FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1998607580> ?p ?o ?g. }

• W1998607580 endingPage "1727" @default.
• W1998607580 startingPage "1719" @default.
• W1998607580 abstract "Replication protein A (RPA) is a heterotrimeric single-stranded DNA-binding protein that participates in multiple DNA transactions that include replication and repair. Base excision repair is a central DNA repair pathway, responsible for the removal of damaged bases. We have shown previously that RPA was able to stimulate long patch base excision repair reconstituted in vitro. Herein we show that human RPA stimulates the activity of the base excision repair component human DNA ligase I by approximately 15-fold. Other analyzed single-stranded binding proteins would not substitute, attesting to the specificity of the stimulation. Conversely, RPA was unable to stimulate the functionally homologous ATP-dependent ligase from T4 bacteriophage. Kinetic analyses suggest that catalysis of ligation is enhanced by RPA, as a 4-fold increase in kcat is observed, whereasKm is not significantly changed. Substrate competition experiments further support the conclusion that RPA does not alter the specificity or rate of substrate binding by DNA ligase I. Additionally, RPA is unable to significantly enhance ligation on substrates containing an unannealed 3′-upstream primer terminus, suggesting that RPA does not stabilize the nick site to enhance ligase recognition. Furthermore when DNA ligase I is pre-bound to the substrate and limited to a single turnover, RPA is still able to stimulate ligation. Overall, the results support a mechanism of stimulation that involves increasing the rate of catalysis of ligation. Replication protein A (RPA) is a heterotrimeric single-stranded DNA-binding protein that participates in multiple DNA transactions that include replication and repair. Base excision repair is a central DNA repair pathway, responsible for the removal of damaged bases. We have shown previously that RPA was able to stimulate long patch base excision repair reconstituted in vitro. Herein we show that human RPA stimulates the activity of the base excision repair component human DNA ligase I by approximately 15-fold. Other analyzed single-stranded binding proteins would not substitute, attesting to the specificity of the stimulation. Conversely, RPA was unable to stimulate the functionally homologous ATP-dependent ligase from T4 bacteriophage. Kinetic analyses suggest that catalysis of ligation is enhanced by RPA, as a 4-fold increase in kcat is observed, whereasKm is not significantly changed. Substrate competition experiments further support the conclusion that RPA does not alter the specificity or rate of substrate binding by DNA ligase I. Additionally, RPA is unable to significantly enhance ligation on substrates containing an unannealed 3′-upstream primer terminus, suggesting that RPA does not stabilize the nick site to enhance ligase recognition. Furthermore when DNA ligase I is pre-bound to the substrate and limited to a single turnover, RPA is still able to stimulate ligation. Overall, the results support a mechanism of stimulation that involves increasing the rate of catalysis of ligation. base excision repair replication protein A apurinic/apyrimidinic proliferating cell nuclear antigen flap endonuclease 1 single-stranded binding protein Cells have evolved DNA repair mechanisms to protect the integrity and correct the informational content of the genome. Base excision repair (BER),1 the most frequently employed form of DNA repair, is responsible for the removal of bases that have become oxidized, alkylated, or deaminated (1Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4325) Google Scholar). Currently, it is estimated that there may be between 10,000 and 50,000 damaged sites/cell/day (1Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4325) Google Scholar, 2Lindahl T. Eur. J. Biochem. 1971; 18: 407-414Crossref PubMed Scopus (37) Google Scholar, 3Nakamura J. Walker V.E. Upton P.B. Chiang S.Y. Kow Y.W. Swenberg J.A. Cancer Res. 1998; 58: 222-225PubMed Google Scholar, 4Nakamura J. Swenberg J.A. Cancer Res. 1999; 59: 2522-2526PubMed Google Scholar, 5Atamna H. Cheung I. