SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1997481684> ?p ?o ?g. }

Showing items 1 to 100 of ±108 with 100 items per page.

W1997481684 endingPage "14682" @default.
W1997481684 startingPage "14677" @default.
W1997481684 abstract "The two-pore domain K+ channel, TRESK (TWIK-related spinal cord K+ channel) is activated in response to the calcium signal by the calcium/calmodulin-dependent protein phosphatase, calcineurin. In the present study we report that calcineurin also interacts with TRESK via an NFAT-like docking site, in addition to its enzymatic action. In its intracellular loop, mouse TRESK possesses the amino acid sequence, PQIVID, which is similar to the calcineurin binding consensus motif, PXIXIT (where X denotes any amino acids), necessary for NFAT (nuclear factor of activated T cells) activation and nuclear translocation. Mutations of the PQIVID sequence of TRESK to PQIVIA, PQIVAD, or PQAVAD increasingly deteriorated the calcium-dependent activation in the listed order and correspondingly reduced the benzocaine sensitivity (a property discriminating activated channels from resting ones), when it was measured after the calcium signal in Xenopus oocytes. Microinjection of VIVIT peptide, designed to inhibit the NFAT-calcineurin interaction specifically, also eliminated TRESK activation. The intracellular loop of TRESK, expressed as a GST fusion protein, bound constitutively active calcineurin in vitro. PQAVAD mutation as well as addition of VIVIT peptide to the reaction abrogated this calcineurin binding. Wild type calcineurin was recruited to GST-TRESK-loop in the presence of calcium and calmodulin. These results indicate that the PQIVID sequence is a docking site for calcineurin, and its occupancy is required for the calcium-dependent regulation of TRESK. Immunosuppressive compounds, developed to target the NFAT binding site of calcineurin, are also expected to interfere with TRESK regulation, in addition to their desired effect on NFAT. The two-pore domain K+ channel, TRESK (TWIK-related spinal cord K+ channel) is activated in response to the calcium signal by the calcium/calmodulin-dependent protein phosphatase, calcineurin. In the present study we report that calcineurin also interacts with TRESK via an NFAT-like docking site, in addition to its enzymatic action. In its intracellular loop, mouse TRESK possesses the amino acid sequence, PQIVID, which is similar to the calcineurin binding consensus motif, PXIXIT (where X denotes any amino acids), necessary for NFAT (nuclear factor of activated T cells) activation and nuclear translocation. Mutations of the PQIVID sequence of TRESK to PQIVIA, PQIVAD, or PQAVAD increasingly deteriorated the calcium-dependent activation in the listed order and correspondingly reduced the benzocaine sensitivity (a property discriminating activated channels from resting ones), when it was measured after the calcium signal in Xenopus oocytes. Microinjection of VIVIT peptide, designed to inhibit the NFAT-calcineurin interaction specifically, also eliminated TRESK activation. The intracellular loop of TRESK, expressed as a GST fusion protein, bound constitutively active calcineurin in vitro. PQAVAD mutation as well as addition of VIVIT peptide to the reaction abrogated this calcineurin binding. Wild type calcineurin was recruited to GST-TRESK-loop in the presence of calcium and calmodulin. These results indicate that the PQIVID sequence is a docking site for calcineurin, and its occupancy is required for the calcium-dependent regulation of TRESK. Immunosuppressive compounds, developed to target the NFAT binding site of calcineurin, are also expected to interfere with TRESK regulation, in addition to their desired effect on NFAT. Two-pore domain potassium (2PK+) 3The abbreviations used are: 2PK+, Two-pore domain potassium channel; NFAT, nuclear factor of activated T cells; TRESK, TWIK-related spinal cord K+ channel; GST, glutathione S-transferase; ANOVA, analysis of variance. channels give rise to background (leak) potassium conductance and their diverse regulatory mechanisms control cellular function by adjusting both the resting membrane potential and excitability (for review, see Refs. 1Kim D. Curr. Pharm. Des. 2005; 11: 2717-2736Crossref PubMed Scopus (122) Google Scholar and 2Talley E.M. Sirois J.E. Lei Q. Bayliss D.A. Neuroscientist. 2003; 9: 46-56Crossref PubMed Scopus (129) Google Scholar). TRESK (TWIK-related spinal cord K+ channel) is uniquely regulated by the calcium signal among the 2PK+ channels. We have recently reported that TRESK, expressed heterologously in Xenopus oocytes, is activated about 10-fold by the calcium/calmodulin-dependent protein phosphatase, calcineurin (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). TRESK was cloned from human spinal cord (4Sano Y. Inamura K. Miyake A. Mochizuki S. Kitada C. Yokoi H. Nozawa K. Okada H. Matsushime H. Furuichi K. J. Biol. Chem. 2003; 278: 27406-27412Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) and mouse cerebellum (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar), and its expression was also demonstrated by reverse transcription-PCR in cerebrum, brainstem, testis, pancreas, and placenta (5Keshavaprasad B. Liu C. Au J.D. Kindler C.H. Cotten J.F. Yost C.S. Anesth. Analg. 