FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1997364024> ?p ?o ?g. }

• W1997364024 endingPage "25508" @default.
• W1997364024 startingPage "25501" @default.
• W1997364024 abstract "Bone senses and adapts to meet mechanical needs by means of an extensive mechanotransduction network comprising osteocytes (former osteoblasts entrapped in mineral) and their cytoplasmic projections through which osteocytes communicate with osteoblasts and osteoclasts on the bone surface. Mechanical stimulation promotes osteocyte (and osteoblast) survival by activating the extracellular signal-regulated kinases, ERKs. Estrogens have similar effects and, intriguingly, the adaptive response of bone to mechanical forces is defective in mice lacking estrogen receptor (ER) α or ERβ. We report that ERKs are not activated by stretching in osteocytic and osteoblastic cells in which both ERα and ERβ have been knocked out or knocked down and this is reversed partially by transfection of either one of the two human ERs and fully by transfection of both receptors. ERK activation in response to stretching is also recovered by transfecting the ligand-binding domain (E) of either receptor or an ERα mutant that does not bind estrogens. Furthermore, mechano-responsiveness is restored by transfecting the Eα targeted to the plasma membrane, but not to the nucleus, whereas ERα mutants with impaired plasma membrane localization or binding to caveolin-1 fail to confer ERK activation in response to stretching. Lastly, the ER antagonist ICI 182,780 abrogates ERK activation and the anti-apoptotic effect of mechanical stimulation. We conclude that in addition to their role as ligand-dependent mediators of the effects of estrogens, the ERs participate in the transduction of mechanical forces into pro-survival signaling in bone cells, albeit in a ligand-independent manner. Bone senses and adapts to meet mechanical needs by means of an extensive mechanotransduction network comprising osteocytes (former osteoblasts entrapped in mineral) and their cytoplasmic projections through which osteocytes communicate with osteoblasts and osteoclasts on the bone surface. Mechanical stimulation promotes osteocyte (and osteoblast) survival by activating the extracellular signal-regulated kinases, ERKs. Estrogens have similar effects and, intriguingly, the adaptive response of bone to mechanical forces is defective in mice lacking estrogen receptor (ER) α or ERβ. We report that ERKs are not activated by stretching in osteocytic and osteoblastic cells in which both ERα and ERβ have been knocked out or knocked down and this is reversed partially by transfection of either one of the two human ERs and fully by transfection of both receptors. ERK activation in response to stretching is also recovered by transfecting the ligand-binding domain (E) of either receptor or an ERα mutant that does not bind estrogens. Furthermore, mechano-responsiveness is restored by transfecting the Eα targeted to the plasma membrane, but not to the nucleus, whereas ERα mutants with impaired plasma membrane localization or binding to caveolin-1 fail to confer ERK activation in response to stretching. Lastly, the ER antagonist ICI 182,780 abrogates ERK activation and the anti-apoptotic effect of mechanical stimulation. We conclude that in addition to their role as ligand-dependent mediators of the effects of estrogens, the ERs participate in the transduction of mechanical forces into pro-survival signaling in bone cells, albeit in a ligand-independent manner. That the skeleton adapts to meet mechanical needs was first recognized by Wolff (1Wolff J. The Law of Bone Remodeling. Springer-Verlag, Berlin1892Google Scholar) and later expanded by Frost (2Frost H.M. Bone Miner. 1987; 2: 73-85PubMed Google Scholar) in the mechanostat hypothesis. Bone adjusts to load by changing its mass, shape, or microarchitecture (3Martin R.B. Burr D.B. Sharkey N.A. Martin R.B. Burr D.B. Sharkey N.A. Skeletal Tissue Mechanics. 1st Ed. Springer-Verlag, New York1998Crossref Google Scholar, 4Aarden E.M. Burger E.H. Nijweide P.J. J. Cell. Biochem. 