Matches in SemOpenAlex for { <https://semopenalex.org/work/W1999532904> ?p ?o ?g. }
- W1999532904 endingPage "21890" @default.
- W1999532904 startingPage "21881" @default.
- W1999532904 abstract "Chondrosarcoma is a primary bone tumor with a dismal prognosis; most patients with this disease develop fatal pulmonary metastases, suggesting the need for a better systemic treatment. Anti-angiogenesis treatment may be useful, because angiogenesis is critical for both tumor growth and metastasis. Vascular endothelial growth factor (VEGF) is the most potent pro-angiogenic factor and is regulated by pathways related to the normal physiologic response to hypoxia and genetic alterations related to the malignant phenotype. Our prior work has shown that VEGF is overexpressed in high grade chondrosarcoma and chondrosarcoma cell lines. Working on the premise that developmental pathways giving a selective growth advantage are often recapitulated in tumors, we investigated the regulation of VEGF by HDAC4 and Runx2 in chondrosarcoma. We tested the hypothesis that there is dysregulation of HDAC4/Runx2/VEGF gene expression and that decreased HDAC4 expression accounts for at least some of the increased VEGF expression seen in chondrosarcoma. We show that reduced expression of HDAC4 in chondrosarcoma cells increases expression of Runx2 leading to increased expression of VEGF and in vitro angiogenesis. Thus, both hypoxia and dysregulated expression of a developmental pathway are causes of increased VEGF expression in chondrosarcoma. Chondrosarcoma is a primary bone tumor with a dismal prognosis; most patients with this disease develop fatal pulmonary metastases, suggesting the need for a better systemic treatment. Anti-angiogenesis treatment may be useful, because angiogenesis is critical for both tumor growth and metastasis. Vascular endothelial growth factor (VEGF) is the most potent pro-angiogenic factor and is regulated by pathways related to the normal physiologic response to hypoxia and genetic alterations related to the malignant phenotype. Our prior work has shown that VEGF is overexpressed in high grade chondrosarcoma and chondrosarcoma cell lines. Working on the premise that developmental pathways giving a selective growth advantage are often recapitulated in tumors, we investigated the regulation of VEGF by HDAC4 and Runx2 in chondrosarcoma. We tested the hypothesis that there is dysregulation of HDAC4/Runx2/VEGF gene expression and that decreased HDAC4 expression accounts for at least some of the increased VEGF expression seen in chondrosarcoma. We show that reduced expression of HDAC4 in chondrosarcoma cells increases expression of Runx2 leading to increased expression of VEGF and in vitro angiogenesis. Thus, both hypoxia and dysregulated expression of a developmental pathway are causes of increased VEGF expression in chondrosarcoma. Chondrosarcomas are mesenchymal tumors in which the primary tissue is cartilage; they include 20% of primary bone tumors and occur in patients of all ages (1Huvos A.G. Bone Tumors Diagnosis, Treatment and Prognosis.2nd Ed. W. B. Saunders Co., Philadelphia1991: 343-365Google Scholar, 2Landis S.H. Murray T. Bolden S. Wingo P.A. CA Cancer J. Clin. 1999; 49 (1): 8-31Crossref PubMed Scopus (3128) Google Scholar). Chondrosarcomas are difficult tumors to cure, because they are unresponsive to the standard adjuvant treatment, chemotherapy (3Terek R.M. Schwartz G.K. Devaney K. Glantz L. Mak S. Healey J.H. Albino A.P. J. Orthop. Res. 1998; 16: 585-590Crossref PubMed Scopus (95) Google Scholar) and radiation therapy (4Moussavi-Harami F. Mollano A. Martin J.A. Ayoob A. Domann F.E. Gitelis S. Buckwalter J.A. Biochem. Biophys. Res. Commun. 2006; 346: 379-385Crossref PubMed Scopus (53) Google Scholar), resulting in cure rates of less than 10% (5Lee F.Y. Mankin H.J. Fondren G. Gebhardt M.C. Springfield D.S. Rosenberg A.E. Jennings L.C. J. Bone Joint Surg. Am. 1999; 81: 326-338Crossref PubMed Scopus (80) Google Scholar, 6Capanna R. Bertoni F. Bettelli G. Picci P. Bacchini P. Present D. Giunti A. Campanacci M. J. Bone Joint Surg. 1988; 70: 60-69Crossref PubMed Scopus (87) Google Scholar), with the vast majority of patients succumbing to pulmonary metastases. Angiogenesis is critical for both tumor growth and development of metastases, and inhibiting angiogenesis has become a therapeutic strategy. We have demonstrated that grade II and III chondrosarcomas have more microvascularity than benign or grade I tumors (7McGough R.L. Aswad B.I. Terek R.M. Clin. Orthop. 