2005; 101 (and table of contents): 1042-1049Crossref PubMed Scopus (45) Google Scholar, 6Liu C. Au J.D. Zou H.L. Cotten J.F. Yost C.S. Anesth. Analg. 2004; 99 (and table of contents): 1715-1722Crossref PubMed Scopus (94) Google Scholar, 7Kang D. Mariash E. Kim D. J. Biol. Chem. 2004; 279: 28063-28070Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). A massive signal was detected by Northern blot in rat thymus and spleen (7Kang D. Mariash E. Kim D. J. Biol. Chem. 2004; 279: 28063-28070Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Single channel activity of TRESK has recently been demonstrated in dorsal root ganglion neurons (8Kang D. Kim D. Am. J. Physiol. 2006; (in press)Google Scholar). In the absence of specific antibodies and inhibitors, TRESK has neither been identified at the protein level nor has it been detected as an endogenous whole cell current. However, the robust activation of TRESK by the calcium signal implicates that it can influence substantially the function of the native cells expressing the channel. The calcineurin-mediated regulation suggests that TRESK activation is the target of the widely used immunosuppressive drugs, cyclosporine A and FK506, as it was, in fact, demonstrated in Xenopus oocytes (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). These drugs inhibit calcineurin (and consequently NFAT activation and interleukin-2 production of T lymphocytes) by forming inhibitory complexes with the ubiquitous immunophilin proteins (9Clipstone N.A. Fiorentino D.F. Crabtree G.R. J. Biol. Chem. 1994; 269: 26431-26437Abstract Full Text PDF PubMed Google Scholar, 10Snyder S.H. Sabatini D.M. Nat. Med. 1995; 1: 32-37Crossref PubMed Scopus (174) Google Scholar). However, general inhibition of calcineurin also causes several undesired effects. Therefore, a novel direction of drug development focuses on the NFAT-docking site of calcineurin, which is considered to be a more specific target than the phosphatase activity (11Martinez-Martinez S. Redondo J.M. Curr. Med. Chem. 2004; 11: 997-1007Crossref PubMed Scopus (143) Google Scholar, 12Roehrl M.H. Wang J.Y. Wagner G. Biochemistry. 2004; 43: 16067-16075Crossref PubMed Scopus (38) Google Scholar). The binding of calcineurin to the PXIXIT consensus motif (where X denotes any amino acid) is required for NFAT activation. Apart from NFAT, the only known mammalian proteins possessing similar calcineurin binding sites are calcineurin inhibitors/modulators or anchoring proteins (13Liu J.O. Biochem. Biophys. Res. Commun. 2003; 311: 1103-1109Crossref PubMed Scopus (31) Google Scholar, 14Dodge K.L. Scott J.D. Biochem. Biophys. Res. Commun. 2003; 311: 1111-1115Crossref PubMed Scopus (26) Google Scholar). In the present study we report for the first time that an ion channel, TRESK, has an NFAT-like calcineurin binding consensus sequence and the binding of the phosphatase to this docking site is indispensable for the regulation of the channel. Therefore the inhibitors, designed to block the calcineurin-NFAT interaction specifically, may also interfere with TRESK activation. Materials—VIVIT peptide (NFAT inhibitor) and calcineurin autoinhibitory peptide (ITSFEEAKGLDRINERMPPRRDAMP) were purchased from Calbiochem, bovine calcineurin and calmodulin from Sigma. Enzymes and kits of molecular biology applications and all other chemicals of analytical grade were obtained from the companies listed elsewhere (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). GST-TRESK Loop Fusion Proteins—To produce GST-TRESKloop protein, the cDNA encoding the intracellular loop of mouse TRESK (amino acids 164–292) was PCR-amplified from our pEXO-TRESK plasmid (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar), applying consecutively Loop-s1/Loop-a1 and Loop-s2/Loop-a1 primer combinations (see the sequences and cloning sites in Table 1). The PCR product was ligated into the XhoI site of pGEX-4T-1 (Amersham Biosciences, Little Chalfont, UK). To obtain the longer GST-TRESKloop-TAPtag protein, TRESK loop was amplified with Loop-s1 and Loop-a2 oligonucleotides. The PCR product was cloned into the pcDNA3-TAPtag plasmid (Séraphin Laboratory, EMBL, Heidelberg, Germany). The fused TRESKloop-TAPtag coding region was amplified with the Loop-s2/TAP-a primer combination and ligated into the SalI site of pGEX-6P-3 (Amersham Biosciences). QuikChange™ in vitro site-directed mutagenesis was performed as described previously (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar).TABLE 1Oligonucleotide sequences for PCR and in vitro site-directed mutagenesisPrimerSequence (5′ → 3′)Restriction