1994; 55: 287-299Crossref PubMed Scopus (292) Google Scholar), and it responds differently depending on the magnitude of strain. Whereas insufficient or excessive levels of strain induce bone resorption, physiological levels of strain maintain bone mass (5Martin R.B. Bone. 2000; 26: 1-6Crossref PubMed Scopus (233) Google Scholar). Osteocytes (former osteoblasts buried in the mineral) are thought to be the cells acting as mechanosensors. Osteoblasts and osteoclasts, the executive cells for bone formation and resorption, are present on bone for relatively short periods and occur in low number and only in locations that undergo remodeling at a given time point, which represent ∼10% of the bone surface. On the other hand, osteocytes are by far the most abundant resident cells and are present throughout the entire bone tissue. Importantly, osteocytes are the core of a functional syncytium that extends from the mineralized bone matrix to the bone surface and the bone marrow, all the way to the blood vessels. This strategic location permits the detection of variations in the level of strain as well as the dispersion of the signals leading to adaptive responses. Through such network, osteocytes might continually compare present mechanical strains to usual levels of strain (the “set point” of the mechanostat) and send signals to osteoblasts or osteoclasts that result in bone gain or loss, as needed (4Aarden E.M. Burger E.H. Nijweide P.J. J. Cell. Biochem. 1994; 55: 287-299Crossref PubMed Scopus (292) Google Scholar). Changes in osteocyte viability evidently influence the mechanical competence of the skeleton. Indeed, the increased bone fragility resulting from glucocorticoid excess or sex steroid deficiency in animals and humans is associated with increased prevalence of osteocyte apoptosis (7Tomkinson A. Reeve J. Shaw R.W. Noble B.S. J. Clin. Endocrinol. Metab. 1997; 82: 3128-3135Crossref PubMed Scopus (338) Google Scholar, 8Weinstein R.S. Jilka R.L. Parfitt A.M. Manolagas S.C. J. Clin. Investig. 1998; 102: 274-282Crossref PubMed Scopus (1371) Google Scholar, 9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar). Conversely, bisphosphonates, intermittent parathyroid hormone administration, and sex steroids all prevent osteocyte apoptosis, suggesting that preservation of osteocytes contributes to the anti-fracture efficacy of these agents that is disproportional to their effects on bone mass (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar, 10Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (767) Google Scholar, 11Jilka R.L. Weinstein R.S. Bellido T. Roberson P. Parfitt A.M. Manolagas S.C. J. Clin. Investig. 1999; 104: 439-446Crossref PubMed Scopus (877) Google Scholar). Moreover, blockade of glucocorticoid action on osteocytes in a transgenic mouse model preserved bone strength despite loss of bone mass, directly demonstrating that osteocyte viability is indeed an independent determinant of bone strength (12O'Brien C.A. Jia D. Plotkin L.I. Bellido T. Powers C.C. Stewart S.A. Manolagas S.C. Weinstein R.S. Endocrinology. 2004; 145: 1835-1841Crossref PubMed Scopus (615) Google Scholar). The life span of osteocytes is greatly influenced by mechanical forces. Indeed, lack of mechanical loading promotes osteocyte apoptosis, whereas mechanical stimulation maintains osteocyte (and osteoblast) viability (13Aguirre J.I. Plotkin L.I. Stewart S.A. Weinstein R.S. Parfitt A.M. Manolagas S.C. Bellido T. J. Bone Miner. Res. 2006; 21: 605-615Crossref PubMed Scopus (370) Google Scholar, 14Dufour C. Holy X. Marie P.J. Exp. Cell Res. 2007; 313: 394-403Crossref PubMed Scopus (64) Google Scholar, 15Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289: C633-C643Crossref PubMed Scopus (212) Google Scholar, 16Bakker A. Klein-Nulend J. Burger E. Biochem. Biophys. Res. Commun. 