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 686-691Crossref PubMed Scopus (262) Google Scholar). The BER process is initiated by the actions of a damage-specific DNA N-glycosylase, responsible for both the recognition and the removal of altered bases (6Krokan H.E. Standal R. Slupphaug G. Biochem. J. 1997; 325: 1-16Crossref PubMed Scopus (726) Google Scholar, 7Krokan H.E. Nilsen H. Skorpen F. Otterlei M. Slupphaug G. FEBS Lett. 2000; 476: 73-77Crossref PubMed Scopus (310) Google Scholar). Removal results in the generation of an apurinic/apyrimidinic (AP) site, which is a substrate for an AP endonuclease. The predominant AP endonuclease in mammalian cells, Ape1 (also called HAP1/REF1/APE), is a multifunctional enzyme that is able to cleave 5′ to an abasic site (8Kane C.M. Linn S. J. Biol. Chem. 1981; 256: 3405-3414Abstract Full Text PDF PubMed Google Scholar, 9Demple B. Herman T. Chen D.S. Proc. Natl. Acad. Sci. U. S. A. 1991; 8: 11450-11454Crossref Scopus (474) Google Scholar, 10Robson C.N. Hickson I.D. Nucleic Acids Res. 1991; 19: 5519-5523Crossref PubMed Scopus (291) Google Scholar, 11Seki S. Akiyama K. Watanabe S. Hatsushika M. Ikeda S. Tsutsui K. J. Biol. Chem. 1991; 266: 20797-20802Abstract Full Text PDF PubMed Google Scholar, 12Seki S. Ikeda S. Watanabe S. Hatsushika M. Tsutsui K. Akiyama K. Zhang B. Biochim. Biophys. Acta. 1991; 1079: 57-64Crossref PubMed Scopus (75) Google Scholar, 13Seki S. Hatsushika M. Watanabe S. Akiyama K. Nagao K. Tsutsui K Biochim. Biophys. Acta. 1992; 1131: 287-299Crossref PubMed Scopus (112) Google Scholar). The cleavage generates a 3′-OH terminus capable of supporting DNA polymerization. However, it also leaves a baseless residue at the 5′ terminus, which must then be removed. BER can then proceed via two pathways, designated short patch or long patch repair (7Krokan H.E. Nilsen H. Skorpen F. Otterlei M. Slupphaug G. FEBS Lett. 2000; 476: 73-77Crossref PubMed Scopus (310) Google Scholar, 14Dianov G. Price A. Lindahl T. Mol. Cell. Biol. 1992; 12: 1605-1612Crossref PubMed Scopus (262) Google Scholar, 15Dianov G. Lindahl T. Curr. Biol. 1994; 4: 1069-1076Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 16Singhal R.K. Prasad R. Wilson S.H. J. Biol. Chem. 1995; 270: 949-957Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar, 17Frosina G. Fortini P. Rossi O. Carrozzino F. Raspaglio G. Cox L.S. Lane D.P. Abbondandolo A. Dogliotti E. J. Biol. Chem. 1996; 271: 9573-9578Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 18Dianov G. Bischoff C. Piotrowski J. Bohr V.A. J. Biol. Chem. 1998; 273: 33811-33816Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 19Biade S. Sobol R.W. Wilson S.H. Matsumoto Y. J. Biol. Chem. 1998; 273: 898-902Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 20Fortini P. Pascucci B. Parlanti E. Sobol R.W. Wilson S.H. Dogliotti E. Biochemistry. 1998; 37: 3575-3580Crossref PubMed Scopus (200) Google Scholar). In short patch repair, DNA polymerase β is responsible for the addition of a single nucleotide as well as the cleavage of the 5′-deoxyribose phosphate residue using an intrinsic deoxyribosephosphate lyase activity (21Matsumoto Y. Kim K. Science. 1995; 269: 699-702Crossref PubMed Scopus (647) Google Scholar, 22Bennett R.A. Wilson III, D.M. Wong D. Demple B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7166-7169Crossref PubMed Scopus (326) Google Scholar, 23Podlutsky A.J. Dianova I.I. Wilson S.H. Bohr V.A. Dianov G.L. Biochemistry. 2001; 40: 809-813Crossref PubMed Scopus (56) Google Scholar). Finally, a DNA ligase can seal the nick to complete repair. This results in the replacement of only the damaged nucleotide. Alternatively, in vivo, a portion of the AP sites become oxidized prior to repair (18Dianov G. Bischoff C. Piotrowski J. Bohr V.A. J. Biol. Chem. 1998; 273: 33811-33816Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 19Biade S. Sobol R.W. Wilson S.H. Matsumoto Y. J. Biol. Chem. 1998; 273: 898-902Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 24Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (661) Google Scholar). The deoxyribosephosphate lyase activity of polymerase β is now unable to remove the chemically altered abasic sugar. Instead, a DNA polymerase (β, δ, or ε) will then displace the baseless sugar along with several additional nucleotides forming a single-stranded flap (25Stucki M. Pascucci B. Parlanti E. Fortini P. Wilson S.H. Hubscher U. Dogliotti E. Oncogene. 