enzymeLoop-s1CCAGGTACCGCCACCATGGATATCCTGGCCACCATCKpnlLoop-s2CCACTCGAGGCCACCATGGATATCCTGGXholLoop-a1GCGCTCGAGGTCCAGCCTCTCCACCTGXholLoop-a2GCGGAATTCGTCCAGCCTCTCCACCTGEcoRITAP-aCAGCTCGAGTCATTTCGGCGCCTGAGCACXholmCnA-sGCGCTCGAGGAGATATACATATGTCCGAGCCCAAGCGATTGNdelmCnAdel-aGCGCTCGAGCTAGTTTCTGATGACTTCCTTCCGGGXholhCnB-sGCGCTCGAGGAGATATACATATGGGAAATGAGGCAAGTTATCCXholhCnB-aGCGCTCGAGGATCCGAGTCACACATCTACCACCATCBamHIPQIVIA-sCAGATTGTCATTGcaGCTGGTGTGGATGPvullPQIVAD-sCATCCCTCAGATTGTCgccGATGCcGGTGTGGATGAACTCCfr10lPQAVAD-sGAAGCCATCCCTCAGgcTGTCgcTGATGCcGGTGTGGATGAACCfr10l Open table in a new tab The GST-TRESKloop fusion constructs were expressed in BL21 strain of Escherichia coli. Bacteria were sonicated in buffer A, containing in mm: 50 NaCl, 50 KCl, 1 EDTA, 1 PMSF, 0.1 benzamidine, 1 dithiothreitol, 50 Tris-HCl (pH 7.6). The lysate was centrifuged and the GST fusion protein was affinity-purified from the supernatant by glutathione-agarose (Sigma). Recombinant, Constitutively Active Calcineurin—The hexahistidine-tagged constitutively active calcineurin was produced by a modification of the methods reported previously (15Mondragon A. Griffith E.C. Sun L. Xiong F. Armstrong C. Liu J.O. Biochemistry. 1997; 36: 4934-4942Crossref PubMed Scopus (87) Google Scholar). Coding regions of the truncated mouse calcineurin A (α-isoform, amino acid residues 1–398) and human calcineurin B subunits were amplified from pBJ5-CnA-FL and pBJ5-CnB plasmids (16Clipstone N.A. Crabtree G.R. Nature. 1992; 357: 695-697Crossref PubMed Scopus (1476) Google Scholar), applying the mCnA-s/mCnAdel-a and hCnB-s/hCnB-a primer combinations, respectively. The calcineurin A and B products were ligated into the same pET15b vector (Novagen), between the NdeI and BamHI sites. BL21 strain of E. coli was cotransformed with pBB131 (encoding myristoyl-CoA:protein N-myristoyltransferase (17Farazi T.A. Manchester J.K. Gordon J.I. Biochemistry. 2000; 39: 15807-15816Crossref PubMed Scopus (20) Google Scholar, 18Rudnick D.A. McWherter C.A. Adams S.P. Ropson I.J. Duronio R.J. Gordon J.I. J. Biol. Chem. 1990; 265: 13370-13378Abstract Full Text PDF PubMed Google Scholar), for modifying calcineurin B post-translationally) and the bicistronic plasmid encoding calcineurin A and B. Bacteria were grown in LB containing 50 μg/ml kanamycin and 130 μg/ml ampicillin and induced with isopropyl β-d-thiogalactopyranoside (0.5 mm) in the presence of myristic acid (0.24 mm) for 3 h. Bacteria were sonicated in buffer B, containing: 200 NaCl, 2 MgCl2, 1 EGTA, 5.5 β-mercaptoethanol, 30 phosphate (pH 7.8 with NaOH), supplemented with 1 PMSF, 0.2 benzamidine, 5 imidazole (in mm) and 30 soybean trypsin inhibitor (type IIS, Sigma), 16 leupeptin, 11 aprotinin (in μg/ml). The lysate was centrifuged, and the protein was purified from the supernatant by nickel-nitrilotriacetic acid-agarose (Qiagen); after binding for 1 h the resin was washed six times with 14 ml of buffer B, containing 0, 20, and 50 mm imidazole, in the first, second, and third pair of washing steps, respectively. Calcineurin was eluted by 5 × 0.5 ml of 250 mm imidazole in buffer B and dialyzed against 140 mm KCl, 2 mm MgCl2, 1 mm EGTA, 0.1 mm dithiothreitol, 20 mm Tris-HCl (pH 7.3) and stored at –70 °C. GST Pulldown Assay—Ten μl of the 50% resin suspension of the appropriate GST fusion protein was incubated for 1 h with or without full-length bovine calcineurin (1.5 μg), recombinant constitutively active calcineurin (5–10 μg), calmodulin (2.5 μg), VIVIT peptide (200 μm), calcineurin autoinhibitory peptide (200 μm), CaCl2 (0.25 mm), in the presence of 1% Triton X-100. The final volume was adjusted with a buffer containing (in mm): 50 NaCl, 50 KCl and 50 Tris-HCl (pH 7.6) (plus 1 mm EDTA in the reactions containing recombinant calcineurin). The resin was washed twice with 150 μl of assay buffer, also containing 1% Triton X-100 in the first wash, and 0.3 mm CaCl2 if full-length calcineurin was used. The bound proteins were analyzed on 12% polyacrylamide gels stained with Coomassie Brilliant Blue or silver, according to Heukeshoven and Dernick (19Heukeshoven J. Dernick R. Electrophoresis. 1988; 9: 28-32Crossref PubMed Scopus (644) Google Scholar). Handling of Xenopus laevis Oocytes and Two-electrode Voltage Clamp Measurements—The oocytes were prepared, the cRNA was synthesized, and microinjected and two-electrode voltage clamp measurements were performed as described previously (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The low [K+] solution contained (in mm): 95.4 NaCl, 2 KCl, 1.8 CaCl2, 5 HEPES (pH 7.5 with NaOH). The high [K+] solution contained 80 mm K+ (78 mm Na+ of the low [K+] solution was replaced with K+). The voltage protocol for measuring TRESK current and the calcium-activated chloride current simultaneously was as following: –100 mV for 300 ms, 0 mV for 250 ms, and +20 mV for 300 ms, applied every 3 s from a holding potential of 0 mV. TRESK current and the calcium-activated chloride current (ICl,Ca) were measured at the end of the voltage steps to –100 mV and +20 mV, respectively. As we reported previously (20Czirják G. Fischer T. Spät A. Lesage F. Enyedi P. Mol. Endocrinol. 2000; 14: 863-874PubMed Google Scholar, 21Czirják G. Petheö G.L. Spät A. Enyedi P. Am. J. Physiol. 