FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1998273216> ?p ?o ?g. }

• W1998273216 endingPage "32525" @default.
• W1998273216 startingPage "32516" @default.
• W1998273216 abstract "Bile salt hydrolase (BSH) is an enzyme produced by the intestinal microflora that catalyzes the deconjugation of glycine- or taurine-linked bile salts. The crystal structure of BSH reported here from Bifidobacterium longum reveals that it is a member of N-terminal nucleophil hydrolase structural superfamily possessing the characteristic αββα tetra-lamellar tertiary structure arrangement. Site-directed mutagenesis of the catalytic nucleophil residue, however, shows that it has no role in zymogen processing into its corresponding active form. Substrate specificity was studied using Michaelis-Menten and inhibition kinetics and fluorescence spectroscopy. These data were compared with the specificity profile of BSH from Clostridium perfrigens and pencillin V acylase from Bacillus sphaericus, for both of which the three-dimensional structures are available. Comparative analysis shows a gradation in activity toward common substrates, throwing light on a possible common route toward the evolution of pencillin V acylase and BSH. Bile salt hydrolase (BSH) is an enzyme produced by the intestinal microflora that catalyzes the deconjugation of glycine- or taurine-linked bile salts. The crystal structure of BSH reported here from Bifidobacterium longum reveals that it is a member of N-terminal nucleophil hydrolase structural superfamily possessing the characteristic αββα tetra-lamellar tertiary structure arrangement. Site-directed mutagenesis of the catalytic nucleophil residue, however, shows that it has no role in zymogen processing into its corresponding active form. Substrate specificity was studied using Michaelis-Menten and inhibition kinetics and fluorescence spectroscopy. These data were compared with the specificity profile of BSH from Clostridium perfrigens and pencillin V acylase from Bacillus sphaericus, for both of which the three-dimensional structures are available. Comparative analysis shows a gradation in activity toward common substrates, throwing light on a possible common route toward the evolution of pencillin V acylase and BSH. Bile salt hydrolase (BSH) 4The abbreviations used are: BSH, bile salt hydrolase; GCA, glycocholic acid; 2-nitrobenzoic acid; Ntn, N-terminal nucleophil; PVA, penicillin V acylase; penV, penicillin V; penG, penicillin G; PAA, phenylacetic acid; POAA, phenoxyacetic acid; CpBSH, bile salt hydrolase from Clostridium perfringens; BsPVA, penicillin acylase from Bacillus sphaericus; BlBSH, bile salt hydrolase from Bifidobacterium longum; CA, cholic acid; DCA, deoxycholic acid; DTNB, 5,5′-dithiobis(2-nitrobenzoic acid). (cholylglycine hydrolase; EC 3.5.1.24) catalyzes hydrolysis of the amide bond in conjugated bile salts, resulting in the release of free amino acids. Bile salts are synthesized mainly from cholesterol by conjugation with the amino acids glycine or taurine in the liver, and stored in the gall bladder until their release into the duodenum in response to ingestion of fatty foods (1Hofmann A.F. News Physiol. Sci. 1999; 14: 24-29PubMed Google Scholar, 2Bahar R.J. Andrew S. Gastroenterol. Clin. N. Am. 1999; 28: 27-58Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Bile salts are also the natural ligands for the farnesoid-X nuclear receptor. Therefore, they are considered important regulators of gene expression in the liver and intestines (3Torchia E.C. Stolz A. Agellon L.B. BMC Biochem. 2001; 2: 11Crossref PubMed Scopus (27) Google Scholar). Upon completion of emulsification, bile acids are returned to the liver by an active transport mechanism. However, their hydrolysis by the bacterial enzyme BSH results in production of free bile acids, whose affinity for the transport system is diminished (4Hofmann A.F. Roda A. J. Lipid Res. 1984; 25: 1477-1489Abstract Full Text PDF PubMed Google Scholar, 5Chikai T. Nakao H. Uchida K. Lipids. 1987; 22: 669-671Crossref PubMed Scopus (89) Google Scholar). These bile acids are then passed into the large intestine where they are further metabolized. As conjugated bile salts possess antimicrobial activity, bacteria seem to have evolved to produce BSH to neutralize this adverse activity (6De Boever P. Verstraete W. J. Appl. Microbiol. 