1998; 17: 835-843Crossref PubMed Scopus (160) Google Scholar). The flap is a substrate for the flap endonuclease 1 (FEN1) (26Murante R.S. Huang L. Turchi J.J. Bambara R.A. J. Biol. Chem. 1994; 269: 1191-1196Abstract Full Text PDF PubMed Google Scholar, 27Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (373) Google Scholar). FEN1 cleaves at the base of the flap generating a nick, which can then be sealed by DNA ligase I (28Tomkinson A.E. Lasko D.D. Daly G. Lindahl T. J. Biol. Chem. 1990; 265: 12611-12617Abstract Full Text PDF PubMed Google Scholar, 29Teraoka H. Minami H. Iijima S. Tsukada K. Koiwai O. Date T. J. Biol. Chem. 1993; 268: 24156-24162Abstract Full Text PDF PubMed Google Scholar). Long patch repair results in the removal and replacement of between 2 and 8 nucleotides. Interestingly, many of the proteins involved in long patch BER are also components of the DNA replication machinery, providing a mechanistic link between the BER and DNA replication complexes (30DeMott M.S. Shen B. Park M.S. Bambara R.A. Zigman S. J. Biol. Chem. 1996; 271: 30068-30076Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 31Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 32Tomkinson A.E. Levin D.S. Bioessays. 1997; 19: 893-901Crossref PubMed Scopus (100) Google Scholar, 33Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 34Tomkinson A.E. Mackey Z.B. Mutat. Res. 1998; 407: 1-9Crossref PubMed Scopus (175) Google Scholar, 35Timson D.J. Singleton M.R. Wigley D.B. Mutat. Res. 2000; 460: 301-318Crossref PubMed Scopus (128) Google Scholar). A minimal repair complex containing FEN1, polymerase β, δ, or ε, and DNA ligase I is necessary to complete the long patch repair reaction in vitro (19Biade S. Sobol R.W. Wilson S.H. Matsumoto Y. J. Biol. Chem. 1998; 273: 898-902Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 24Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (661) Google Scholar, 33Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 36Matsumoto Y. Kim K. Hurwitz J. Gary R. Levin D.S. Tomkinson A.E. Park M.S. J. Biol. Chem. 1999; 274: 33703-33708Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). In addition to the minimal complex, a variety of other accessory proteins influence the efficiency of the reaction, suggesting their participation in vivo. Both proliferating cell nuclear antigen (PCNA) and RPA, two proteins that are essential for DNA replication, are also participants in DNA repair, including BER (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 38Dianov G.L. Jensen B.R. Kenny M.K. Bohr V.A. Biochemistry. 1999; 38: 11021-11025Crossref PubMed Scopus (48) Google Scholar, 39Gary R. Kim K. Cornelius H.L. Park M.S. Matsumoto Y. J. Biol. Chem. 1999; 274: 4354-4363Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 40Otterlei M. Warbrick E. Nagelhus T.A. Haug T. Slupphaug G. Akbari M. Aas P.A. Steinsbekk K. Bakke O. Krokan H.E. EMBO J. 1999; 18: 3834-3844Crossref PubMed Scopus (295) Google Scholar). PCNA has been shown to directly interact with both FEN1 and DNA ligase I and stimulate their activities (41Li X. Li J. Harrington J. Lieber M.R. Burgers P.M. J. Biol. Chem. 1995; 270: 22109-22112Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 42Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar, 43Jonsson Z.O. Hindges R. Hubscher U. EMBO J. 1998; 17: 2412-2425Crossref PubMed Scopus (235) Google Scholar, 44Montecucco A. Rossi R. Levin D.S. Gary R. Park M.S. Motycka T.A. Ciarrocchi G. Villa A. Biamonti G. Tomkinson A.E. EMBO J. 1998; 17: 3786-3795Crossref PubMed Scopus (172) Google Scholar, 45Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 46Tom S. Henricksen L.A. Park M.S. Bambara R.A. J. Biol. Chem. 2001; 276: 24817-24825Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Both stimulation mechanisms have been investigated thoroughly and shown to be mediated through an increase in enzyme-substrate binding (45Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 46Tom S. Henricksen L.A. Park M.S. Bambara R.A. J. Biol. Chem. 2001; 276: 24817-24825Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). More efficient binding increases the overall efficiency of both the cleavage and ligation reactions. The results portray PCNA as a targeting and assembly component of DNA replication and repair protein complexes. The roles of RPA in both DNA replication and nucleotide excision repair are well established (47Wold M.S. Annu. Rev. Biochem. 