2001; 281: C700-C708Crossref PubMed Google Scholar), ICl,Ca at –100 mV in 80 mm [K+] was negligible compared with the robust K+ current of expressed 2PK+ channels. Thus ICl,Ca was estimated by applying voltage steps to +20 mV, which is close to the K+ equilibrium potential. The initial ICl,Ca could be measured independently from the K+ current, since TRESK activation was delayed compared with the onset of ICl,Ca. All treatments of the animals were conducted in accordance with state laws and institutional regulations. The experiments were approved by the Animal Care and Ethics Committee of the Semmelweis University. Statistics and Calculations—Data are expressed as means ± S.E. Statistical significance was estimated by t test for dependent or independent samples, one-way ANOVA or two-way repeated measures ANOVA and Scheffe's test for pairwise post hoc comparisons using the Statistica 6.0 program package (StatSoft, Tulsa, OK). The difference was considered to be significant at p < 0.05. Free [Ca2+] was calculated with Chelator program (written by Theo J. M. Schoenmakers, University of Nijmegen, Nijmegen, The Netherlands). Some sequence operations (e.g. automatic design of silent mutations to QuikChange primers for selecting the mutant clones) were performed with the sequence-handling program “SeqHandler” developed in our laboratory. The Local Anesthetic Benzocaine Distinguishes Activated TRESK from the Resting Channels—Reduced stimulation of a mutant TRESK channel by the calcium signal may reflect the impaired mechanism of calcineurin-dependent activation. However, a constitutively active mutant channel, which is nearly maximally active even under basal conditions, is also expected to be unresponsive to the calcium signal. To discriminate between these two mutant types, we searched for a pharmacological tool, which affects distinctly the basal and the calcineurin-activated currents. TRESK current was measured in 80 mm extracellular K+ concentration at –100 mV with the two-electrode voltage clamp technique. The calcium signal evoked by ionomycin (0.5 μm) resulted in a 9.4 ± 1-fold activation of TRESK (n = 5). Benzocaine (1 mm) inhibited TRESK current significantly less before (13 ± 2%) than after the application of ionomycin (51 ± 1%, p < 0.001, Student's t test for dependent samples, Fig. 1). This indicates that benzocaine inhibits stimulated wild type TRESK preferentially and it can be applied to determine, whether a given macroscopic TRESK current is constituted by resting or activated channels. We also tested the effect of benzocaine on S276A mutant TRESK, which had been reported to be a constitutively active form of the channel, being unresponsive to the calcium signal (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The resting current of S276A TRESK was inhibited by benzocaine (51 ± 1%, n = 6, Fig. 1B) identically to the current of the activated wild type channel. The strong inhibition of S276A mutant verified that benzocaine could be used for differentiating the two types of mutant TRESK channels, both of which are characterized by apparent insensitivity to the calcium signal. The constitutively active TRESK mutants are expected to be inhibited more effectively by the local anesthetic than the mutants of really impaired activation. Mutations of the PQIVID Sequence of TRESK Prevent the Calcium-dependent Activation—In its intracellular loop, mouse TRESK possesses the PQIVID sequence (amino acids 210–215), which is highly similar to the calcineurin binding consensus motif (PXIXIT) of NFAT proteins. To examine the role of this motif in the calcium-dependent regulation, different mutants of TRESK channel were created by replacing distinct amino acid residues of the PQIVID sequence with alanines. Since the mutation of a proline residue often results in major structural changes and apart from the proline only the two isoleucines match directly to the PXIXIT consensus motif, we mutated one or both of these isoleucines (PQIVAD and PQAVAD mutants). In addition, we also examined the PQIVIA mutant to elucidate whether the aspartate residue, which does not correspond to the NFAT consensus motif, can substitute for the threonine and strengthen the binding to calcineurin. Expression of all the mutants yielded functional channels in Xenopus oocytes; however, their responses to the calcium signal, evoked by the calcium ionophore ionomycin, were affected (Fig. 2A). The response of the PQIVIA mutant was attenuated (4.1 ± 0.3-fold activation (n = 5) in contrast to the 7.5 ± 0.6-fold (n = 6) increase of the wild type), suggesting that the aspartate residue promoted the binding of calcineurin, and its mutation to alanine decreased the affinity to the phosphatase. Mutation of the second isoleucine of the motif (PQIVAD mutation) strongly reduced the ionomycin-evoked activation (only 1.6 ± 0.1-fold increase, n = 5). The mutation of both critical isoleucines (PQAVAD) had an even stronger effect; the calcium-dependent regulation was completely eliminated (1.1 ± 0.1-fold current after the stimulation, n = 5, Fig. 2A). The reduced response of the mutant channels to the calcium signal suggests that the PQIVID sequence