2004; 320: 1163-1168Crossref PubMed Scopus (137) Google Scholar). We have recently shown that the anti-apoptotic effect of mechanical stimulation requires integrin signaling as well as intact caveolae and the kinase activity of Src and focal adhesion kinase and downstream phosphorylation and nuclear translocation of the extracellular signal-regulated kinases (ERKs) 4The abbreviations used are:ERKextracellular signal-regulated kinaseERestrogen receptorhERhuman EREligand-binding domain of the ERGFPgreen fluorescent proteinEGFepidermal growth factorIGFinsulin-like growth factorEα nucE from the ERα targeted to the nucleusEα memE from the ERα targeted to the cell membraneRFPred fluorescent proteinARandrogen receptorMEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseANOVAanalysis of variance. 4The abbreviations used are:ERKextracellular signal-regulated kinaseERestrogen receptorhERhuman EREligand-binding domain of the ERGFPgreen fluorescent proteinEGFepidermal growth factorIGFinsulin-like growth factorEα nucE from the ERα targeted to the nucleusEα memE from the ERα targeted to the cell membraneRFPred fluorescent proteinARandrogen receptorMEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseANOVAanalysis of variance. (15Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289: C633-C643Crossref PubMed Scopus (212) Google Scholar). In addition to the kinase domain of Src, the Src homology 2 domain is necessary for the anti-apoptotic effect of stretching (15Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289: C633-C643Crossref PubMed Scopus (212) Google Scholar). This evidence strongly suggests that the scaffolding properties of caveolin-1 and Src interaction with other proteins might be crucial for the formation of a pro-survival signalsome in osteocytes. extracellular signal-regulated kinase estrogen receptor human ER ligand-binding domain of the ER green fluorescent protein epidermal growth factor insulin-like growth factor E from the ERα targeted to the nucleus E from the ERα targeted to the cell membrane red fluorescent protein androgen receptor mitogen-activated protein kinase/extracellular signal-regulated kinase kinase analysis of variance. extracellular signal-regulated kinase estrogen receptor human ER ligand-binding domain of the ER green fluorescent protein epidermal growth factor insulin-like growth factor E from the ERα targeted to the nucleus E from the ERα targeted to the cell membrane red fluorescent protein androgen receptor mitogen-activated protein kinase/extracellular signal-regulated kinase kinase analysis of variance. Estrogen receptor (ER) α interacts with the Src homology 2 domain of Src (17Migliaccio A. Castoria G. Di Domenico M. de Falco A. Bilancio A. Lombardi M. Barone M.V. Ametrano D. Zannini M.S. Abbondanza C. Auricchio F. EMBO J. 2000; 19: 5406-5417Crossref PubMed Google Scholar) and also binds to caveolin-1 (18Schlegel A. Wang C. Pestell R.G. Lisanti M.P. Biochem. J. 2001; 359: 203-210Crossref PubMed Scopus (65) Google Scholar, 19Schlegel A. Wang C. Katzenellenbogen B.S. Pestell R.G. Lisanti M.P. J. Biol. Chem. 1999; 274: 33551-33556Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Moreover, mice lacking ERα or ERβ exhibit a poor osteogenic response to bone loading (20Lee K. Jessop H. Suswillo R. Zaman G. Lanyon L. Nature. 2003; 424: 389Crossref PubMed Scopus (285) Google Scholar, 21Lee K.C. Jessop H. Suswillo R. Zaman G. Lanyon L.E. J. Endocrinol. 2004; 182: 193-201Crossref PubMed Scopus (100) Google Scholar). Based on these lines of evidence, we have investigated herein the participation of the ERs in mechanotransduction in osteocytes and osteoblasts. We report that cells lacking ERα and ERβ are unresponsive to mechanical stimulation and that both ERα as well as ERβ rescue ERK activation in response to stretching. In addition, the ligand-binding domain (E) of either receptor is sufficient to confer responsiveness to mechanical stimuli, albeit in a ligand-independent fashion. Furthermore, both plasma membrane localization of ERα and its interaction with caveolin-1 are required for stretching-induced ERK activation and anti-apoptosis. These findings reveal a novel function of the membrane-associated ERs that is independent of the ligand and is essential for the transduction of mechanical forces into intracellular survival signaling in osteocytes and osteoblasts. Moreover, our findings suggest a