1997; 66: 61-92Crossref PubMed Scopus (1178) Google Scholar, 48Iftode C. Daniely Y. Borowiec J.A. Crit. Rev. Biochem. Mol. Biol. 1999; 34: 141-180Crossref PubMed Scopus (395) Google Scholar). For example, during DNA replication, RPA participates in the recognition and unwinding of the origin, binds to the single-stranded DNA to prevent secondary structure formation, and stimulates polymerase α through direct protein-protein interactions (49Collins K.L. Kelly T.J. Mol. Cell. Biol. 1991; 11: 2108-2115Crossref PubMed Google Scholar, 50Dornreiter I. Erdile L.F. Gilbert I.U. von Winkler D. Kelly T.J. Fanning E. EMBO J. 1992; 11: 769-776Crossref PubMed Scopus (285) Google Scholar, 51Longhese M.P. Plevani P. Lucchini G. Mol. Cell. Biol. 1994; 14: 7884-7890Crossref PubMed Scopus (114) Google Scholar, 52Bullock P.A. Crit. Rev. Biochem. Mol. Biol. 1997; 32: 503-568Crossref PubMed Scopus (133) Google Scholar). Considerable evidence links RPA to BER, but the contributions of the binding protein have not been determined. RPA has been shown to interact directly with the major nuclear DNA glycosylase, the uracil-DNA glycosylase (53Nagelhus T.A. Haug T. Singh K.K. Keshav K.F. Skorpen F. Otterlei M. Bharati S. Lindmo T. Benichou S. Benarous R. Krokan H.E. J. Biol. Chem. 1997; 272: 6561-6566Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 54Mer G. Bochkarev A. Gupta R. Bochkareva E. Frappier L. Ingles C.J. Edwards A.M. Chazin W.J. Cell. 2000; 103: 449-456Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Recent crystal structure data specifically localize the interaction between RPA and uracil-DNA glycosylase to the C-terminal region of the RPA 32 subunit (54Mer G. Bochkarev A. Gupta R. Bochkareva E. Frappier L. Ingles C.J. Edwards A.M. Chazin W.J. Cell. 2000; 103: 449-456Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). This interaction might target RPA binding specifically to sites of base damage. Yet, RPA does not alter the enzymatic activity of the glycosylase. In another observation, yeast that contain a defective RFA1 gene (encoding the yeast homolog to the large subunit of RPA) are sensitive to methyl methane sulfonate, a DNA damaging agent that produces lesions repaired by BER (55Umezu K. Sugawara N. Chen C. Haber J.E. Kolodner R.D. Genetics. 1998; 148: 989-1005Crossref PubMed Google Scholar). Although not defining mechanism, these results strongly suggest that RPA is a component of the BER complex. Interestingly, when the final steps of long patch BER were reconstituted in vitro using only FEN1, calf polymerase ε, and DNA ligase I, the addition of RPA produced a manyfold stimulation of product formation (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Furthermore, RPA has been shown to influence the rate of long patch repair using mammalian cell extracts in cooperation with PCNA (38Dianov G.L. Jensen B.R. Kenny M.K. Bohr V.A. Biochemistry. 1999; 38: 11021-11025Crossref PubMed Scopus (48) Google Scholar). Again, the actual function of RPA in the process is unclear. In some studies of reconstituted BER reactions in vitro, stimulation by RPA has not been observed (36Matsumoto Y. Kim K. Hurwitz J. Gary R. Levin D.S. Tomkinson A.E. Park M.S. J. Biol. Chem. 1999; 274: 33703-33708Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 56Pascucci B. Stucki M. Jonsson Z.O. Dogliotti E. Hubscher U. J. Biol. Chem. 1999; 274: 33696-33702Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). This suggests that the concentrations of reaction components are critical determinants of the amount of stimulation. Very likely RPA stimulates a reaction component that limits the overall rate of BER. If that component