of TRESK, similarly to the PXIXIT motifs of NFAT proteins, is a functionally important calcineurin docking site. In the same experiment, by applying our newly discovered pharmacological tool, benzocaine, we also demonstrated that the mutations of the PQIVID sequence really interfered with the process of activation and did not render TRESK constitutively active. The benzocaine sensitivity, measured after the ionomycin stimulation, was reduced in line with the smaller responsiveness to the calcium signal. Whereas the wild type TRESK current was inhibited by 57 ± 2% (n = 5), the sensitivity of the PQIVIA, PQIVAD, and PQAVAD mutants was attenuated (44 ± 1% inhibition, n = 5), strongly reduced (23 ± 1%, n = 5), and decreased nearly to the level characteristic for the resting channels (18 ± 1%, n = 5), respectively (Fig. 2A). These pharmacological data confirm the conclusion that the more severe is the perturbation of the binding motif, the more impaired is the interaction with calcineurin, and consequently, the higher fraction of the mutant channels remains in the resting state after the calcium signal. To verify that the different levels of activation of TRESK mutants were not due to the difference in the calcium signal, we measured the endogenous calcium-activated chloride current (ICl,Ca), reflecting the cytoplasmic [Ca2+] of the oocytes. The amplitude of ICl,Ca, measured at +20 mV in 80 mm extracellular [K+], 9–15 s after the administration of ionomycin, was not significantly different in the oocytes expressing the different TRESK mutants (data not shown). This indicates that the reduced activation of TRESK mutants was not the consequence of the altered Ca2+ homeostasis of the cell, but it was the inherent property of the mutant channels. The Activation of the PQIVID Mutants Is Reduced Irrespective of the Mechanism of the Calcium Signal—The levels of activation of the wild type and mutant TRESK channels were also compared, when the calcium signal was induced in a more physiological manner, by stimulation of M1 muscarinic ACh receptors, coexpressed with the channel. Whereas carbachol (1 μm) activated wild type TRESK efficiently, the response of the PQIVIA, PQIVAD, and PQAVAD mutants were attenuated, strongly reduced and eliminated, respectively (Fig. 2B), as in the case of stimulation with ionomycin. These results suggest that the receptor-mediated activation of TRESK also depends on the binding of calcineurin to the PQIVID motif. In Xenopus oocytes, ionomycin increases the cytoplasmic [Ca2+] mainly by releasing the ion from intracellular stores (22Yoshida S. Plant S. J. Physiol. (Lond.). 1992; 458: 307-318Crossref Scopus (50) Google Scholar), and the stimulation of M1 receptor also results in calcium release. To activate TRESK independently from the calcium stores, the cytoplasmic [Ca2+] was controlled directly by microinjecting a saturated calcium buffer of high (50 mm Ca2+ plus 50 mm EGTA) concentration. The order of responsiveness of wild type TRESK and the PQIVID mutants to the microinjection was the same as those obtained with ionomycin and carbachol (Fig. 2C). This indicates that the activation of TRESK may generally rely on the intact PQIVID motif in the case of calcium signals of different source and kinetics. Microinjection of VIVIT Peptide Eliminates the Calcineurin-dependent Activation of TRESK—The sequence of VIVIT peptide (MAGPH-PVIVITGPHEE) was optimized for the highest affinity toward the NFAT binding site of calcineurin (23Aramburu J. Yaffe M.B. Lopez-Rodriguez C. Cantley L.C. Hogan P.G. Rao A. Science. 1999; 285: 2129-2133Crossref PubMed Scopus (521) Google Scholar). To provide a further in vivo evidence for TRESK-calcineurin interaction in addition to TRESK mutants, we also attempted to block the interaction by saturating the NFAT binding site of calcineurin with VIVIT peptide. Xenopus oocytes expressing wild type TRESK were microinjected with the peptide and subsequently challenged with ionomycin. These oocytes failed to respond with TRESK activation to the stimulation (Fig. 3A). The effective inhibition indicated that VIVIT peptide occupied the NFAT-docking site of calcineurin and thus prevented the binding of the intracellular loop of TRESK, which would have normally interacted with the same region of the phosphatase. The dependence of TRESK regulation on calcineurin raised the question whether the basal K+ current was also the result of the calcineurin activity in the resting cell. To suppress the resting calcineurin activity by reducing the cytoplasmic calcium concentration to subphysiological levels, EGTA was microinjected to the oocytes expressing TRESK, and the background K+ current was measured before and after the microinjection. It was reported previously (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar) that the 50-nl injection of a high (50 mm) concentration of EGTA was sufficient (even after the estimated 10-fold dilution of the chelator in the cytoplasm) to eliminate the calcium-dependent TRESK activation. However, an identical EGTA injection failed to influence