mechanism by which bone adaptation could be modulated by changes in the molecular makeup of osteocytes. Cells—MLO-Y4 osteocytic cells and MLO-Y4 cells stably expressing green fluorescent protein (GFP) targeted to the nucleus (MLO-GFP) were obtained and cultured as previously described (10Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (767) Google Scholar, 22Kato Y. Windle J.J. Koop B.A. Mundy G.R. Bonewald L.F. J. Bone Miner. Res. 1997; 12: 2014-2023Crossref PubMed Scopus (416) Google Scholar). Osteoblastic cells were obtained from calvaria of wild type or ERα- and ERβ-deficient mice (ERαβ-/-) (23Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development. 2000; 127: 4277-4291Crossref PubMed Google Scholar) and cultured as previously described (24Jilka R.L. Weinstein R.S. Takahashi K. Parfitt A.M. Manolagas S.C. J. Clin. Investig. 1996; 97: 1732-1740Crossref PubMed Scopus (295) Google Scholar). Plasmids—Vector pBlueScript (pBSC) II was purchased from Stratagene (La Jolla, CA). Wild type human (h) ERα and hERα L525A were provided by B. Katzenellenbogen (University of Illinois at Urbana-Champaign, Urbana, IL) (25Kraus W.L. McInerney E.M. Katzenellenbogen B.S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12314-12318Crossref PubMed Scopus (181) Google Scholar, 26Ekena K. Weis K.E. Katzenellenbogen J.A. Katzenellenbogen B.S. J. Biol. Chem. 1996; 271: 20053-20059Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The constructs containing the ligand-binding domain of ERα (Eα) fused to cyan fluorescent protein and targeted to the nucleus (Eα nuc) or to the cell membrane (Eα mem) were previously described (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar). Wild type hERβ was provided by T. C. Spelsberg (Mayo Clinic College of Medicine, Rochester, MN) (27Monroe D.G. Johnsen S.A. Subramaniam M. Getz B.J. Khosla S. Riggs B.L. Spelsberg T.C. J. Endocrinol. 2003; 176: 349-357Crossref PubMed Scopus (45) Google Scholar). The ligand-binding domain of ERβ (Eβ) was generated by PCR amplification of the wild type hERβ, using the following primer pair, 5′-CAAGGTCGACAAAATGGAGTTGGTACAC-3′ and 5′-GCGGGATCCTTAAAGCACGTGGGCATTC-3′. PCR products were digested using SalI and BamHI and inserted into the same sites of the pCMV5 vector as previously published for Eα (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar). Murine ERα and ERβ were provided by D. L. Bodenner (University of Arkansas for Medical Sciences). Murine ERα S522A and human C447A were provided by E. R. Levin (University of California, San Francisco, CA) (28Razandi M. Alton G. Pedram A. Ghonshani S. Webb P. Levin E.R. Mol. Cell. Biol. 2003; 23: 1633-1646Crossref PubMed Scopus (286) Google Scholar) and M. Marino (University of Rome, Italy) (29Acconcia F. Ascenzi P. Bocedi A. Spisni E. Tomasi V. Trentalance A. Visca P. Marino M. Mol. Biol. Cell. 2005; 16: 231-237Crossref PubMed Scopus (377) Google Scholar), respectively. ERK2 fused to GFP (GFP-ERK2) and ERK2 fused to red fluorescent protein (RFP-ERK2) were provided by R. Seger (The Weizmann Institute of Sciences, Rehovot, Israel) (30Rubinfeld H. Hanoch T. Seger R. J. Biol. Chem. 1999; 274: 30349-30352Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) and L. Luttrell (Medical University of South Carolina, Charleston, SC) (31Luttrell L.M. Roudabush F.L. Choy E.W. Miller W.E. Field M.E. Pierce K.L. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2449-2454Crossref PubMed Scopus (686) Google Scholar), respectively. Wild type MEK was provided by N. G. Ahn (University of Colorado, Boulder, CO) (32Mansour S.J. Matten W.T. Hermann A.S. Candia J.M. Rong S. Fukasawa K. Vande Woude G.F. Ahn N.G. Science. 