1999; 87: 345-352Crossref PubMed Scopus (69) Google Scholar, 7Dambekodi P.C. Gilliland S.E. J. Dairy Sci. 1998; 81: 1818-1824Abstract Full Text PDF PubMed Scopus (71) Google Scholar). A number of bacterial strains possessing de-conjugating activity such as Enterococci, Bacteroides, anaerobic Lactobacillaceae, and Clostridia have been isolated (8Tanaka H. Doesburg K. Iwasaki T. Mierau I. J. Dairy Sci. 1999; 82: 2530-2535Abstract Full Text PDF PubMed Scopus (223) Google Scholar, 9Tannock G.W. Dashkevicz M.P. Feighner S.D. Appl. Environ. Microbiol. 1989; 55: 1848-1851Crossref PubMed Google Scholar, 10Christiaens H. Leer R.J. Pouwels P.H. Verstraete W. Appl. Environ. Microbiol. 1992; 58: 3792-3798Crossref PubMed Google Scholar, 11Coleman J.P. Hudson L.L. Appl. Environ. Microbiol. 1995; 61: 2514-2520Crossref PubMed Google Scholar, 12Stellwag E.J. Hylemon P.B. Biochim. Biophys. Acta. 1976; 452: 165-176Crossref PubMed Scopus (105) Google Scholar) and these have been shown to be present in ileal and fecal content. Bifidobacteria are among the most common genera in the human colon and have been considered as key commensals in promoting host health, but very little is known about their genetics (13Grill J.P. Schneider F. Crociani J. Ballongue J. Appl. Environ. Microbiol. 1995; 61: 2577-2582Crossref PubMed Google Scholar). Bifidobacteria longum is the most studied among the 32 species of Bifidobacteria known today (14Kaufmann P. Pfefferkorn A. Teuber M. Meile L. Appl. Environ. Microbiol. 1997; 63: 1268-1273Crossref PubMed Google Scholar). Depleted levels of bile salts following their hydrolysis triggers consumption of cholesterol, resulting in further synthesis of bile salts with a consequential lowering of the serum cholesterol levels. Thus, in addition to an effective increase in bile tolerance levels, enhancing the BSH activity of probiotics offers a potential biological alternative to pharmaceutical interventions for treating hypercholesterolemia (15Jones M.L. Chen H. Ouyang W. Metz T. Prakash S. J. Biomed. Biotechnol. 2004; 1: 61-69Crossref Scopus (88) Google Scholar, 16De Smet I. DeBoever P. Verstraete W. Br. J. Nutr. 1998; 79: 185-194Crossref PubMed Scopus (146) Google Scholar, 17Lim H.J. Kim S.Y. Lee W.K. J. Vet. Sci. 2004; 5: 391-395Crossref PubMed Scopus (74) Google Scholar). Possible detrimental effects due to the introduction of BSH activity have also been hypothesized. De-conjugated bile salts are implicated in the formation of gallstones (18Thomas L.A. Veysey M.J. Bathgate T. King A. French G.R. Smeeton N.C. Murphy G.M. Dowling R.H. Gastroenterology. 2000; 119: 806-815Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), in the retarded growth of chickens due to poor lipid uptake by the small intestine (19Knarreborg A. Engberg R.M. Jensen S.K. Jensen B.B. Appl. Environ. Microbiol. 2002; 68: 6425-6428Crossref PubMed Scopus (93) Google Scholar), and in colorectal cancer (20Marteau P. Rambaud J.C. FEMS Microbiol. Rev. 1993; 12: 207-220Crossref PubMed Google Scholar). Furthermore, it has been proposed that BSH activity in virulent strains of Listeria monocytogenes contributes to virulence (21Dussurget O. Cabanes D. Dehoux P. Lecuit M. Buchrieser C. Glaser P. Cossart P. Mol. Microbiol. 2002; 45: 1095-1106Crossref PubMed Scopus (266) Google Scholar). The clinical significance of BSH warrants structural and biochemical studies that can reveal the determinants of its activity modulation. The conspicuous sequence similarity of 29% between BSH and penicillin V acylase (PVA) suggested that the enzyme would belong to the N-terminal nucleophil (Ntn) hydrolase superfamily. Although the Ntn hydrolases display a wide range of substrate specificity, the self-activation and catalytic mechanisms of these enzymes seem similar. All the known members of the family catalyze the hydrolysis of amide bonds present in proteins or in small molecules, and each one of the members is synthesized as a pre-protein. An autocatalytic endoproteolytic process is thought to generate a new N-terminal residue, which is designed to act as a nucleophil. For both BSH and PVA, Cys is predicted to be the first residue of the mature protein. This residue is central to the mechanism of catalysis and serves both as a nucleophil and as a proton donor (22Oinonen C. Rouvinen J. Protein Sci. 2000; 9: 2329-2337Crossref PubMed Scopus (210) Google Scholar). The N-terminal amino group acts as the proton acceptor and activates the nucleophilic thiol group of the Cys side chain. Cys1 becomes a catalytic center only on removal of the initiation formylmethionine. Such unmasking post-translational modifications are common to all members of the Ntn hydrolase superfamily (23Brannigan J.A. Dodson G.G. Duggleby H.J. Moody P.C.E. Smith J.L. Tomchick D.R. Murzin A.G. Nature. 