2002; 397: 76-82Crossref PubMed Scopus (28) Google Scholar) and that these tumors overexpress vascular endothelial growth factor (VEGF) 2The abbreviations used are: VEGFvascular endothelial growth factorRunx2runt-related transcription factor 2HDAChistone deacetylaseqPCRreal time RT-PCRCMconditioned mediaHUVEChuman umbilical vein endothelial cellHIF-1αhypoxia inducing factor 1-alphaEVempty vectorH4HDAC4ChIPchromatin immunoprecipitationHAhemagglutininsiRNAsmall interfering RNAELISAenzyme-linked immunosorbent assayCSchondrosarcomaCBPcAMP-response element-binding protein (CREB)-binding protein. 2The abbreviations used are: VEGFvascular endothelial growth factorRunx2runt-related transcription factor 2HDAChistone deacetylaseqPCRreal time RT-PCRCMconditioned mediaHUVEChuman umbilical vein endothelial cellHIF-1αhypoxia inducing factor 1-alphaEVempty vectorH4HDAC4ChIPchromatin immunoprecipitationHAhemagglutininsiRNAsmall interfering RNAELISAenzyme-linked immunosorbent assayCSchondrosarcomaCBPcAMP-response element-binding protein (CREB)-binding protein. (8McGough R.L. Lin C. Meitner P. Aswad B.I. Terek R.M. Clin. Orthop. 2002; 397: 62-69Crossref PubMed Scopus (32) Google Scholar). Because VEGF is the most important proangiogenic molecule and is overexpressed in high grade chondrosarcoma, we have focused on the regulation of VEGF in this tumor. vascular endothelial growth factor runt-related transcription factor 2 histone deacetylase real time RT-PCR conditioned media human umbilical vein endothelial cell hypoxia inducing factor 1-alpha empty vector HDAC4 chromatin immunoprecipitation hemagglutinin small interfering RNA enzyme-linked immunosorbent assay chondrosarcoma cAMP-response element-binding protein (CREB)-binding protein. vascular endothelial growth factor runt-related transcription factor 2 histone deacetylase real time RT-PCR conditioned media human umbilical vein endothelial cell hypoxia inducing factor 1-alpha empty vector HDAC4 chromatin immunoprecipitation hemagglutinin small interfering RNA enzyme-linked immunosorbent assay chondrosarcoma cAMP-response element-binding protein (CREB)-binding protein. VEGF expression is determined by normal physiologic hypoxia-related pathways and genetic abnormalities. We know that both of these broad categories of gene regulation are operational in chondrosarcomas. Included in genetic abnormalities are epigenetic phenomena such as DNA methylation and histone modification that regulate chromatin structure and gene expression (9Rountree M.R. Bachman K.E. Herman J.G. Baylin S.B. Oncogene. 2001; 20: 3156-3165Crossref PubMed Scopus (343) Google Scholar). Both histone acetylases and histone deacetylases (HDACs) are key enzymes that catalyze the reversible acetylation/deacetylation of core histone tails, which is an essential mechanism of the epigenetic control of gene expression (10Tsukiyama T. Wu C. Curr. Opin. Genet. Dev. 1997; 7: 182-191Crossref PubMed Scopus (191) Google Scholar). HDACs function as transcriptional co-repressors. HDACs can deacetylate DNA binding transcription factors, thereby decreasing their binding affinity, localization, and half-life (11Vega R.B. Matsuda K. Oh J. Barbosa A.C. Yang X. Meadows E. McAnally J. Pomajzl C. Shelton J.M. Richardson J.A. Karsenty G. Olson E.N. Cell. 2004; 119: 555-566Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar). The activity of HDACs is affected by their phosphorylation state, thereby linking them to cell signaling pathways (12Zheng Q. Sebald E. Zhou G. Chen Y. Wilcox W. Lee B. Krakow D. Am. J. Hum. Genet. 2005; 77: 305-312Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). The mammalian HDACs fall into three classes based on their structural and biochemical characteristics (13Verdin E. Dequiedt F. Kasler H.G. Trends Genet. 