1994; 265: 966-970Crossref PubMed Scopus (1253) Google Scholar). The construct encoding the nuclear red fluorescent protein was previously described (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar, 33Plotkin L.I. Aguirre J.I. Kousteni S. Manolagas S.C. Bellido T. J. Biol. Chem. 2005; 280: 7317-7325Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Knock Down and Rescue of ERα and ERβ Expression—The expression of ERα, ERβ, or the irrelevant protein lamin A/C was knocked down in MLO-Y4 cells using small interfering RNAs. Cells were incubated with Oligofectamine reagent and small interfering RNA oligonucleotides (Dharmacon Research Inc., Lafayette, CO) for 4 h at 37 °C. Two days later, the expression of ERα and/or ERβ was rescued by transient transfections with wild type or mutated receptors along with ERK2-GFP or ERK2-RFP and wild type MEK. Mechanical Stimulation of Cell Cultures—Cells were plated on flexible bottom wells coated with collagen type I. 16–24 h later cells were stretched at 5% elongation for 10 min using different regimens of biaxial stretching (Fig. 1A) in a FX-4000 Flexercell Strain Unit (Flexcell International Corp., Hillsborough, NC). Regimen 1 was performed using 20-s stretching and 0.1-s resting periods. Regimens 2–6 were performed using equal periods of stretching and resting. The frequency for regimens 1 and 2 was 3 cycles/min (equivalent to 0.05 Hz); for regimen 3, 6 cycles/min (0.1 Hz); for regimen 4, 12 cycles/min (0.2 Hz); for regimen 5, 24 cycles/min (0.4 Hz); and for regimen 6, 60 cycles/min (1 Hz). The optimal conditions for ERK activation for each cell type (Fig. 1, B–D) were used in subsequent experiments: regimen 1 for MLO-Y4 cells and regimen 2 for osteoblastic cells. For the experiments using pharmacological inhibitors, cells were treated with 10-7 m ICI 182,780, 10-7 m AG1478, 10-4 m AG538 (Sigma), or 5 × 10-5 m PD98059 (New England Biolabs, Beverly, MA) for 30 min before mechanical stimulation. Western Blot Analysis—Immediately after stretching, cells were lysed and proteins were separated by SDS-polyacrylamide electrophoresis as previously described (15Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289: C633-C643Crossref PubMed Scopus (212) Google Scholar). Immunoblotting was performed using antibodies recognizing phosphorylated or total ERKs, lamin A/C, ERα (Santa Cruz Biotechnology, Santa Cruz, CA), ERβ (Affinity BioReagents, Golden, CO) or β-actin (Sigma), followed by incubation with the corresponding secondary antibody conjugated with horseradish peroxidase (Santa Cruz Biotechnology). Blots were developed by ECL, and the intensity of the bands was quantified by scanning and densitometry using a VersaDoc TM imaging system (Bio-Rad Laboratories). Real-time PCR—RNA was isolated using Ultraspec reagent and treated with DNase (Worthington Biochemical Corp., Lakewood, NJ) to remove contaminating plasmid DNA. Reverse transcription was performed using the High-Capacity cDNA Archive kit (Applied Biosystems). Primers and probes for mERβ (probe, 5′-ACAAAGCCAGGGATTTT-3′, forward primer, GGAACTGGTGCACATGATTGG, reverse primer, GCTTTCCAAGAGGCGGACTT); hERα (probe, 5′-CACAAAGCCTGGCACC-3′, forward primer, CATGATCAACTGGGCGAAGAG, reverse primer, CCTGATCATGGAGGGTCAAATC); hERβ (probe, 5′-CACAAAGCCGGGAAT-3′, forward primer, TGATCAGCTGGGCCAAGAAG, reverse primer, GAGCCGCACTTGGTCGAA); and ChoB (probe, 5′-TCCAGAGCAGGATCC-3′, forward primer, CCCAGGATGGCGACGAT, reverse primer, CCGAATGCTGTAATGGCGTAT) and for mERα (mm00433149_m1) were from Applied Biosystems. The PCR reaction was performed using 20 μl of Gene Expression Assay Mix TaqMan Universal Master Mix containing 80 ng of each cDNA template in triplicates, using an ABI 7300 Real-time PCR system (Applied Biosystems). The -fold change in expression was calculated using the ΔCt or ΔΔCt comparative threshold cycle method. Quantification of Apoptosis—MLO-Y4 cells were stretched for 10 min at 5% elongation using regimen 1 (Fig. 1A) followed by treatment with 6 × 10-5 m etoposide (Sigma) for 9 h. Caspase 3 activity was determined in cell lysates by measuring the degradation of the fluorogenic substrate Ac-DEVD-AFC (Biomol, Plymouth Meeting, PA) as previously reported (10Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (767) Google Scholar). Caspase 3 units/μg protein were calculated using a standard curve prepared with recombinant caspase 3 (Biomol) assayed together with the samples. Apoptosis was also quantified by enumerating MLO-GFP cells exhibiting chromatin condensation and nuclear fragmentation