is present in a sufficiently high concentration in vitro, the stimulatory effects may be masked. An approach to determine the role of RPA in BER is to examine its effect upon individual steps in the reaction. A final step in both BER and the joining of nascent DNA fragments in DNA replication is the ligation reaction. Of the four known DNA ligases in mammalian cells, DNA ligase I has been linked to both DNA replication and BER (57Waga S. Bauer G. Stillman B. J. Biol. Chem. 1994; 269: 10923-10934Abstract Full Text PDF PubMed Google Scholar, 58Levin D.S. Bai W. Yao N. O'Donnell M. Tomkinson A.E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12863-12868Crossref PubMed Scopus (196) Google Scholar, 59Levin D.S. McKenna A.E. Motycka T.A. Matsumoto Y. Tomkinson A.E. Curr. Biol. 2000; 10: 919-922Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). DNA ligase I was also utilized for the in vitroreconstitution of long patch BER wherein RPA stimulation was observed (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). The quantity of DNA ligase used in our in vitro BER reconstitution reactions was not saturating, allowing for a reaction component that stimulates DNA ligase to increase overall product formation. DNA ligases catalyze esterification of the 3′-OH and a 5′-phosphate termini of a nick in double-stranded DNA. Mammalian DNA ligases require a divalent cation and ATP for catalysis. The reaction mechanism for ligation has been elucidated previously, and involves at least three sequential steps (60Weiss B. Richardson C.C. J. Biol. Chem. 1967; 242: 4270-4272Abstract Full Text PDF PubMed Google Scholar, 61Weiss B. Thompson A. Richardson C.C. J. Biol. Chem. 1968; 243: 4556-4563Abstract Full Text PDF PubMed Google Scholar, 62Weiss B. Jacquemin-Sablon A. Live T.R. Fareed G.C. Richardson C.C. J. Biol. Chem. 1968; 243: 4543-4555Abstract Full Text PDF PubMed Google Scholar, 63Weiss B. Live T.R. Richardson C.C. J. Biol. Chem. 1968; 243: 4530-4542Abstract Full Text PDF PubMed Google Scholar, 64Modrich P. Anraku Y. Lehman I.R. J. Biol. Chem. 1973; 248: 7495-7501Abstract Full Text PDF PubMed Google Scholar, 65Lehman I.R. Science. 1974; 186: 790-797Crossref PubMed Scopus (470) Google Scholar). In the first, DNA ligase interacts with ATP to generate a ligase-adenylate covalent intermediate with the concomitant release of pyrophosphate (PPi). The ligase-adenylate can then bind to the 5′-phosphate terminus and transfer the AMP to form a DNA-AMP intermediate. Finally, the ligase catalyzes the reaction between the DNA-AMP and the 3′-OH terminus to join the two repaired strands together and releases the AMP. Crystallographic studies of the eukaryotic ATP-dependent DNA ligase from Chorella virus have shed some light on the complicated chemistry of the ligation reaction. They show that the ATP-dependent ligases undergo significant conformational changes associated with the chemical steps of the ligation reaction mechanism (66Odell M. Sriskanda V.V. Shuman S. Nikolov D.B. Mol. Cell. 2000; 6: 1183-1193Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). We show here for the first time that RPA is able to stimulate DNA ligase I and the mechanism underlying stimulation involves an increase in the rate of the chemical step of ligation. Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA) or by Genosys Biotechnologies (The Woodlands, TX). Radionucleotides [γ-32P]ATP (3000 Ci/mmol) were obtained from PerkinElmer Life Sciences. The T4 polynucleotide kinase and the T4 DNA ligase were obtained from Roche Molecular Biochemicals.Escherichia coli single-stranded DNA-binding protein (SSB) was obtained from Promega. Micro Bio-Spin 30 chromatography columns were obtained from Bio-Rad. All other reagents were the best available commercial grade. Recombinant human DNA ligase I and recombinant human RPA were overexpressed and purified as described previously (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Purified DNA ligase I was dialyzed into storage buffer (30 mm HEPES (pH 7.5), 10% glycerol, 15% sucrose, 25 mm KCl, 1 mm dithiothreitol, 0.01% Nonidet P-40, and 1 mm EDTA) and stored at −80 °C. Oligomer sequences are listed in Table I, and