unstimulated TRESK (Fig. 3B), indicating that a calcium-dependent calcineurin activity did not contribute to the maintenance of the basal TRESK current. As an alternative approach to extinguish the possible basal calcineurin action on TRESK independently from calcium, the TRESK-interacting surface of calcineurin was blocked with VIVIT peptide. The microinjection of VIVIT peptide did not reduce the basal TRESK current (Fig. 3B), also confirming that calcineurin was not required for the resting TRESK activity. The PQIVID Motif of TRESK Binds Constitutively Active Calcineurin Permanently and Wild Type Calcineurin Calcium/Calmodulin-dependently—To demonstrate the direct binding of the PQIVID motif of TRESK to calcineurin, GST pulldown experiments were performed with a GST-TRESKloop-TAPtag fusion protein (see “Experimental Procedures”), immobilized on glutathione-agarose beads. The constitutively active form of calcineurin (A subunit lacking the autoinhibitory domain and the calmodulin binding site but complexed with B subunit) was incubated with this resin. The characteristic band of the truncated calcineurin A could be easily detected with Coomassie Blue staining (compare lanes 1 and 2 in Fig. 4A) if all proteins bound to the resin were analyzed on SDS-PAGE. To verify that calcineurin actually bound to the PQIVID sequence, the experiment was carried out with the PQAVAD mutant version of GST-TRESKloop-TAPtag under identical conditions. In good accordance with the results obtained in the oocyte experiments, the PQAVAD mutant GST-TRESKloop-TAPtag did not bind the constitutively active calcineurin at all (compare lanes 3 and 4 in Fig. 4A). Moreover, the addition of VIVIT peptide (200 μm) to the binding reaction of the “wild type” (PQIVID) GST-TRESKloop-TAPtag also eliminated the association with the constitutively active calcineurin (Fig. 4B). These experiments indicate unequivocally that calcineurin binds directly and specifically to the PQIVID motif of TRESK. To gain further insight into the regulation of TRESK-calcineurin interaction, we also examined the binding of the full-length version of the phosphatase to the PQIVID motif. Since the calcineurin purified from bovine brain has a larger molecular weight than its truncated recombinant counterpart, the smaller GST-TRESKloop protein could be used in this pull-down experiment. Apparently, full-length calcineurin bound to GST-TRESKloop more strongly in the presence of the calcium/calmodulin complex, and the specificity of this binding was also verified by the inhibitory effect of VIVIT peptide (Fig. 4C). Thus the affinity of wild type calcineurin to the PQIVID motif is enhanced by the activation of the phosphatase, and calcineurin may be recruited to TRESK during the physiological activation by the calcium/calmodulin complex. The Calcineurin Autoinhibitory Peptide Diminishes TRESK Activation but Does Not Interfere with the Binding of Calcineurin to the PQIVID Motif—As the binding of calcineurin to the PQIVID motif was indispensable for TRESK activation, the question emerged whether this binding was sufficient on its own or whether the phosphatase activity of calcineurin was also required for the regulation. To suppress the phosphatase activity without occluding the protein-protein interaction, a peptide corresponding to the autoinhibitory domain (467–491 amino acids) of calcineurin was microinjected. This microinjection inhibited the ionomycin-induced activation of wild type TRESK (Fig. 5A), suggesting that the phosphatase activity of endogenous calcineurin was required for TRESK activation. To demonstrate that the autoinhibitory peptide did not influence the binding of calcineurin to the PQIVID motif, recombinant constitutively active calcineurin was used. We reported previously that the coexpression of the truncated calcineurin A subunit (1–398 amino acids, devoid of the autoinhibitory domain) and full-length calcineurin B with TRESK resulted in permanent activation of the channel (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Inhibition of the phosphatase activity by the reintroduction of the autoinhibitory domain by peptide microinjection substantially reduced the otherwise permanently stimulated TRESK current (Fig. 5B). On the other hand, the autoinhibitory peptide, blocking only the active site of the phosphatase, did not influence the binding of the constitutively active calcineurin to the PQIVID motif in our GST pulldown experiments (compare lanes 3 and 4 in Fig. 5C). The reduction of TRESK current by the selective inhibition of the phosphatase activity supports the conclusion that dephosphorylation is also required for TRESK regulation in addition to the binding of calcineurin to the PQIVID motif. Several proteins are substrates of calcineurin (24Klee C.B. Ren H. Wang X. J. Biol. Chem. 1998; 273: 13367-13370Abstract Full Text Full Text PDF PubMed Scopus (794) Google Scholar); however, only a small subset of them interacts directly with the calcium/calmodulin-dependent phosphatase through an NFAT-like docking site (13Liu J.O. Biochem. Biophys. Res. Commun. 