under a fluorescence microscope, as previously published (10Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (767) Google Scholar). Cells were stretched and treated with etoposide for 6 h. At least 250 cells from fields selected by systematic random sampling were examined for each experimental condition. Subcellular Localization of ERK2—MLO-Y4 cells or osteoblastic cells derived from wild type and ERαβ-/- mice were transiently transfected with ERα, ERβ, or the different ER mutants together with GFP-ERK2 or RFP-ERK2 to visualize the subcellular localization of ERKs. Cells were also co-transfected with wild type MEK to anchor inactive ERK2 in the cytoplasm. Twenty-four hours after transfection, cells were incubated with medium without serum for 20 min and stretched for 10 min at 5% elongation or treated for 5 min with 10 ng/ml epidermal growth factor (EGF) (Sigma) or 5 ng/ml insulin-like growth factor-1 (IGF-I) (Genetech, South San Francisco, CA). Cells were immediately fixed. ERK2 nuclear accumulation was quantified in more than 250 cells/condition by enumerating the percentage of cells exhibiting increased GFP or RFP in the nucleus compared with the cytoplasm, as previously reported (33Plotkin L.I. Aguirre J.I. Kousteni S. Manolagas S.C. Bellido T. J. Biol. Chem. 2005; 280: 7317-7325Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Image Acquisition—Fluorescent images were collected on an inverted microscope (Axiovert 200; Carl Zeiss Light Microscopy, Gottingen, Germany) with an LD A-Plan, ×32/0.40 lens and a low light camera (Polaroid DMC Ie; Polaroid Corp., Cambridge, MA), using a filter set for GFP. The acquisition software was Image-Pro Plus (Media Cybernetics, Silver Spring, MD). Statistical Analysis—Data were analyzed by one-way analysis of variance (ANOVA). The Student-Newman-Keuls method was used to estimate the level of significance of differences between means, or by Student's t test. Expression of ERα and ERβ Is Required for Stretching-induced ERK Activation in Osteocytic and Osteoblastic Cells—To establish whether the ERs participate in mechanotransduction, we compared responsiveness to mechanical stimulation of MLO-Y4 osteocytic cells or osteoblastic cells derived from wild type mice to osteoblasts derived from mice lacking both ERα and ERβ (ERαβ-/- osteoblastic cells). To this end, cells grown on flexible bottomed culture plates were subjected to biaxial stretching. Unlike MLO-Y4 or wild type control cells, ERαβ-/- osteoblastic cells did not exhibit ERK phosphorylation in response to mechanical stimulation under various regimens of stretching (Fig. 1). Moreover, stretching did not induce ERK nuclear accumulation in ERαβ-/- cells, as assessed by determining the subcellular localization of a GFP-ERK2 fusion protein by epifluorescence microscopy (Fig. 2, A and B). However, when ERαβ-/- cells were transfected with ERα, ERβ, or both receptors, stretching significantly increased the percentage of cells exhibiting nuclear GFP-ERK2 accumulation. We then proceeded to examine the response to stretching of MLO-Y4 cells in which the expression of ERα, ERβ, or both was knocked down using oligonucleotides specific for each receptor or for the nonessential protein lamin, used as a negative control. Cells transfected with small interfering RNAs for murine ERα or ERβ exhibited significantly reduced expression of the respective receptors compared with cells in which lamin was silenced, as determined by quantitative PCR and by Western blotting (Fig. 3A). Transfection of the human receptors to cells that had been silenced for ERα, ERβ, or both receptors successfully restored receptor expression as indicated by the levels of human ERα or human ERβ, quantified by PCR (Fig. 3B). Stretching induced an increase of ∼100% in the number of cells exhibiting ERK nuclear accumulation when the control protein lamin was silenced (Fig. 3C). In contrast, cells in which ERα or ERβ was silenced exhibited a reduced response to stretching with an increase of only ∼40–60% compared with unstretched cells; full responsiveness to stretching was restored by transfection