the primer-template substrates for each individual experiment were constructed as described in the figure legends. In all substrates, the 3′ end regions of the downstream primers share homology with the 5′ ends of their respective templates. The 5′-radioactive end-labeled primers were generated by incubating the oligonucleotide with [γ-32P]ATP and T4 polynucleotide kinase for 1 h at 37 °C. Unincorporated radionucleotides were removed using Micro Bio-Spin 30 chromatography columns. The radiolabeled primers were then purified on a 15% polyacrylamide, 7 m urea denaturing gel. Each respective upstream primer was annealed to the proper template to generate a nick between the 3′ end of the upstream primer and the 5′ end of the downstream primer. Substrates were annealed by mixing 1 pmol of the respective downstream primer with 5 pmol of the corresponding template in annealing buffer (10 mm Tris base, 50 mm KCl, and 1 mm EDTA (pH 8.0)) to a final volume of 25 μl. The mixture was heated to 65 °C for 10 min and allowed to cool to room temperature. Finally, 10 pmol of the corresponding upstream primer was added and annealed by incubating at 37 °C for 1 h. Double-stranded nonradioactive oligonucleotide substrates utilized in Fig. 5 were generated by annealing the appropriate primer and template at a 2:1 ratio in the annealing buffer described above. The mixture was heated to 65 °C for 10 min and allowed to cool to room temperature.Table IOligonucleotide sequences (5′–3′)Downstream primers D1(18-mer)GTAAAACGACGGCCAGTG D2(42-mer)UACCCCCCGTATGGATCCAACCAAGCTTCGACGTAATGCAAGG1-aU is defined as deoxyuridine. D3(44-mer)CGTGACCGGCAGCAAAATGCCAGCACTGACCCTTTTGGGACCGC D4 (28-mer)CCACCCGTCCACCCGACGCCACCTCCTGUpstream primers U1 (25-mer)CGCCAGGGTTTTCCCAGTCACGACC U2 (31-mer)TCCAGCTAAACCAATTGGCGCAATGGACCGG U3 (25-mer)CGACCGTGCCAGCCTAAATTTCAAT U4(25-mer)CGACCGTGCCAGCCTAAATTTCAACTemplates T1(44-mer)GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCG T2(73-mer)TTGCATTACGTCGAAGCTTGGTTGGATCCATACGGGGGTACCGGTCCATTGCGCCAATTGGTTTAGCTGGAGG T3(54-mer)GCAGGAGGTGGCGTCGGGTGGACGGGTGGATTGAAATTTAGGCTGGCACGGTCG1-a U is defined as deoxyuridine. Open table in a new tab Reactions containing the indicated amounts of radiolabeled substrate, DNA ligase I or T4 ligase, and RPA or SSB were performed in a buffer consisting of 30 mm HEPES (pH 7.6), 40 mm KCl, 0.01% Nonidet P-40, 0.1 mg/ml bovine serum albumin, 8 mm MgCl2, and 0.1 mm ATP. The reaction volume was 20 μl unless otherwise indicated. Reactions were incubated at either 37 or 30 °C as indicated, terminated with 15 μl of formamide dye (90% formamide (v/v) with bromphenol blue and xylene cyanol), and heated to 95 °C for 5 min. Upon separation on a 15% polyacrylamide, 7 murea denaturing gel, products were detected by PhosphorImager (Molecular Dynamics) analysis. The single-turnover assay was done under identical conditions with the exception of the 0.1 mmATP. Ligation reactions were performed at 30 °C in accordance with the conditions described above for the enzymatic assays. The substrate comprised D1:U1:T1 (see TableI). Varying amounts of substrate (5, 10, 15, 20, 35, 50, 75, and 100 fmol), and a fixed amount of DNA ligase I (0.25 fmol) were utilized. Assays were performed in triplicate. Enzyme, substrate, and reaction buffer lacking MgCl2 were combined and initiated by the addition of 8 mm MgCl2. Reactions that contained RPA were performed identically with the exception of the addition of 250 fmol of RPA prior to the initiation of the reaction. Reactions were terminated at 2 min by the addition of 20 μl of formamide dye (90% formamide (v/v) with bromphenol blue and xylene cyanol), and heated to 95 °C for 5 min. The initial velocity was determined by measuring the substrate and product intensities on a denaturing 15% polyacrylamide, 7 m urea gel using PhosphorImager analysis. The velocity is expressed as the amount of substrate converted (nmol) over time (s). Km andVmax values were calculated by directly fitting the data obtained to the Michaelis-Menten equation.kcat values were determined by dividing theVmax by the enzyme concentration utilized in the experiments. Previous studies have demonstrated that RPA is recruited to sites of repair through a specific interaction with uracil DNA glycosylase (53Nagelhus T.A. Haug T. Singh K.K. Keshav K.F. Skorpen F. Otterlei M. Bharati S. Lindmo T. Benichou S. Benarous R. Krokan H.E. J. Biol. Chem. 1997; 272: 6561-6566Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). Subsequently, RPA was shown to enhance the efficiency of long patch BER (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 38Dianov G.L. Jensen B.R. Kenny M.K. Bohr V.A. Biochemistry. 