1995; 378: 416-419Crossref PubMed Scopus (547) Google Scholar). The importance of the -SH group was confirmed by the fact that replacement of Cys with other potential nucleophilic residues such as Ser or Thr resulted in the loss of BSH activity (24Chandra P.M. Brannigan J.A. Prabhune A. Pundle A. Turkenburg J.P. Dodson G.G. Suresh C.G. Acta Crystallogr. Sect. F. 2005; 61: 124-127Crossref PubMed Scopus (11) Google Scholar). Sequence analysis of BSH suggests that its tertiary structure, specifically the special arrangement of catalytic residues, might be similar to that of PVA. This prompted us to test the action of BSH on penicillin V (penV, Fig. 1) as well as other related compounds like penicillin G (penG), and also to test the inhibitory effects of compounds such as phenylacetic acid (PAA) on the enzyme activity. This is expected to provide insight into the construction of the catalytic site of BSH. Classical inhibition kinetic studies demonstrate the type of inhibition and its quantitative aspects. Furthermore, the active site protection assay suggests that the inhibition is due to the binding of inhibitor at, or near, the active site itself. Transient structural changes during the binding of inhibitors were monitored through fluorescence microscopy. Tryptophan proved to be a useful intrinsic probe, because its fluorescence emission spectrum varied depending on the molecular environment. Disruption of the native structure leads to changes in the exposure of the tryptophan side chains to solvent that can be readily monitored by recording the protein fluorescence emission spectrum. Here we report the crystal structure of BSH from B. longum and comparative studies of structure-function between PVAs and BSHs that suggests a common catalytic mechanism and possible evolutionary relationship between these two enzymes. Materials—Conjugated bile salt kit, penicillin V, penicillin G, PAA, phenoxyacetic acid (POAA), 4-amino PAA, cholic acid, deoxycholic acid, ninhydrin, dithiothreitol, and Sephacryl S-200 were obtained from Sigma. All chemicals used were of analytical grade. Overexpression and Site-directed Mutagenesis—The B. longum bsh gene was amplified from plasmid pBH1351 (25Tanaka H. Hashiba H. Kok J. Mierau I. Appl. Environ. Microbiol. 2000; 66: 2502-2512Crossref PubMed Scopus (224) Google Scholar) by PCR, using primers GGAGTCATTAATGTGCACTGGTGTCCGTTTC (A) and GGAAGAATTCATCGGGCGACGCTGATGAG (B), which incorporate restriction enzyme recognition sites. C1A and T2A mutations were introduced by appropriate substitutions in primer A, (GGAGTCATTAATGGCCACTGGTGTCCGTTTC and GGAGTCATTAATGTGCGCTGGTGTCCGTTTC, respectively). The PCR product was cloned into the T7 promoter-based pET26b(+) expression vector (Novagen) using NdeI and EcoRI restriction sites and transformed into Escherichia coli BL21(DE3) for protein production. Protein Purification and Crystallization—BlBSH protein was purified and crystallized essentially as described earlier (26Kumar R.S. Brannigan J.A. Pundle A. Prabhune A. Dodson G.G. Suresh C.G. Acta Crystallogr. Sect. D. 2004; 60: 1665-1667Crossref PubMed Scopus (8) Google Scholar). Crystals of the two mutants were obtained in similar conditions with slight differences in the concentration of additives. Clostridium perfrigens BSH was obtained from Sigma and purified by passing through Sephacryl S-200. Recombinant penicillin acylase from Bacillus sphaericus was purified as described previously (24Chandra P.M. Brannigan J.A. Prabhune A. Pundle A. Turkenburg J.P. Dodson G.G. Suresh C.G. Acta Crystallogr. Sect. F. 2005; 61: 124-127Crossref PubMed Scopus (11) Google Scholar). Structure Determination and Refinement—The structure was solved by molecular replacement using one molecule of PVA (3PVA) as a search model (the structure 2BJF reported by Rossocha et al. (27Rossocha M. Schultz-Heienbrok R. von Moeller H. Coleman J.P. Saenger W. Biochemistry. 