2003; 311: 1103-1109Crossref PubMed Scopus (31) Google Scholar, 14Dodge K.L. Scott J.D. Biochem. Biophys. Res. Commun. 2003; 311: 1111-1115Crossref PubMed Scopus (26) Google Scholar, 25Boustany L.M. Cyert M.S. Genes Dev. 2002; 16: 608-619Crossref PubMed Scopus (108) Google Scholar, 26Heath V.L. Shaw S.L. Roy S. Cyert M.S. Eukaryot. Cell. 2004; 3: 695-704Crossref PubMed Scopus (63) Google Scholar, 27Kim S.J. Ding W. Albrecht B. Green P.L. Lairmore M.D. J. Biol. Chem. 2003; 278: 15550-15557Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Previously, we demonstrated unequivocally that the calcium-dependent regulation of the two-pore domain K+ channel, TRESK, is mediated by calcineurin (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Alanine scanning mutagenesis of all intracellular serine and threonine residues of TRESK indicated that Ser276, located in the intracellular loop, is a likely candidate for dephosphorylation, since the S276A mutation, mimicking the dephosphorylated state, rendered the channel constitutively active (3Czirják G. Tóth Z.E. Enyedi P. J. Biol. Chem. 2004; 279: 18550-18558Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). In the present study we report another aspect of TRESK-calcineurin interaction. In addition to the enzyme-substrate relation, calcineurin also binds to the NFAT-like PQIVID motif of mouse TRESK. This binding motif does not resemble the sites dephosphorylated by calcineurin at all and it has been shown in the case of NFAT proteins that a surface of the phosphatase, other than the substrate binding region, connects to PXIXIT motifs (28Li H. Rao A. Hogan P.G. J. Mol. Biol. 2004; 342: 1659-1674Crossref PubMed Scopus (66) Google Scholar). Interestingly, our GST pulldown experiments indicated that the regulation of calcineurin activity essentially influenced TRESK-calcineurin interaction. The constitutively active calcineurin devoid of the autoinhibitory domain bound to the PQIVID motif permanently. In contrast, the binding of the wild type enzyme required (or at least it was enhanced drastically by) the presence of calcium/calmodulin complex. This substantial change of affinity may result in the shuttling of calcineurin between the cytoplasm and the PQIVID site during the calcium signal. Beyond the in vitro results, we provided compelling evidence that the association of the two proteins is indispensable for the regulation of TRESK in Xenopus oocytes. The channel was activated efficiently by endogenous calcineurin, and the activation evolved even if TRESK was expressed by injecting only a trace amount of cRNA (data not shown). Thus TRESK-calcineurin interaction developed without the overexpression of the interacting partners. Identification of the well defined NFAT-like motif also made it very unlikely that TRESK and calcineurin interacted only by chance in our heterologous expression system. The intracellular loops of the human and mouse TRESK orthologues show only limited similarity. Still, the PQIVID motif aligns exceptionally well to the PQIIIS sequence of human TRESK, and the two channels are activated identically by the calcium signal, indicating that the binding mechanism of calcineurin is evolutionary conserved. In the present medical practice of organ transplantation, the phosphatase activity of calcineurin is inhibited for immunosuppression. To eliminate the side effects of these treatments, significant effort has been made to develop compounds, which inhibit NFAT activation but not the phosphatase activity of calcineurin in general. In addition to VIVIT peptide (23Aramburu J. Yaffe M.B. Lopez-Rodriguez C. Cantley L.C. Hogan P.G. Rao A. Science. 1999; 285: 2129-2133Crossref PubMed Scopus (521) Google Scholar), a family of small molecule inhibitors blocking the NFAT binding site of calcineurin has also been discovered (12Roehrl M.H. Wang J.Y. Wagner G. Biochemistry. 2004; 43: 16067-16075Crossref PubMed Scopus (38) Google Scholar). This novel class of inhibitors (and possibly future drugs) is also expected to prevent TRESK activation, in addition to the presently used immunosuppressive agents, since TRESK and NFAT are complexed with calcineurin by the same mechanism. Further research, elucidating the exact physiological role of TRESK, will be required to determine, whether this cross-reaction is advantageous or disadvantageous therapeutically. Elimination of TRESK regulation may cause undesired symptoms or it may have an auxiliary immunosuppressive effect, considering the reported expression of the channel in thymus and spleen. We thank Isabella A. Graef and Gerald R. Crabtree for the calcineurin A (pBJ5-CnA-FL) and calcineurin B (pBJ5-CnB), and Jill Manchester and Jeffrey Gordon for the N-myristoyltransferase (pBB131) plasmid constructs. We thank Irén Veres and Beáta Busi for the expert technical assistance." @default.
W1997481684 created "2016-06-24" @default.
W1997481684 creator A5042836109 @default.
W1997481684 creator A5070327980 @default.
W1997481684 date "2006-05-01" @default.
W1997481684 modified "2023-09-27" @default.
