• W1997204703 cites W2155246792 @default.
• W1997204703 cites W2169333620 @default.
• W1997204703 cites W2300552860 @default.
• W1997204703 cites W2335987214 @default.
• W1997204703 cites W2407898412 @default.
• W1997204703 cites W2436036140 @default.
• W1997204703 cites W4249424055 @default.
• W1997204703 cites W59209658 @default.
• W1997204703 doi "https://doi.org/10.1074/jbc.273.25.15779" @default.
• W1997204703 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9624177" @default.
• W1997204703 hasPublicationYear "1998" @default.
• W1997204703 type Work @default.
• W1997204703 sameAs 1997204703 @default.
• W1997204703 citedByCount "159" @default.
• W1997204703 countsByYear W19972047032012 @default.
• W1997204703 countsByYear W19972047032013 @default.
• W1997204703 countsByYear W19972047032014 @default.
• W1997204703 countsByYear W19972047032015 @default.
• W1997204703 countsByYear W19972047032016 @default.
• W1997204703 countsByYear W19972047032017 @default.
• W1997204703 countsByYear W19972047032018 @default.
• W1997204703 countsByYear W19972047032019 @default.
• W1997204703 countsByYear W19972047032020 @default.
• W1997204703 countsByYear W19972047032021 @default.
• W1997204703 countsByYear W19972047032022 @default.
• W1997204703 countsByYear W19972047032023 @default.
• W1997204703 crossrefType "journal-article" @default.
• W1997204703 hasAuthorship W1997204703A5019230318 @default.
• W1997204703 hasAuthorship W1997204703A5034075082 @default.
• W1997204703 hasAuthorship W1997204703A5042371488 @default.
• W1997204703 hasAuthorship W1997204703A5051115252 @default.
• W1997204703 hasAuthorship W1997204703A5051850457 @default.
• W1997204703 hasAuthorship W1997204703A5060486921 @default.
• W1997204703 hasAuthorship W1997204703A5071962035 @default.
• W1997204703 hasBestOaLocation W19972047031 @default.
• W1997204703 hasConcept C104317684 @default.
• W1997204703 hasConcept C1491633281 @default.
• W1997204703 hasConcept C184235292 @default.
• W1997204703 hasConcept C185592680 @default.
• W1997204703 hasConcept C2778106830 @default.
• W1997204703 hasConcept C2779222958 @default.
• W1997204703 hasConcept C2780610907 @default.
• W1997204703 hasConcept C40692019 @default.

• next