2005; 44: 5739-5748Crossref PubMed Scopus (109) Google Scholar) is a closer match but it was not available at the time). Two copies were positioned using the program MOLREP (28Vagin A. Teplyakov A. Acta Crystallogr. Sect. D. 2000; 56: 1622-1624Crossref PubMed Scopus (690) Google Scholar) within the CCP4 crystallographic software suite (29Collaborative Computational Project No. 4Acta Crystallogr. Sect. D. 1994; 50: 760-763Crossref PubMed Scopus (19825) Google Scholar). The solution in space group P3221 was clearly better than in the enantiomorph, P3121. As expected the two molecules form a dimer in the asymmetric unit, and the complete homotetrameric unit is generated by the crystallographic 2-fold axis. The model was completed using automated model building program ARP/wARP (30Perrakis A. Harkiolaki M. Wilson K.S. Lamzin V.S. Acta Crystallogr. Sect. D. 2001; 57: 1445-1450Crossref PubMed Scopus (461) Google Scholar) and refined using the REFMAC program (31Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D. 1997; 53: 240-255Crossref PubMed Scopus (13945) Google Scholar). This resulted in an initial model with an R-factor of 27.0 and Rfree of 31.0. Subsequent rounds of refinement were carried out alternating between manual model building with COOT (32Emsley P. Cowtan K. Acta Crystallogr. Sect. D. 2004; 60: 2126-2132Crossref PubMed Scopus (23864) Google Scholar) and refinement using the maximum likelihood method. In the last four refinement cycles, solvent molecules were placed at peaks of (Fo - Fc) density above 4 σ (3 σ in the final cycle) providing the sites could participate in hydrogen bonds with protein atoms. 229 water molecules were fitted into the asymmetric unit. The difference map (Fo - Fc) showed three distinct blobs of density close to the Sγ atom of N-terminal residue Cys1. These were interpreted as oxygen atoms due to formation of sulfonic acid. Extra density in the vicinity of the N-terminal cysteine was left unidentified and may represent an oxidized dithiothreitol molecule. Structure validation was performed using the program PROCHECK (33Laskowski R.A. McArthur M.W. Moss D.S. Thornton J. J. Appl. Crystallogr. 1993; 26: 282-291Crossref Google Scholar), which showed all 316 residues in the allowed region of a Ramachandran map (34Ramachandran G.N. Sasisekharan V. Adv. Protein Chem. 1968; 23: 283-438Crossref PubMed Scopus (2778) Google Scholar). The structural homology search using the three-dimensional structure against the data base of protein chains was carried out using the program DALI (35Holm L. Sander C. Science. 1996; 273: 595-603Crossref PubMed Scopus (1290) Google Scholar). The structures of C1A and T2A mutants of BSH were determined using the refined model of wild-type BSH as a search model in MOLREP. Other steps were carried out as described. Bile Salt Hydrolase Assay—BSH enzyme activity was determined by estimating the amount of free amino acids released upon incubation of the enzyme sample with 1 mm sodium taurocholate or 1 mm sodium glycocholate at 40 °C in 10 mm sodium phosphate, pH 6.5, containing 10 mm dithiothreitol. After 10 and 30 min incubation time, a 25-μl aliquot was with-drawn and the reaction arrested by mixing with 25 μl of 15% (w/v) trichloroacetic acid. The sample was spun at 10,000 × g for 1 min and the supernatant was mixed with an equal volume of 2% ninhydrin solution before boiling for 15 min. The absorption was recorded at 570 nm and the amount of product formed was estimated from a calibration curve (36Lee Y.P. Takahashi T. Anal. Biochem. 1966; 14: 71-77Crossref Scopus (642) Google Scholar). One unit of BSH activity is defined as the amount of enzyme that liberates 1 μmol of the amino acid from substrate per min. Specific activity was defined as the number of units of activity per milligram of the pure protein. Substrate Specificity—The values of Km and kcat for different substrates were determined by incubating the enzyme sample with a range of substrate concentrations under standard assay conditions. Non-substrate ligands were compared by determining the Ki measured by incubating 1.12 mg/ml of BSH with the respective inhibitors in the concentration range 0.5-5 mm and by increasing the concentration of glycocholic acid (GCA; 0.1-10 mm) under standard assay conditions. The constants were calculated by fitting the linear regression curve to the data on Lineweaver-Burk plots using Enzyme Kinetics!Pro (37Lisy J.M. Simon P. Comput. Chem. 1998; 22: 509-513Crossref Scopus (10) Google Scholar). The