2003; 19: 286-293Abstract Full Text Full Text PDF PubMed Scopus (545) Google Scholar). Recent studies show that the class II HDACs are involved in cellular differentiation and developmental processes, and their dysregulation may be involved in carcinogenesis. HDAC4 along with -5, -7, and -9 compose the class IIa HDACs. Class I HDACs are ubiquitously expressed, whereas class II HDACs have tissue-specific expression and regulate cell differentiation. HDAC4 is expressed in muscle, brain, and cartilage. Targets of HDAC4 include Runx1 and Runx2. Runx2 is important for skeletal development. There has been no direct link established between HDAC4 and angiogenesis; however, in the growth plate, HDAC4 is expressed in prehypertrophic chondrocytes and regulates chondrocyte hypertrophy and endochondral bone formation by binding and inhibiting the activity of Runx2/Cbfa1 (11Vega R.B. Matsuda K. Oh J. Barbosa A.C. Yang X. Meadows E. McAnally J. Pomajzl C. Shelton J.M. Richardson J.A. Karsenty G. Olson E.N. Cell. 2004; 119: 555-566Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar) and induces cell death in a caspase-9-dependent manner (14Paroni G. Mizzau M. Henderson C. Del Sal G. Schneider C. Brancolini C. Mol. Biol. Cell. 2004; 15: 2804-2818Crossref PubMed Scopus (112) Google Scholar). Runx2 is a transcription factor that is necessary for chondrocyte hypertrophy and endochondral ossification (11Vega R.B. Matsuda K. Oh J. Barbosa A.C. Yang X. Meadows E. McAnally J. Pomajzl C. Shelton J.M. Richardson J.A. Karsenty G. Olson E.N. Cell. 2004; 119: 555-566Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar). HDAC4 expression decreases in the more mature hypertrophic chondrocytes, releasing Runx2 activity, and endochondral ossification ensues. Runx2 is known to up-regulate VEGF expression during endochondral bone formation, and both changes in HDAC4 and Runx2 expression are necessary for this process to occur (15Zelzer E. Glotzer D.J. Hartmann C. Thomas D. Fukai N. Soker S. Olsen B.R. Mech. Dev. 2001; 106: 97-106Crossref PubMed Scopus (296) Google Scholar). The functions of HDAC4 and Runx2 in the growth plate have been demonstrated in HDAC4 knock-out and Runx2 gain of function mice in which there is premature ossification of the growth plate in both models. Overexpression of Runx2 in fibroblasts induces an increase in their VEGF mRNA level and protein production (15Zelzer E. Glotzer D.J. Hartmann C. Thomas D. Fukai N. Soker S. Olsen B.R. Mech. Dev. 2001; 106: 97-106Crossref PubMed Scopus (296) Google Scholar). In chondrosarcoma, overexpression of Runx2 has been detected in high grade tumors, although its significance has been heretofore unknown (16Papachristou D.J. Papachristou G.I. Papachristou G.J. Papaefthimiou O.A. Agnantis N.J. Basdra E.K. Papavassiliou A.G. Histopathology. 2005; 47: 565-574PubMed Google Scholar, 17Park H.R. Park Y.K. Pathol. Oncol. Res. 2007; 13: 32-37Crossref PubMed Scopus (12) Google Scholar). In lung cancer patients, reduced expression of class II HDACs is associated with poor progression (18Osada H. Tatematsu Y. Saito H. Yatabe Y. Mitsudomi T. Takahashi T. Int. J. Cancer. 2004; 112: 26-32Crossref PubMed Scopus (184) Google Scholar). Taken together, these studies highlight the importance of the class II HDACs in control of Runx2 transcription in normal chondrocyte differentiation and suggest Runx2 may play an important role in angiogenesis and chondrosarcoma development. In this study, we tested the hypothesis that decreased HDAC4 expression in chondrosarcoma cell lines accounts for some of the increased VEGF expression and angiogenic activity in these cells. We also investigated the mechanism of HDAC4 regulation of Runx2 and VEGF transcription. Human chondrocytes isolated from normal adult articular cartilage were cultured in complete medium (40% Dulbecco舗s modified Eagle舗s medium, 40% minimum Eagle舗s medium, 20% F-12 medium) with 10% fetal bovine serum (19Lin C. McGough R. Aswad B. Block J.A. Terek R. J. Orthop. Res. 2004; 22: 1175-1181Crossref PubMed Scopus (167) Google Scholar). Chondrosarcoma (CS) cell line JJ (a gift from Dr. Joel Block, Rush Medical School, Chicago) was also cultured in complete medium (19Lin C. McGough R. Aswad B. Block J.A. Terek R. J. Orthop. Res. 2004; 22: 1175-1181Crossref PubMed Scopus (167) Google Scholar), and CS-1 (a gift from Dr. Francis Hornicek, Harvard Medical School, Boston) was cultured in RPMI 1640 medium with 10% fetal bovine serum. All cells were cultured in a humidified incubator under 5% CO2. JJ was derived from a human grade II chondrosarcoma and CS-1 from a human grade III chondrosarcoma (20Block J.A. Inerot S.E. Gitelis S. Kimura J.H. J. Bone Joint Surg. 1991; 73: 647-658Crossref PubMed Scopus (48) Google Scholar, 21Morioka H. Weissbach L. Vogel T. Nielsen G.P. Faircloth G.T. Shao L. Hornicek F.J. Clin. Cancer Res. 2003; 9: 1211-1217PubMed Google Scholar, 22Shao L. Kasanov J. Hornicek F.J. Morii T. Fondren G. Weissbach L. Biochem. Pharmacol. 