W1997481684 title "Targeting of Calcineurin to an NFAT-like Docking Site Is Required for the Calcium-dependent Activation of the Background K+ Channel, TRESK" @default.
W1997481684 cites W1509995036 @default.
W1997481684 cites W1531919411 @default.
W1997481684 cites W1970842110 @default.
W1997481684 cites W1974712482 @default.
W1997481684 cites W1974956422 @default.
W1997481684 cites W1975371118 @default.
W1997481684 cites W1979555078 @default.
W1997481684 cites W1991163286 @default.
W1997481684 cites W2004536978 @default.
W1997481684 cites W2014223927 @default.
W1997481684 cites W2017764934 @default.
W1997481684 cites W2019757361 @default.
W1997481684 cites W2021286825 @default.
W1997481684 cites W2028211858 @default.
W1997481684 cites W2057048385 @default.
W1997481684 cites W2071878018 @default.
W1997481684 cites W2072678654 @default.
W1997481684 cites W2101750224 @default.
W1997481684 cites W2103513180 @default.
W1997481684 cites W2110510554 @default.
W1997481684 cites W2123474600 @default.
W1997481684 cites W2130322562 @default.
W1997481684 cites W2135262062 @default.
W1997481684 cites W2148058938 @default.
W1997481684 cites W2411930161 @default.
W1997481684 cites W2414491497 @default.
W1997481684 doi "https://doi.org/10.1074/jbc.m602495200" @default.
W1997481684 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16569637" @default.
W1997481684 hasPublicationYear "2006" @default.
W1997481684 type Work @default.
W1997481684 sameAs 1997481684 @default.
W1997481684 citedByCount "89" @default.
W1997481684 countsByYear W19974816842012 @default.
W1997481684 countsByYear W19974816842013 @default.
W1997481684 countsByYear W19974816842014 @default.
W1997481684 countsByYear W19974816842015 @default.
W1997481684 countsByYear W19974816842016 @default.
W1997481684 countsByYear W19974816842017 @default.
W1997481684 countsByYear W19974816842018 @default.
W1997481684 countsByYear W19974816842019 @default.
W1997481684 countsByYear W19974816842020 @default.
W1997481684 countsByYear W19974816842021 @default.
W1997481684 countsByYear W19974816842023 @default.
W1997481684 crossrefType "journal-article" @default.
W1997481684 hasAuthorship W1997481684A5042836109 @default.
W1997481684 hasAuthorship W1997481684A5070327980 @default.
W1997481684 hasBestOaLocation W19974816841 @default.
W1997481684 hasConcept C107824862 @default.
W1997481684 hasConcept C12554922 @default.
W1997481684 hasConcept C126322002 @default.
W1997481684 hasConcept C128057223 @default.
W1997481684 hasConcept C159110408 @default.
W1997481684 hasConcept C178790620 @default.
W1997481684 hasConcept C185592680 @default.
W1997481684 hasConcept C189938988 @default.
W1997481684 hasConcept C2911091166 @default.
W1997481684 hasConcept C41685203 @default.
W1997481684 hasConcept C519063684 @default.
W1997481684 hasConcept C55493867 @default.
W1997481684 hasConcept C71924100 @default.
W1997481684 hasConcept C85520022 @default.
W1997481684 hasConcept C86803240 @default.
W1997481684 hasConcept C98274493 @default.
W1997481684 hasConceptScore W1997481684C107824862 @default.
W1997481684 hasConceptScore W1997481684C12554922 @default.
W1997481684 hasConceptScore W1997481684C126322002 @default.
W1997481684 hasConceptScore W1997481684C128057223 @default.
W1997481684 hasConceptScore W1997481684C159110408 @default.
W1997481684 hasConceptScore W1997481684C178790620 @default.
W1997481684 hasConceptScore W1997481684C185592680 @default.
W1997481684 hasConceptScore W1997481684C189938988 @default.
W1997481684 hasConceptScore W1997481684C2911091166 @default.
W1997481684 hasConceptScore W1997481684C41685203 @default.
W1997481684 hasConceptScore W1997481684C519063684 @default.
W1997481684 hasConceptScore W1997481684C55493867 @default.
W1997481684 hasConceptScore W1997481684C71924100 @default.
W1997481684 hasConceptScore W1997481684C85520022 @default.
W1997481684 hasConceptScore W1997481684C86803240 @default.
W1997481684 hasConceptScore W1997481684C98274493 @default.
W1997481684 hasIssue "21" @default.
W1997481684 hasLocation W19974816841 @default.
W1997481684 hasLocation W19974816842 @default.
W1997481684 hasOpenAccess W1997481684 @default.
W1997481684 hasPrimaryLocation W19974816841 @default.
W1997481684 hasRelatedWork W1970886539 @default.
W1997481684 hasRelatedWork W1977323622 @default.
W1997481684 hasRelatedWork W1983978847 @default.
W1997481684 hasRelatedWork W1993389789 @default.
W1997481684 hasRelatedWork W1997481684 @default.
W1997481684 hasRelatedWork W1997610452 @default.
W1997481684 hasRelatedWork W2004011149 @default.