standard errors in the estimation of the values of Km and kcat were within limits of 10%. Cysteine Modification Active Site Protection Assay—BSH (4 μm, 1 ml) in 100 mm potassium phosphate buffer, pH 8.0, was incubated with 1 mm 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) at 30 °C for 60 min. Aliquots were removed at defined time intervals and the residual activity was determined. The protective effect of substrate and inhibitor during cysteine modification was determined by incubating the enzyme with an excess of substrate or inhibitors prior to treatment with modifying reagent under similar experimental conditions. Excess reagents were removed by passing through a PD10 column. The residual activity was quantified under the standard assay conditions. Fluorescence Measurement—Fluorescence was measured using a PerkinElmer Life Sciences LS50 fluorescence spectrophotometer connected to a Julabo F20 water bath. To eliminate background emission, the signal produced by either buffer solution, or buffer containing the appropriate quantity of substrate or inhibitor was subtracted. The sample was excited at 295 nm and the emission recorded in the 300-400 nm wavelength range at 25 °C. The slit-width on both the excitation and emission were set at 5 nm, and the spectra were obtained at 100 nm/min. The binding constant (Kd)of the various substrates and inhibitors was determined by monitoring the effect of fluorescence emission upon titration with a given ligand (38Leher S.S. Biochemistry. 1971; 10: 3254-3263Crossref PubMed Scopus (1695) Google Scholar, 39Eftink M.R. Ghiron A. Biochemistry. 1976; 15: 672-680Crossref PubMed Scopus (993) Google Scholar). The binding of ligands to BSH can be described as, Kd=[BSH][inhibitor][BSHinhibitor] where Kd is the apparent dissociation constant, [BSH] is the concentration of the protein, [BSH inhibitor] is the concentration of complexed protein, and [inhibitor] is the concentration of unbound inhibitor. The proportion of inhibitor-bound protein as described by Equation 1 is related to measured fluorescence emission intensity as, (Fo-F)/(F-F∞)=[BSHinhibitor]/[BSH]T where Fo is fluorescence intensity of enzyme alone, F is observed fluorescence intensity at a given concentration of inhibitor, F∞ is intensity of BSH saturated with inhibitor, and [BSH]T is the total protein concentration. If the total inhibitor concentration, [inhibitor]T, is in large molar excess relative to [BSH]T, then it can be assumed that [inhibitor] is approximately equal to [inhibitor]T. Equations 1 and 2 can then be combined. (Fo-F)/(F-F∞)=[inhibitor]T/(Kd+[inhibitor]T) The values of Kd were determined from a nonlinear least square regression analysis of titration data using Equation 3. The stoichiometry of binding was established using a linear version of the Hill equation, log{(Fo-F)/(F-F∞)}=nlog[inhibitor]-logK' where n is the order of the binding reaction with respect to inhibitor concentration and K′ is the concentration of the ion that yields 50% of F - F∞. The thermodynamic parameters ΔG, ΔH, and ΔS were determined according to Equation 5, -RTlnK=ΔG=ΔH-TΔS where R is the gas constant, and T corresponds to absolute temperature. The crystal structure of wild-type BSH has been determined at 2.5-Å resolution (Table 1) and its mutants C1A and T2A at 3.2 and 3.0 Å, respectively (details not included). The wild-type protein crystallized in space group P3221 with unit cell parameters a = b = 125.24, c = 117.03 Å and in P6122 space group with cell parameters a = b = 123.98, c = 219.56 Å (Table 1). One of the mutants, C1A, crystallized in space group C2 with unit cell parameters a = 186.36, b = 71.10, c = 133.65 Å, and β = 109.10°, whereas the other, T2A, crystallized in the same space group and cell parameters as the wild type (data not shown). Reflections were phased using the molecular replacement method. The processed form of the B. sphaericus penicillin V acylase monomer (3pva) was used as a search model. The initial electron density allowed assignment of all 316 residues in each of subunits A and B of the asymmetric unit. The overall G factor output by PROCHECK, considered as a measure of stereochemical quality of the model, is -0.034. This is within the limits expected for a structure that is refined at 2.5-Å resolution. The refinement statistics are presented in Table 1.TABLE 1Summary of data collection and