2003; 66: 2381-2395Crossref PubMed Scopus (30) Google Scholar). The following constructs were provided by the individuals listed: pcDNA3-HDAC4-FLAG, Eric A. Miska, University of Cambridge, Cambridge, UK (23Miska E.A. Langley E. Wolf D. Karlsson C. Pines J. Kouzarides T. Nucleic Acids Res. 2001; 29: 3439-3447Crossref PubMed Scopus (112) Google Scholar); pCMV/Runx2, Renny Franceshi, University of Michigan, Ann Arbor, MI (24Xiao G. Jiang D. Ge C. Zhao Z. Lai Y. Boules H. Phimphilai M. Yang X. Karsenty G. Franceschi R.T. J. Biol. Chem. 2005; 280: 30689-30696Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar); pGL3-Runx2-LUC (0.6 kb of rat RUNX2 promoter), Gary Stein, University of Massachusetts Medical School (25Drissi H. Luc Q. Shakoori R. Chuva De Sousa Lopes S. Choi J.Y. Terry A. Hu M. Jones S. Neil J.C. Lian J.B. Stein J.L. Van Wijnen A.J. Stein G.S. J. Cell Physiol. 2000; 184: 341-350Crossref PubMed Scopus (237) Google Scholar); human VEGF promoter constructs pGL3-VEGF3.3-LUC (−2362/+955) and pGL3-VEGF1.7-LUC (−794/+955), Dr. Lee Ellis, University of Texas M.D. Anderson Cancer Center, Houston, TX (26Zhang L. Yu D. Hu M. Xiong S. Lang A. Ellis L.M. Pollock R.E. Cancer Res. 2000; 60: 3655-3661PubMed Google Scholar); and HA-CBP, Eugene Chin, Rhode Island Hospital, Providence, RI. Cells were transiently transfected with DNA plasmids using FuGENE 6 (Roche Applied Science) after seeding for 18 h. After transfection, cells were incubated for 48 h and harvested for the following experiments. Site-directed mutagenesis of the two putative Runx2-binding sites in the VEGF promoter (pGL3-VEGF1.7-LUC (−794/+955)) was performed to change the core-binding motif TGG/ACC (27Javed A. Barnes G.L. Jasanya B.O. Stein J.L. Gerstenfeld L. Lian J.B. Stein G.S. Mol. Cell. Biol. 2001; 21: 2891-2905Crossref PubMed Scopus (162) Google Scholar) to TCT/AGA using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). First, the putative Runx-binding site mutation between nucleotides −559 and −553 (Fig. 4C) was generated by amplifying the promoter fragment using the forward primer carrying the mutation site indicated in capital letters, 5′-ggggcgctcggccaGAacagggaagctg-3′ and the reverse primer 5′-cagcttccctgttctggccgagcgcccc-3′. The PCR product was digested with DpnI to destroy the parental DNA, followed by transformation in XL1-Blue competent cells (Stratagene, La Jolla, CA). The second mutation between +293 and +287 bp was then generated by using the single mutant promoter as the template with forward primer 5′-tctacttccccaaatcactgtACattttggaaaccagcagaaag-3′ and reverse primer 5′-ctttctgctggtttccaaaatgtacagtgatttggggaagtaga-3′. Incorporation of the substitution mutations was confirmed by sequencing (Brown University, Providence, RI). RNA was isolated from chondrocytes and transfected and nontransfected CS cell lines with RNAqueous kit (Ambion, Austin, TX). After treatment with TURBO DNase (Ambion), 1 μg of RNA was reverse-transcribed with random hexamers to obtain first-strand cDNA using iScript cDNA kit (Bio-Rad). The quantification of mRNA for HDAC4, Runx2, and VEGF was performed by two-step real time quantitative RT-PCR (Qiagen, Valencia, CA). Primers for HDAC4 were (5′ to 3′) as follows: forward, gag aga ctc acc ctt ccc g, and reverse, ccg gtc tgc acc aac caa g. Runx2 primers were as follows: forward, ggc agg cac agt ctt ccc, and reverse, ggc cca gtt ctg aag cac c, and can detect the three Runx2 transcript variants. The primers used for VEGF and 18 S rRNA (18 S) were reported previously (19Lin C. McGough R. Aswad B. Block J.A. Terek R. J. Orthop. Res. 2004; 22: 1175-1181Crossref PubMed Scopus (167) Google Scholar). 18 S was used as an internal control gene because it has been shown to be the optimal reference gene (28Asp J. Brantsing C. Lövstedt K. Benassi M.S. Inerot S. Gamberi G. Picci P. Lindahl A. Int. J. Oncol. 2005; 27: 1577-1582PubMed Google Scholar). Amplification conditions were as follows: 2 min of preincubation at 50 °C, 10 min at 95 °C for enzyme activation, and 40 cycles at 95 °C denaturation for 10 s, 55 °C annealing for 30 s, and 72 °C extension for 30 s. The comparative threshold cycle (Ct) method, i.e. 2−ΔΔCt method, was used for the calculation of fold amplification (29Livak K.J. Schmittgen T.D. Methods. 