of the corresponding human receptors. Furthermore, stretching failed to induce ERK nuclear translocation in cells in which both ERα and ERβ were silenced. Whereas transfection of ERα or ERβ partially restored the response, transfection of both receptors conferred full responsiveness to mechanical stimulation. Taken together, these findings demonstrate that the expression of both ERα and ERβ is required for transduction of mechanical stimulation into ERK activation. The Ligand-binding Domain of the ERs Is Sufficient to Mediate Stretching-induced ERK Activation—We have previously shown that the ligand-binding domain (designated E) of ERα is sufficient to mediate the anti-apoptotic effect of estrogens (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar). In agreement with these earlier observations, we found that stretching-induced nuclear ERK accumulation was rescued in cells in which ERα and ERβ were silenced by transfecting the E domain of ERα, the E domain of ERβ, or both E domains (Fig. 4, A and B). However, in contrast to estrogen-induced ERK activation that requires binding of the ligand to the receptor (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar), stretching-induced ERK nuclear accumulation was also rescued by the ERα mutant receptor L525A that does not bind estrogens. These results indicate that the ligand-binding domain of ERα or ERβ is sufficient for the activation of ERKs by stretching and strongly suggest that binding of the ligand is not required. Plasma Membrane Localization of ERα and Its Interaction with Caveolin-1 Are Required for Stretching-induced ERK Activation—We next investigated whether the ability of the E domain of ERα to confer responsiveness to stretching was dependent on its localization to a particular subcellular compartment. The response to stretching in ERα/ERβ-silenced cells was recovered to a similar extent by transfecting the wild type E domain or the E domain targeted to the plasma membrane (Eα mem), but not by the E domain targeted to the nucleus (Eα nuc) (Fig. 4, A and C). Appropriate expression of the Eα mutants was confirmed by epifluorescence microscopy of MLO-Y4 osteocytic cells transfected with the constructs (which are fused to enhanced cyan fluorescent protein) along with nuclear red fluorescent protein to mark the nucleus (Fig. 4D). As we have previously shown in HeLa cells (9Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar), the construct containing the wild type nontargeted E domain was evenly distributed throughout the cell. In contrast, Eα nuc accumulated in the nuclear compartment, whereas Eα mem localized in membranes and was excluded from the nucleus. Consistent with the findings with the targeted E domain constructs, transfection of two different ERα mutants that exhibit decreased localization at the plasma membrane and deficient interaction with caveolin-1 (S522A and C447A) failed to confer ERK activation in response to stretching. Stretching-induced Anti-apoptosis Is Abolished by the ER Antagonist ICI 182,780, but No" @default.
• W1997364024 created "2016-06-24" @default.
• W1997364024 creator A5021299204 @default.
• W1997364024 creator A5027634434 @default.
• W1997364024 creator A5032280425 @default.
• W1997364024 creator A5032860185 @default.
• W1997364024 creator A5051020662 @default.
• W1997364024 creator A5053404897 @default.
• W1997364024 creator A5089412457 @default.
• W1997364024 date "2007-08-01" @default.
• W1997364024 modified "2023-10-11" @default.
• W1997364024 title "A Novel Ligand-independent Function of the Estrogen Receptor Is Essential for Osteocyte and Osteoblast Mechanotransduction" @default.
• W1997364024 cites W1984426954 @default.
• W1997364024 cites W2001521752 @default.
• W1997364024 cites W2002315967 @default.
• W1997364024 cites W2002659263 @default.
• W1997364024 cites W2006985579 @default.
• W1997364024 cites W2007478852 @default.
• W1997364024 cites W2013809140 @default.
• W1997364024 cites W2014107736 @default.
• W1997364024 cites W2014707010 @default.
• W1997364024 cites W2018245449 @default.
• W1997364024 cites W201886038 @default.