refinement statistics Data in parentheses correspond to the outer shell.Crystal system/space groupTrigonal/P3221Hexagonal/P6122Resolution range (Å)20.0-2.49 (2.55-2.50)20.0-2.30 (2.35-2.30)Completeness (%)99.5 (100)99.7 (97.21)Number of unique reflections37,13536,287Rsym (%)aRsym = ∑|I - (I)|/∑I.6.0 (39.0)3.1Refinement statisticsRcrystbRcryst = ∑|Fo - Fc|/∑Foc.17.419.2RfreecRfree = ∑|Fo - Fc|/∑Fo, where the F values are test set amplitudes (5%) not used in refinement.21.122.8Number of protein atoms5,1545,152Number of water molecules229254Overall B value (Å2)38.925.4Root mean square deviationBond length (Å)0.0240.029Bond angle (°)2.1752.269Dihedral angles0.1420.207Ramachandran plot (% residues)Most favored region87.187.5Additionally allowed region11.810.7Generously allowed region1.11.8Disallowed region00a Rsym = ∑|I - (I)|/∑I.b Rcryst = ∑|Fo - Fc|/∑Foc.c Rfree = ∑|Fo - Fc|/∑Fo, where the F values are test set amplitudes (5%) not used in refinement. Open table in a new tab Description of the Structure—The overall structure of BSH from B. longum (BlBSH) confirms the characteristic Ntn hydrolase fold comprised of a four-layered αββα core structure that is formed by two antiparallel β-sheets packed against each other, with these β-sheets sandwiched between the layers of α-helices (Fig. 2a). The approximate monomer dimensions are 75 × 38 × 44 Å. β-Sheet I includes the N and C termini and is composed of six strands. β-Sheet II comprises seven strands. The topology of the strands in the first β-sheet is NH2-β1, β2, β15, β16, β17, and β18-COOH and the second β-sheet is β11, β10, β9, β6, β5, β4, and β3 (Fig. 2b). β-Sheet I is more flattened and the angle between the strands of the two sheets is 30°. Few residues are involved in the loops connecting the β-strands and α-helices. However, a large loop of about 26 Å length comprising residues 188 to 220 contained in β-sheet II is a prominent feature in the structure, which extends into the neighboring molecule of the tetramer. Two other major loops (58-65 and 129-139) enclose the active site. The distances from active site residue Cys1 to the termini of the above two loops are about 15.5 and 13.4 Å, respectively. Of a total of 12 loops, nine contain glycine residues that are more flexible in their possible conformation than other amino acids and influence the loop structure. These glycine residues appear to be conserved in all the Ntn hydrolases. There is a preponderance of hydrophobic residues between the β-sheets and many hydrophobic side chains are also present in the interface between β-sheets and α-helices and between α-helices. The β-sheet II and α-helix I layer together form a substructure reminiscent of a T-fold (40Colloc'h N. Poupon A. Mornon J.-P. Proteins Struct. Funct. Genet. 2000; 39: 142-154Crossref PubMed Scopus (54) Google Scholar). Tetrameric Structure—The tetrameric association of BSH subunits in solution was suggested by gel filtration and dynamic light-scattering studies (data not shown). The tetramer may be considered a dimer of dimers. In the structure, the dimer forms a tetramer with its replicate monomers, referred to as AS and BS generated by a crystallographic dyad axis (Fig. 3). A major contribution to the formation of the dimer in the asymmetric unit comes from interaction of the loop consisting of residues 188 to 220, which extends from one monomer across two of the others in a manner somewhat reminiscent of domain swapping (Fig. 3). Extensive interactions between A/AS (12 hydrogen bonds), A/BS (14 hydrogen bonds), and the equivalent B/AS and B/BS subunits also include hydrophobic and electrostatic interactions. The total solvent accessible area of the whole tetramer is almost 43,500 Å2. In the tetramer, each monomer interacts with the remaining three monomers. The buried surface area between monomers A and AS is 13% of the surface of each monomer. The main interactions between these monomers are made by the long loop (residues 188-200). The buried surface between subunits A and B is only 3% of the monomer surface area, whereas that between A and BS is about 10%. About 26% of the total tetramer surface is involved in subunit interaction. Thus the maximum interactions within the dimers are between subunits A and AS or B and BS. The dimers are held together by the interaction of A with B and AS with BS. Each of the monomers has approximately one-fourth of the