2001; 25: 402-408Crossref PubMed Scopus (123232) Google Scholar). Each experiment was evaluated with three PCRs, and each experiment was repeated three times, the sample size necessary to maintain power at 0.80 to detect a 50% decrease with an α of 0.025 (one-tailed t test). The expression of HDAC4, Runx2, and VEGF in each tumor cell line was compared with chondrocytes using a one-tailed Student舗s t test to take advantage of the directional hypothesis. After subculture for 18 h, CS cells in 12-well plates were 70% confluent and then transiently transfected with reporter plasmid and co-transfected with gene expression vector, or empty vector, or different concentrations of HDAC4 vector as indicated using FuGENE 6 (Roche Applied Science), according to the manufacturer舗s instructions. The total amount of transfected DNA (1.5 μg/well) for each experiment was kept constant by addition of EV when needed. Cells were lysed 48 h after transfection. Luciferase activity was measured to assess reporter gene expression in a luminometer (Turner Design, Sunnyvale, CA) using Dual-Luciferase® Reporter Assay System (Promega, Madison, WI). In this system, cells were co-transfected with 0.02 μg of pRL-SV40 (Renilla luciferase driven by a full SV40 promoter) to control for transfection efficiency. Luciferase values were normalized for transfection efficiency (firefly/Renilla ratios). The relative fold induction or inhibition refers to the ratio of luciferase activity measured in expression vector-transfected cells relative to the activity obtained in the empty vector-transfected cells. Each measurement was made in duplicate. Whole cell lysates containing 20 μg of protein were heated and separated by 4–20% SDS-polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). Membranes were blocked with 5% nonfat milk/PBST for 1 h and subsequently incubated overnight with primary antibodies (anti-VEGF and anti-HDAC4 polyclonal antibody, Santa Cruz Biotechnology; anti-Runx2 antibody, CeMines, Inc., Golden, CO). Signals were detected using a horseradish peroxidase-conjugated secondary antibody and an enhanced chemiluminescence detection kit (Amersham Biosciences). Bands were quantified using Image Acquisition and Analysis Software (UVP Biosystems, Upland, CA) and normalized to actin. Because of heterogeneity of Western blot data, normalized data were natural logarithm-transformed and analyzed with Student舗s t test with Bonferroni correction. CS cells in 10-cm2 dishes were transfected with 4 μg of HA-CBP and/or FLAG-HDAC4. 48 h later, cells were lysed, and the lysates were incubated with 2 μg of anti-Runx2 antibody (CeMines, Inc., Golden, CO) with shaking at 4 °C overnight, and then with 30 μl of prewashed protein A/G Plus-agarose immunoprecipitation reagent (Santa Cruz Biotechnology) for 2 h at 4 °C. Beads were washed four times in 1× wash buffer (Actif Motif, Carlsbad, CA), resuspended in 1 volume of Western loading buffer, and boiled for 10 min at 95 °C. The presence of immunoprecipitated proteins (acetylated Runx2, total Runx2, and HDAC4) was detected by SDS-PAGE and immunoblotting by using anti-acetylated lysine antibody (Cell Signaling Technology, Beverly, MA), anti-Runx2 antibody (CeMines, Inc.), and anti-HDAC4 polyclonal antibody (Santa Cruz Biotechnology). Cells in 6-well plates were transfected with 5 nm HDAC4 siRNA (MU-003497-02, Dharmacon, Lafayette, CO) or Runx2 siRNA (Hs_RUNX2_3_HP siRNA, target sequence CAGCACGCTATTAAATCCAAA, Qiagen) per ml by HiPerFect transfection reagent (Qiagen). mRNA and protein were obtained from cell lysates as described above 72 h after transfection. Soluble VEGF was detected in the conditioned media (CM) obtained from CS cells transfected with HDAC4 expression plasmid (different concentrations) or empty plasmid or siRNA specific for Runx2 or scramble siRNA for control using a commercially available assay kit (R & D Systems, Minneapolis, MN) according to manufacturer舗s instructions. VEGF levels in the CM were measured two times for each condition and normalized for the number of cells at the end of the culture period. Immunodepletion of VEGF in CM obtained from transfected CS cells as described above was performed by incubating either with 1 μg of anti-VEGF goat IgG (R & D Systems, Minneapolis, MN) or with control normal goat IgG per 1 ml of CM for 2 h