• W1997364024 cites W2024916097 @default.
• W1997364024 cites W2027806994 @default.
• W1997364024 cites W2038965450 @default.
• W1997364024 cites W2039223695 @default.
• W1997364024 cites W2043589252 @default.
• W1997364024 cites W2058386105 @default.
• W1997364024 cites W2084766033 @default.
• W1997364024 cites W2085392426 @default.
• W1997364024 cites W2086422627 @default.
• W1997364024 cites W2087137783 @default.
• W1997364024 cites W2098982859 @default.
• W1997364024 cites W2103036353 @default.
• W1997364024 cites W2104293738 @default.
• W1997364024 cites W2105846317 @default.
• W1997364024 cites W2110687233 @default.
• W1997364024 cites W2116751183 @default.
• W1997364024 cites W2120653485 @default.
• W1997364024 cites W2122430182 @default.
• W1997364024 cites W2141369673 @default.
• W1997364024 cites W2143214738 @default.
• W1997364024 cites W2147859244 @default.
• W1997364024 cites W2156753857 @default.
• W1997364024 cites W2160084272 @default.
• W1997364024 cites W2163208284 @default.
• W1997364024 cites W2164576311 @default.
• W1997364024 cites W2167978187 @default.
• W1997364024 cites W2170680219 @default.
• W1997364024 cites W3010765523 @default.
• W1997364024 cites W4242341198 @default.
• W1997364024 doi "https://doi.org/10.1074/jbc.m702231200" @default.
• W1997364024 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17609204" @default.
• W1997364024 hasPublicationYear "2007" @default.
• W1997364024 type Work @default.
• W1997364024 sameAs 1997364024 @default.
• W1997364024 citedByCount "123" @default.
• W1997364024 countsByYear W19973640242012 @default.
• W1997364024 countsByYear W19973640242013 @default.
• W1997364024 countsByYear W19973640242014 @default.
• W1997364024 countsByYear W19973640242015 @default.
• W1997364024 countsByYear W19973640242016 @default.
• W1997364024 countsByYear W19973640242017 @default.
• W1997364024 countsByYear W19973640242018 @default.
• W1997364024 countsByYear W19973640242019 @default.
• W1997364024 countsByYear W19973640242020 @default.
• W1997364024 countsByYear W19973640242021 @default.
• W1997364024 countsByYear W19973640242022 @default.
• W1997364024 countsByYear W19973640242023 @default.
• W1997364024 crossrefType "journal-article" @default.
• W1997364024 hasAuthorship W1997364024A5021299204 @default.
• W1997364024 hasAuthorship W1997364024A5027634434 @default.
• W1997364024 hasAuthorship W1997364024A5032280425 @default.
• W1997364024 hasAuthorship W1997364024A5032860185 @default.
• W1997364024 hasAuthorship W1997364024A5051020662 @default.
• W1997364024 hasAuthorship W1997364024A5053404897 @default.
• W1997364024 hasAuthorship W1997364024A5089412457 @default.
• W1997364024 hasBestOaLocation W19973640241 @default.
• W1997364024 hasConcept C116569031 @default.
• W1997364024 hasConcept C121608353 @default.
• W1997364024 hasConcept C12554922 @default.
• W1997364024 hasConcept C126322002 @default.
• W1997364024 hasConcept C14036430 @default.
• W1997364024 hasConcept C170493617 @default.
• W1997364024 hasConcept C181104049 @default.
• W1997364024 hasConcept C185592680 @default.
• W1997364024 hasConcept C202751555 @default.
• W1997364024 hasConcept C2778260815 @default.
• W1997364024 hasConcept C2780973866 @default.
• W1997364024 hasConcept C530470458 @default.
• W1997364024 hasConcept C55493867 @default.
• W1997364024 hasConcept C71924100 @default.
• W1997364024 hasConcept C84606932 @default.
• W1997364024 hasConcept C86803240 @default.
• W1997364024 hasConcept C95444343 @default.
• W1997364024 hasConceptScore W1997364024C116569031 @default.
• W1997364024 hasConceptScore W1997364024C121608353 @default.

• next