surface contributed in tetramer formation. Active Site and Activity Studies—Chemical modification of BSH with 2 mm DTNB lowered the activity by 78%. In the presence of 20 mm GCA, the drop in activity was only 12% indicating that the modified residue or residues are at, or near the active site. The conformity between the CD spectra of the wild type and the chemically modified BSH indicates that the loss of activity is due to specific residue modification and not due to structural perturbations. The putative role of Cys1 in catalysis was further clarified by the replacement of Cys1 by Ala through site-directed mutagenesis. The C1A mutant turned out to be completely inactive. The residue Cys1 is situated at the tip of strand β1. The proximity of this residue to other putatively important residues such as Trp21, Thr171, Asn172, and Arg225 is evident from the structure (Fig. 4a). The binding site was also confirmed by superposing the structure of the enzyme-substrate complex of BSH from C. perfringens (CpBSH) (27Rossocha M. Schultz-Heienbrok R. von Moeller H. Coleman J.P. Saenger W. Biochemistry. 2005; 44: 5739-5748Crossref PubMed Scopus (109) Google Scholar). The residues that are identified as responsible for catalysis (Cys1, Arg17, Asp20, Asn174, and Arg227) by comparison with penicillin V acylase (41Suresh C.G. Pundle A.V. SivaRaman H. Rao K.N. Brannigan J.A. McVey C.E. Verma C.S. Dauter Z. Dodson E.J. Dodson G.G. Nat. Struct. Biol. 1999; 6: 414-416Crossref PubMed Scopus (105) Google Scholar) are conserved in both the structures (Fig. 5). Residues involved in substrate binding are conservatively replaced. The substrate-binding site consists of residues of β-sheet II located in strands β4, β5, and β9 that stabilize the geometry of the active site. The higher B-factors of the loop comprising residues 262-273 that are proximal to the active site reveal its enhanced conformational flexibility (Fig. 4b). Based on sequence alignment (Fig. S1) and substrate binding studies we suggest that Trp21 plays a selective role in binding of bile salt while it suppresses productive binding of penV. This residue is located about 6.3 Å away from Cys1. Crystal Structures of C1A and T2A—The superposition of the mutant and wild-type BSH structures showed that there was little effect of the mutations on the geometry of the catalytic site. Residue Thr2 is conserved in all BSHs but not in PVA where serine takes its place (Fig. S1). We decided to test this mutation for possible effects on processing or activity. Both mutant proteins process normally, by simple removal of the initiator methionine. The C1A mutant is completely inactive, whereas T2A mutant is partially active, with a reduced kcat (Table 2).TABLE 2Steady state kinetic parameters for B/BSH and its T2A mutantKmkcatkcat/Kmμms−1μm−1s−1Wild-type BSHGCA22 ± 785 ± 93.8TCA32 ± 1376 ± 92.4T2A mutantGCA24 ± 544 ± 31.8TCA30 ± 040 ± 11.3 Open table in a new tab Substrate Specificity—BlBSH exhibited a preference for glycine-conjugated bile salts over taurine-conjugated forms, but did not appear to discriminate between deoxy- and dihydroxybile salts. BSH activity of enzymes CpBSH and BsPVA are 73 and 20%, respectively, of the BlBSH activity. The latter is totally inactive toward penicillin V, whereas the BsPVA enzyme has the highest PVA activity. The penicllin V acylase activity of CpBSH is only 11% of the activity of BsPVA. There appears therefore to be an inversion of substrate preference within this protein set. For comparison, the values of their activities at their respective pH optima have been" @default.
• W1998273216 created "2016-06-24" @default.
• W1998273216 creator A5007156546 @default.
• W1998273216 creator A5058315843 @default.
• W1998273216 creator A5058816389 @default.
• W1998273216 creator A5059682608 @default.
• W1998273216 creator A5066791787 @default.
• W1998273216 creator A5074423495 @default.
• W1998273216 creator A5078432793 @default.
• W1998273216 date "2006-10-01" @default.
• W1998273216 modified "2023-10-18" @default.
• W1998273216 title "Structural and Functional Analysis of a Conjugated Bile Salt Hydrolase from Bifidobacterium longum Reveals an Evolutionary Relationship with Penicillin V Acylase" @default.
• W1998273216 cites W1524169968 @default.
• W1998273216 cites W1546896179 @default.
• W1998273216 cites W1549863768 @default.
• W1998273216 cites W1592794451 @default.