at 4 °C with rotation; then 30 μl of protein A/G-agarose (Santa Cruz Biotechnology) was added and incubated for 2 h more at 4 °C with rotation. The resulting immune complexes were removed by centrifugation, and then VEGF levels were remeasured in the CM by ELISA. ChIP experiments were performed following the protocol provided with the ChIP-IT kit (Active Motif, Carlsbad, CA) using JJ and CS-1 cells. Cells were treated with formaldehyde to cross-link DNA-bound protein and subsequently subjected to sonication in lysis buffer containing protease inhibitors (1 mm phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, and 1 μg/ml pepstatin). Immunoprecipitation was performed with 2 μg of the anti-Runx2 antibody or anti-HDAC4 antibody (Santa Cruz Biotechnology) for each ChIP reaction. Following immunoprecipitation, proteins were removed by treatment with proteinase K, and the DNA was purified by the DNA mini-columns supplied with the kit. PCR was performed using primers for three regions of the human VEGF promoter (5′ to 3′) as follows: Pf1, gcttgccattccccacttgaatc; Pr1, tgtctgtctgtctgtccgtcag; Pf2, gtgtgcagacggcagtcactag; Pr2, gatctattggaatcctggagtgacc; Pf3, ctacagacgttccttagtgctgg; Pr3, caccaagtttgtggagctgagaac. CM from CS cells were tested for angiogenic activity in the HUVEC assay. HUVECs in EGM-2 medium (Cambrex, East Rutherford, NJ) were plated at 5 × 103 cells per well in 24-well plates and starved of extrinsic VEGF and basic fibroblast growth factor for 24 h. HUVECs were then cultured in the different CM for 24 h followed by 18 h with [3H]thymidine (1 μCi/well). Proliferation rate was measured from radioactivity incorporated into total DNA using a Topcount NXT scintillation counter (Packard Instrument Co.) and calculated as a ratio of experimental to control. Results are an average of three independent experiments with four data points for each condition. Similarly, we tested the effect of VEGF-immunodepleted CM on HUVEC proliferation in the presence or absence of rhVEGF165 (R & D Systems). To study the effects of co-culturing HUVEC with JJ cells on HUVEC tube formation, we used a three-dimensional Matrigel system. In this system, each well of 4-well chamber slides was first divided into two equal parts by a thin strip of agarose gel (30Wang I.E. Shan J. Choi R. Oh S. Kepler C.K. Chen F.H. Lu H.H. J. Orthop. Res. 2007; 25: 1609-1620Crossref PubMed Scopus (100) Google Scholar). 100 μl of growth factor-reduced Matrigel (BD Biosciences) was added into one side of the wells and allowed to solidify for 30 min at 37 °C. JJ cells were then plated on the Matrigel, and 2 days after transfection, the other side of the wells were coated with Matrigel onto which HUVECs were plated. JJ cells and HUVECs were initially cultured in their own media. After 2 h, the wells were covered with enough of the HUVEC medium (2% fetal bovine serum, HUVEC medium without VEGF and fibroblast growth factors) so that the agarose divider no longer separated the two wells. After 1 day of co-culture, images of HUVEC were taken using an SpotII digital camera (Diagnostic Instruments, Sterling Heights, MI) attached to a Nikon microscope. Eight different fields were evaluated for each treatment, each image being selected on the basis of the optimal focal plane that had the majority of cells in focus. The tubular structures were traced, and the total length, area, and number of junctions were analyzed using Elements software (Nikon, Inc, Mellville, NY). The experiment was repeated three times. Statistical analysis was performed with GraphPad Prism version 3.0 (GraphPad Software, San Diego). ELISA, luciferase activity, and HUVEC proliferation and tube formation results were analyzed with one-way analysis of variance. Post test comparisons were made with Bonferroni correction. Experiments with two groups were analyzed with the Student舗s t test. The null hypothesis of no difference was rejected at a significance level of 5%. As a first step in evaluating the potential role of HDAC4, Runx2, and VEGF as dysregulated pathways in chondrosarcoma, we analyzed expression of these genes and proteins in chondrocyte and chondrosarcoma cell lines using quantitative real time PCR and Western blotting (Fig. 1). We found that HDAC4 gene expression was decreased to 17 and 39% in chondrosarcoma cells compared with chondrocytes (Fig. 1A), whereas Runx2 was increased 