FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1999789026> ?p ?o ?g. }

• W1999789026 endingPage "849" @default.
• W1999789026 startingPage "849" @default.
• W1999789026 abstract "A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997." @default.
• W1999789026 created "2016-06-24" @default.
• W1999789026 creator A5006882300 @default.
• W1999789026 creator A5034743868 @default.
• W1999789026 creator A5036982385 @default.
• W1999789026 creator A5075540898 @default.
• W1999789026 creator A5090749371 @default.
• W1999789026 date "2013-06-01" @default.
• W1999789026 modified "2023-09-30" @default.
• W1999789026 title "First Report of <i>Barley yellow dwarf virus</i> and <i>Cereal yellow dwarf virus</i> Affecting Cereal Crops in Azerbaijan" @default.
• W1999789026 doi "https://doi.org/10.1094/pdis-07-12-0656-pdn" @default.
• W1999789026 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30722617" @default.
• W1999789026 hasPublicationYear "2013" @default.
• W1999789026 type Work @default.
• W1999789026 sameAs 1999789026 @default.
• W1999789026 citedByCount "6" @default.
• W1999789026 countsByYear W19997890262019 @default.
• W1999789026 countsByYear W19997890262022 @default.
• W1999789026 countsByYear W19997890262023 @default.
• W1999789026 crossrefType "journal-article" @default.
• W1999789026 hasAuthorship W1999789026A5006882300 @default.
• W1999789026 hasAuthorship W1999789026A5034743868 @default.
• W1999789026 hasAuthorship W1999789026A5036982385 @default.
• W1999789026 hasAuthorship W1999789026A5075540898 @default.
• W1999789026 hasAuthorship W1999789026A5090749371 @default.
• W1999789026 hasBestOaLocation W19997890261 @default.
• W1999789026 hasConcept C109110057 @default.
• W1999789026 hasConcept C159047783 @default.
• W1999789026 hasConcept C2522874641 @default.
• W1999789026 hasConcept C2776558808 @default.
• W1999789026 hasConcept C2781191690 @default.
• W1999789026 hasConcept C86803240 @default.
• W1999789026 hasConceptScore W1999789026C109110057 @default.
• W1999789026 hasConceptScore W1999789026C159047783 @default.
• W1999789026 hasConceptScore W1999789026C2522874641 @default.
• W1999789026 hasConceptScore W1999789026C2776558808 @default.
• W1999789026 hasConceptScore W1999789026C2781191690 @default.
• W1999789026 hasConceptScore W1999789026C86803240 @default.
• W1999789026 hasIssue "6" @default.
• W1999789026 hasLocation W19997890261 @default.
• W1999789026 hasLocation W19997890262 @default.
• W1999789026 hasLocation W19997890263 @default.
• W1999789026 hasOpenAccess W1999789026 @default.
• W1999789026 hasPrimaryLocation W19997890261 @default.
• W1999789026 hasRelatedWork W1964005957 @default.
• W1999789026 hasRelatedWork W1966077743 @default.
• W1999789026 hasRelatedWork W1993538835 @default.
• W1999789026 hasRelatedWork W1997141711 @default.
• W1999789026 hasRelatedWork W2027781036 @default.
• W1999789026 hasRelatedWork W2323375424 @default.
• W1999789026 hasRelatedWork W2329219543 @default.
• W1999789026 hasRelatedWork W2329986074 @default.
• W1999789026 hasRelatedWork W2421507966 @default.
• W1999789026 hasRelatedWork W2506405683 @default.
• W1999789026 hasVolume "97" @default.
• W1999789026 isParatext "false" @default.
• W1999789026 isRetracted "false" @default.
• W1999789026 magId "1999789026" @default.
• W1999789026 workType "article" @default.