• W1998273216 cites W1602209617 @default.
• W1998273216 cites W1916997903 @default.
• W1998273216 cites W1964111349 @default.
• W1998273216 cites W1967817108 @default.
• W1998273216 cites W1975039906 @default.
• W1998273216 cites W1986015202 @default.
• W1998273216 cites W1986191025 @default.
• W1998273216 cites W1986525686 @default.
• W1998273216 cites W1995725157 @default.
• W1998273216 cites W2001127189 @default.
• W1998273216 cites W2001641653 @default.
• W1998273216 cites W2002515063 @default.
• W1998273216 cites W2014453458 @default.
• W1998273216 cites W2018976389 @default.
• W1998273216 cites W2020091120 @default.
• W1998273216 cites W2021896492 @default.
• W1998273216 cites W2022454496 @default.
• W1998273216 cites W2023790301 @default.
• W1998273216 cites W2038840577 @default.
• W1998273216 cites W2045507365 @default.
• W1998273216 cites W2078652488 @default.
• W1998273216 cites W2084490127 @default.
• W1998273216 cites W2088749908 @default.
• W1998273216 cites W2097678114 @default.
• W1998273216 cites W2114203830 @default.
• W1998273216 cites W2118455767 @default.
• W1998273216 cites W2132645356 @default.
• W1998273216 cites W2144081223 @default.
• W1998273216 cites W2147513681 @default.
• W1998273216 cites W2148305363 @default.
• W1998273216 cites W2151751266 @default.
• W1998273216 cites W2154495926 @default.
• W1998273216 cites W2154795785 @default.
• W1998273216 cites W2155765902 @default.
• W1998273216 cites W2161587852 @default.
• W1998273216 cites W2171070582 @default.
• W1998273216 cites W2223751714 @default.
• W1998273216 cites W49155368 @default.
• W1998273216 doi "https://doi.org/10.1074/jbc.m604172200" @default.
• W1998273216 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16905539" @default.
• W1998273216 hasPublicationYear "2006" @default.
• W1998273216 type Work @default.
• W1998273216 sameAs 1998273216 @default.
• W1998273216 citedByCount "118" @default.
• W1998273216 countsByYear W19982732162012 @default.
• W1998273216 countsByYear W19982732162013 @default.
• W1998273216 countsByYear W19982732162014 @default.
• W1998273216 countsByYear W19982732162015 @default.
• W1998273216 countsByYear W19982732162016 @default.
• W1998273216 countsByYear W19982732162017 @default.
• W1998273216 countsByYear W19982732162018 @default.
• W1998273216 countsByYear W19982732162019 @default.
• W1998273216 countsByYear W19982732162020 @default.
• W1998273216 countsByYear W19982732162021 @default.
• W1998273216 countsByYear W19982732162022 @default.
• W1998273216 countsByYear W19982732162023 @default.
• W1998273216 crossrefType "journal-article" @default.
• W1998273216 hasAuthorship W1998273216A5007156546 @default.
• W1998273216 hasAuthorship W1998273216A5058315843 @default.
• W1998273216 hasAuthorship W1998273216A5058816389 @default.
• W1998273216 hasAuthorship W1998273216A5059682608 @default.
• W1998273216 hasAuthorship W1998273216A5066791787 @default.
• W1998273216 hasAuthorship W1998273216A5074423495 @default.
• W1998273216 hasAuthorship W1998273216A5078432793 @default.
• W1998273216 hasBestOaLocation W19982732161 @default.
• W1998273216 hasConcept C100544194 @default.
• W1998273216 hasConcept C112613896 @default.
• W1998273216 hasConcept C174802600 @default.
• W1998273216 hasConcept C178790620 @default.
• W1998273216 hasConcept C185592680 @default.
• W1998273216 hasConcept C2776371256 @default.
• W1998273216 hasConcept C2776996202 @default.
• W1998273216 hasConcept C2780206646 @default.
• W1998273216 hasConcept C2780305828 @default.
• W1998273216 hasConcept C501593827 @default.
• W1998273216 hasConcept C521977710 @default.
• W1998273216 hasConcept C55493867 @default.
• W1998273216 hasConcept C86803240 @default.
• W1998273216 hasConcept C89423630 @default.
• W1998273216 hasConceptScore W1998273216C100544194 @default.
• W1998273216 hasConceptScore W1998273216C112613896 @default.
• W1998273216 hasConceptScore W1998273216C174802600 @default.

• next