4.1- and 15.6-fold (Fig. 1B), and VEGF was increased 5.9- and 8.5-fold (Fig. 1C). All chondrosarcoma gene expressions were significantly different from chondrocytes (p < 0.01). Protein levels of Runx2 and VEGF showed analogous changes (Fig. 1D). Quantification of Western blots showed HDAC4 was decreased to 47% in chondrosarcoma cells compared with chondrocytes, and Runx2 and VEGF were increased 3.4- and 3.1-fold compared with chondrocytes. To determine whether the decreased expression of HDAC4 is a cause, either directly or indirectly, of increased VEGF expression, chondrosarcoma cells were transfected with either HDAC4 expression construct or siRNA directed against HDAC4. We tested if increased HDAC4 expression would decrease VEGF expression. Real time PCR showed that HDAC4 transfection repressed the endogenous VEGFa transcription to 34% in JJ cells and to 29% in CS-1 cells compared with the control (EV) (p < 0.01) (Fig. 2A). Fig. 2, B and C, shows high level of HDAC4 expression after HDAC4 transfection. Western blotting also showed that endogenous VEGFa protein level decreased after HDAC4 transfection (Fig. 2C). Thus, VEGF expression was repressed by overexpression of HDAC4. The opposite effect was seen with HDAC4 knockdown. As can be seen from Fig. 2, E and F, siRNA effectively decreased the expression of endogenous HDAC4 mRNA and protein levels, whereas VEGFa mRNA increased 4.1-fold (p < 0.01) (Fig. 2D) as did protein levels (Fig. 2F). Similar results were obtained with JJ cells (data not shown). To understand the mechanism of the regulation of VEGF expression by HDAC4, we did the following studies. We used VEGFa and Runx2 reporter constructs to investigate the effects of HDAC4 and Runx2, alone and in combination, on the VEGF and Runx2 promoters. The results of luciferase activity analysis show that transfection of HDAC4 expression construct repressed VEGFa promoter-driven luciferase activity to 54% in JJ cells (p < 0.05) and to 35% in CS-1 (p < 0.02) (Fig. 3A). Because Runx2 is known to be a target for HDAC4, and because Runx2 is known to regulate endochondral ossification, which requires VEGF, we analyzed the role of Runx2 in the HDAC4 regulation of VEGF expression. When CS-1 was transfected with the HDAC4 expression construct and a Runx2-luciferase reporter construct, promoter activity decreased to 38% of control (Fig. 3B). HDAC4 also decreased Runx2 mRNA in JJ and CS-1 (p < 0.01) (Fig. 3C). When Runx2 expression was knocked down using siRNA (Fig. 3E), similar effects were seen on VEGF expression as with HDAC4 transfection. VEGF mRNA decreased to 33% of control (p < 0.01) (Fig. 3D), and the protein level also decreased (Fig. 3E). When CS-1 was transfected with a Runx2 expression construct, VEGF promoter activity increased 2.9-fold compared with EV (p < 0.01) (Fig. 3F). The effect of Runx2 on the VEGF promoter activity could be counteracted by HDAC4 transfection in a dose-dependent manner (Fig. 3F) (p < 0.05 for 0.1–0.6 μg). To assess if HDAC4 has a direct effect on VEGF expression, we performed separate and combination transfections with HDAC4 and Runx2 siRNA. HDAC4 transfection decreased VEGF mRNA to 35% of control (p < 0.001) and secreted VEGF into conditioned media from 311 to 202 pg/ml (p < 0.05). Runx2 knockdown had a similar effect as follows: VEGF mRNA decreased to 29% of control (p < 0.001), and VEGF protein decreased to 107 pg/ml (p < 0.01). HDAC4 transfection after Runx2 knockdown had no additional effect on VEGF mRNA (27% of control, p > 0.05 compared with Runx2 siRNA) or secreted protein (102 pg/ml, p > 0.05) (Fig. 3, G and H). The results are consistent with Runx2 being the mediator of HDAC4 regulation of VEGF. To show more definit" @default.
- W1999532904 created "2016-06-24" @default.
- W1999532904 creator A5024814377 @default.
- W1999532904 creator A5042518913 @default.
- W1999532904 creator A5076613371 @default.
- W1999532904 creator A5086701763 @default.
- W1999532904 date "2009-08-01" @default.
- W1999532904 modified "2023-09-27" @default.
- W1999532904 title "HDAC4 Represses Vascular Endothelial Growth Factor Expression in Chondrosarcoma by Modulating RUNX2 Activity" @default.
- W1999532904 cites W178370525 @default.
- W1999532904 cites W1956818442 @default.
- W1999532904 cites W1965072143 @default.
- W1999532904 cites W1970850706 @default.
- W1999532904 cites W1979377700 @default.