1999; 38: 11021-11025Crossref PubMed Scopus (48) Google Scholar). Experiments analyzing the effects of RPA upon the individual enzymes involved in long patch BER focus here on DNA ligase I. Fig. 1A shows a titration of RPA into reactions containing human DNA ligase I at either 0.02 nm (left panel) or 0.06 nm(right panel) concentrations. The reactions were performed in substrate excess so that the amount of product formation is indicative of the reaction rate. Upon addition of RPA to the ligation reactions, an increase in the amount of ligation product was observed (lanes 3–6 and 8–11). Fig. 1B is the graphical analysis of the results from three independent experiments performed as shown in Fig. 1A. The graph depicts the -fold stimulation of ligation product formation as a function of RPA concentration for both tested ligase concentrations. There was a consistent increase in ligation rate, and thus -fold stimulation, with increasing concentrations of RPA over the tested range. Furthermore, the stimulation was independent of DNA ligase concentration within the tested range. RPA-mediated stimulation of ligation rate was maximally 15-fold compared with reactions lacking RPA. It was necessary to include a molar excess of RPA in these and in subsequent experiments. This was because the annealing reactions performed to generate the nicked substrate contain an excess of single-stranded DNA that is capable of binding to and sequestering the RPA. The presence of single-stranded DNA at the levels used here has negligible effects upon ligation activity (data not shown). The substrate utilized was identical to the one used in a previous analysis of BER with RPA (37DeMott M.S. Zigman S. Bambara R.A. J. Biol. Chem. 1998; 273: 27492-27498Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). To clarify the specificity of the functional interaction between RPA and DNA ligase I, we determined whether RPA could stimulate another ATP-dependent ligase. RPA was titrated into a reaction containing the bacteriophage T4 ligase (Fig.2). Stimulation of T4 ligase would suggest that the stimulation mechanism is independent of the ligase structure. For example, it could have involved an alteration in substrate structure that improves access of the ligase to the nick. Specificity for DNA ligase I would imply that the mechanism involves a direct improvement of ligase function. Titration of RPA into the T4 ligase reactions (lanes 1–9) shows that there is no enhancement of the accumulation of ligation product as compared with the reactions containing human DNA ligase I (lanes 10–18). Additionally, we demonstrated stimulation of DNA ligase I on a different substrate (both in sequence and length) than tested in Fig. 1to ensure that RPA directed stimulation was not based upon a unique interaction with a specific substrate. To determine whether other single-stranded binding proteins are also able to stimulate DNA ligase I activity, we titrated E. coli SSB into reactions containing DNA ligase I. The conversion of radiolabeled substrate to ligation product in the" @default.
• W1998607580 created "2016-06-24" @default.
• W1998607580 creator A5001420469 @default.
• W1998607580 creator A5005315226 @default.
• W1998607580 creator A5027181371 @default.
• W1998607580 date "2002-01-01" @default.
• W1998607580 modified "2023-10-17" @default.
• W1998607580 title "Mechanism Underlying Replication Protein A Stimulation of DNA Ligase I" @default.
• W1998607580 cites W1489254411 @default.
• W1998607580 cites W1510858660 @default.
• W1998607580 cites W1516514485 @default.
• W1998607580 cites W1525930814 @default.
• W1998607580 cites W1547755849 @default.
• W1998607580 cites W1551501987 @default.