- W1999532904 cites W2019026667 @default.
- W1999532904 cites W2021406440 @default.
- W1999532904 cites W2039214489 @default.
- W1999532904 cites W2047698726 @default.
- W1999532904 cites W2049243908 @default.
- W1999532904 cites W2049763628 @default.
- W1999532904 cites W2050339689 @default.
- W1999532904 cites W2054240721 @default.
- W1999532904 cites W2058139610 @default.
- W1999532904 cites W2073700812 @default.
- W1999532904 cites W2076223951 @default.
- W1999532904 cites W2083753909 @default.
- W1999532904 cites W2085277673 @default.
- W1999532904 cites W2085425025 @default.
- W1999532904 cites W2085907524 @default.
- W1999532904 cites W2102884982 @default.
- W1999532904 cites W2104159015 @default.
- W1999532904 cites W2107277218 @default.
- W1999532904 cites W2121296685 @default.
- W1999532904 cites W2138178697 @default.
- W1999532904 cites W2145663988 @default.
- W1999532904 cites W2148583445 @default.
- W1999532904 cites W2157445945 @default.
- W1999532904 cites W2158018007 @default.
- W1999532904 cites W2166952064 @default.
- W1999532904 cites W2324384090 @default.
- W1999532904 cites W4250208933 @default.
- W1999532904 doi "https://doi.org/10.1074/jbc.m109.019091" @default.
- W1999532904 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2755912" @default.
- W1999532904 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19509297" @default.
- W1999532904 hasPublicationYear "2009" @default.
- W1999532904 type Work @default.
- W1999532904 sameAs 1999532904 @default.
- W1999532904 citedByCount "56" @default.
- W1999532904 countsByYear W19995329042012 @default.
- W1999532904 countsByYear W19995329042013 @default.
- W1999532904 countsByYear W19995329042014 @default.
- W1999532904 countsByYear W19995329042015 @default.
- W1999532904 countsByYear W19995329042016 @default.
- W1999532904 countsByYear W19995329042017 @default.
- W1999532904 countsByYear W19995329042018 @default.
- W1999532904 countsByYear W19995329042019 @default.
- W1999532904 countsByYear W19995329042020 @default.
- W1999532904 countsByYear W19995329042021 @default.
- W1999532904 countsByYear W19995329042022 @default.
- W1999532904 countsByYear W19995329042023 @default.
- W1999532904 crossrefType "journal-article" @default.
- W1999532904 hasAuthorship W1999532904A5024814377 @default.
- W1999532904 hasAuthorship W1999532904A5042518913 @default.
- W1999532904 hasAuthorship W1999532904A5076613371 @default.
- W1999532904 hasAuthorship W1999532904A5086701763 @default.
- W1999532904 hasBestOaLocation W19995329041 @default.
- W1999532904 hasConcept C103041312 @default.
- W1999532904 hasConcept C104317684 @default.
- W1999532904 hasConcept C146285616 @default.
- W1999532904 hasConcept C150194340 @default.
- W1999532904 hasConcept C150425827 @default.
- W1999532904 hasConcept C167734588 @default.
- W1999532904 hasConcept C185592680 @default.
- W1999532904 hasConcept C2776363554 @default.
- W1999532904 hasConcept C2777025900 @default.
- W1999532904 hasConcept C502942594 @default.
- W1999532904 hasConcept C55493867 @default.
- W1999532904 hasConcept C58793620 @default.
- W1999532904 hasConcept C86339819 @default.
- W1999532904 hasConcept C86803240 @default.
- W1999532904 hasConcept C95444343 @default.
- W1999532904 hasConceptScore W1999532904C103041312 @default.
- W1999532904 hasConceptScore W1999532904C104317684 @default.
- W1999532904 hasConceptScore W1999532904C146285616 @default.
- W1999532904 hasConceptScore W1999532904C150194340 @default.
- W1999532904 hasConceptScore W1999532904C150425827 @default.
- W1999532904 hasConceptScore W1999532904C167734588 @default.
- W1999532904 hasConceptScore W1999532904C185592680 @default.
- W1999532904 hasConceptScore W1999532904C2776363554 @default.
- W1999532904 hasConceptScore W1999532904C2777025900 @default.
- W1999532904 hasConceptScore W1999532904C502942594 @default.
- W1999532904 hasConceptScore W1999532904C55493867 @default.
- W1999532904 hasConceptScore W1999532904C58793620 @default.
- W1999532904 hasConceptScore W1999532904C86339819 @default.
- W1999532904 hasConceptScore W1999532904C86803240 @default.
- W1999532904 hasConceptScore W1999532904C95444343 @default.
- W1999532904 hasIssue "33" @default.
- W1999532904 hasLocation W19995329041 @default.