• W1998607580 cites W1559100537 @default.
• W1998607580 cites W1566131689 @default.
• W1998607580 cites W1574971610 @default.
• W1998607580 cites W1577831872 @default.
• W1998607580 cites W1590134197 @default.
• W1998607580 cites W1595631525 @default.
• W1998607580 cites W1597899204 @default.
• W1998607580 cites W1729887059 @default.
• W1998607580 cites W1845321470 @default.
• W1998607580 cites W1965446460 @default.
• W1998607580 cites W1968476315 @default.
• W1998607580 cites W1968760263 @default.
• W1998607580 cites W1970566518 @default.
• W1998607580 cites W1974823582 @default.
• W1998607580 cites W1976548111 @default.
• W1998607580 cites W1978124987 @default.
• W1998607580 cites W1983825041 @default.
• W1998607580 cites W1984987874 @default.
• W1998607580 cites W1994232734 @default.
• W1998607580 cites W1994245744 @default.
• W1998607580 cites W1999423188 @default.
• W1998607580 cites W2000479074 @default.
• W1998607580 cites W2000605935 @default.
• W1998607580 cites W2003329456 @default.
• W1998607580 cites W2004442904 @default.
• W1998607580 cites W2011649399 @default.
• W1998607580 cites W2012291005 @default.
• W1998607580 cites W2019777050 @default.
• W1998607580 cites W2020134525 @default.
• W1998607580 cites W2020633581 @default.
• W1998607580 cites W2028025897 @default.
• W1998607580 cites W2028513756 @default.
• W1998607580 cites W2033676950 @default.
• W1998607580 cites W2035746057 @default.
• W1998607580 cites W2035932182 @default.
• W1998607580 cites W2037240454 @default.
• W1998607580 cites W2038350526 @default.
• W1998607580 cites W2041149390 @default.
• W1998607580 cites W2044064237 @default.
• W1998607580 cites W2047472296 @default.
• W1998607580 cites W2051555627 @default.
• W1998607580 cites W2064477710 @default.
• W1998607580 cites W2064538331 @default.
• W1998607580 cites W2065986032 @default.
• W1998607580 cites W2071457845 @default.
• W1998607580 cites W2078424943 @default.
• W1998607580 cites W2079497347 @default.
• W1998607580 cites W2088867782 @default.
• W1998607580 cites W2093369849 @default.
• W1998607580 cites W2109263179 @default.
• W1998607580 cites W2114539716 @default.
• W1998607580 cites W2122002835 @default.
• W1998607580 cites W2134259738 @default.
• W1998607580 cites W2134327149 @default.
• W1998607580 cites W2137026987 @default.
• W1998607580 cites W2142485616 @default.
• W1998607580 cites W2164143121 @default.
• W1998607580 cites W2171775098 @default.
• W1998607580 cites W2398980959 @default.
• W1998607580 cites W2462318323 @default.
• W1998607580 doi "https://doi.org/10.1074/jbc.m109053200" @default.
• W1998607580 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11698410" @default.
• W1998607580 hasPublicationYear "2002" @default.
• W1998607580 type Work @default.
• W1998607580 sameAs 1998607580 @default.
• W1998607580 citedByCount "25" @default.
• W1998607580 countsByYear W19986075802012 @default.
• W1998607580 countsByYear W19986075802013 @default.
• W1998607580 countsByYear W19986075802015 @default.
• W1998607580 countsByYear W19986075802016 @default.
• W1998607580 countsByYear W19986075802017 @default.
• W1998607580 countsByYear W19986075802018 @default.
• W1998607580 countsByYear W19986075802021 @default.
• W1998607580 crossrefType "journal-article" @default.
• W1998607580 hasAuthorship W1998607580A5001420469 @default.
• W1998607580 hasAuthorship W1998607580A5005315226 @default.
• W1998607580 hasAuthorship W1998607580A5027181371 @default.
• W1998607580 hasBestOaLocation W19986075801 @default.
• W1998607580 hasConcept C121332964 @default.
• W1998607580 hasConcept C12590798 @default.
• W1998607580 hasConcept C159047783 @default.
• W1998607580 hasConcept C169760540 @default.
• W1998607580 hasConcept C175114707 @default.
• W1998607580 hasConcept C185592680 @default.

• next