FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000030207> ?p ?o ?g. }

• W2000030207 endingPage "18741" @default.
• W2000030207 startingPage "18734" @default.
• W2000030207 abstract "N-Acylethanolamines (NAEs) are lipids involved in several physiological processes in animal and plant cells. In brain, NAEs are ligands of endocannabinoid receptors, which modulate various signaling pathways. In plant, NAEs regulate seed germination and root development, and they are involved in plant defense against pathogen attack. This signaling activity is started by an enzyme called N-acylphosphatidylethanolamine (NAPE) synthase. This catalyzes the N-acylation of phosphatidylethanolamine to form NAPE, which is most likely hydrolyzed by phospholipase D β/γ isoforms to generate NAE. This compound is further catabolized by fatty amide hydrolase. The genes encoding the enzymes involved in NAE metabolism are well characterized except for the NAPE synthase gene(s). By heterologous expression in Escherichia coli and overexpression in plants, we characterized an acyltransferase from Arabidopsis thaliana (At1g78690p) catalyzing the synthesis of lipids identified as NAPEs (two-dimensional TLC, phospholipase D hydrolysis assay, and electrospray ionization-tandem mass spectrometry analyses). The ability of free fatty acid and acyl-CoA to be used as acyl donor was compared in vitro with E. coli membranes and purified enzyme (obtained by immobilized metal ion affinity chromatography). In both cases, NAPE was synthesized only in the presence of acyl-CoA. β-Glucuronidase promoter experiments revealed a strong expression in roots and young tissues of plants. Using yellow fluorescent protein fusion, we showed that the NAPE synthase is located in the plasmalemma of plant cells. N-Acylethanolamines (NAEs) are lipids involved in several physiological processes in animal and plant cells. In brain, NAEs are ligands of endocannabinoid receptors, which modulate various signaling pathways. In plant, NAEs regulate seed germination and root development, and they are involved in plant defense against pathogen attack. This signaling activity is started by an enzyme called N-acylphosphatidylethanolamine (NAPE) synthase. This catalyzes the N-acylation of phosphatidylethanolamine to form NAPE, which is most likely hydrolyzed by phospholipase D β/γ isoforms to generate NAE. This compound is further catabolized by fatty amide hydrolase. The genes encoding the enzymes involved in NAE metabolism are well characterized except for the NAPE synthase gene(s). By heterologous expression in Escherichia coli and overexpression in plants, we characterized an acyltransferase from Arabidopsis thaliana (At1g78690p) catalyzing the synthesis of lipids identified as NAPEs (two-dimensional TLC, phospholipase D hydrolysis assay, and electrospray ionization-tandem mass spectrometry analyses). The ability of free fatty acid and acyl-CoA to be used as acyl donor was compared in vitro with E. coli membranes and purified enzyme (obtained by immobilized metal ion affinity chromatography). In both cases, NAPE was synthesized only in the presence of acyl-CoA. β-Glucuronidase promoter experiments revealed a strong expression in roots and young tissues of plants. Using yellow fluorescent protein fusion, we showed that the NAPE synthase is located in the plasmalemma of plant cells. N-Acylethanolamines (NAEs) 2The abbreviations used are: NAEN-acylethanolaminePLDphospholipase DNAPEN-acylphosphatidylethanolaminePEphosphatidylethanolamineMES4-morpholineethanesulfonic acidGCgas chromatographyMSmass spectrometryMS/MStandem mass spectrometryFFAfree fatty acidFAAHfatty amide hydrolaseGFPgreen fluorescent proteinYFPyellow fluorescent proteinIMACimmobilized metal ion affinity chromatography. are bioactive lipids composed of an ethanolamine headgroup amide-linked to an acyl chain varying in length and degree of saturation. In animals, NAEs are involved in different physiological processes, such as neuroprotective action (1.Hansen H.S. Moesgaard B. Petersen G. Hansen H.H. Pharmacol. Ther. 2002; 95: 119-126Crossref PubMed Scopus (70) Google Scholar), embryo development (2.Paria B.C. Dey S.K. Chem. Phys. Lipids. 2000; 108: 211-220Crossref PubMed Scopus (125) Google Scholar), cell proliferation (3.De Petrocellis L. Melck D. Bisogno T. Di Marzo V. Chem. Phys. Lipids. 2000; 108: 191-209Crossref PubMed Scopus (155) Google Scholar), apoptosis (4.Sarker K.P. Obara S. Nakata M. Kitajima I. Maruyama I. FEBS Lett. 2000; 472: 39-44Crossref PubMed Scopus (149) Google Scholar), nociception, anxiety, inflammation, appetite/anorexia, learning, and memory (for review, see Ref. 5.Simon G.M. Cravatt B.F. J. Biol. Chem. 2006; 281: 26465-26472Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Most studies carried out with animal cells/tissues have focused on N-arachidonoylethanolamine (anandamide, NAE20:4), which is synthesized in brain neurons but also, under certain conditions, in macrophage cells (6.Liu J. Wang L. Harvey-White J. Osei-Hyiaman D. Razdan R. Gong Q. Chan A.C. Zhou Z. Huang B.X. Kim H.Y. Kunos G. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13345-13350Crossref PubMed Scopus (362) Google Scholar). NAE20:4 binds CB1 cannabinoid receptors located in brain neurons (7.Felder C.C. Briley E.M. Axelrod J. Simpson J.T. Mackie K. Devane W.A. Proc. Natl. Acad. Sci. U.S.A. 1993; 90: 7656-7660Crossref PubMed Scopus (449) Google Scholar) and also acts as ligand of vanilloid receptors for pain modulation (8.Kumar R.N. Chambers W.A. Pertwee R.G. Anaesthesia. 2001; 56: 1059-1068Crossref PubMed Scopus (154) Google Scholar). In addition, it has been shown that NAE20:4 also promotes food intake, whereas NAE18:0 and NAE18:1 exert anorexic effects by increasing satiety (9.Fu J. Gaetani S. Oveisi F. Lo Verme J. Serrano A. Rodríguez De Fonseca F. Rosengarth A. Luecke H. Di Giacomo B. Tarzia G. Piomelli D. Nature. 2003; 425: 90-93Crossref PubMed Scopus (896) Google Scholar, 10.Nielsen M.J. Petersen G. Astrup A. Hansen H.S. J. Lipid Res. 2004; 45: 1027-1029Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 11.Terrazzino S. Berto F. Dalle Carbonare M. Fabris M. Guiotto A. Bernardini D. Leon A. FASEB J. 2004; 18: 1580-1582Crossref PubMed Scopus (81) Google Scholar). NAE16:0 is accumulated during inflammation and has several anti-inflammatory effects (for a review, see Ref. 12.Lambert D.M. Vandevoorde S. Jonsson K.O. Fowler C.J. Curr. Med. Chem. 2002; 9: 663-674Crossref PubMed Scopus (264) Google Scholar). N-acylethanolamine phospholipase D N-acylphosphatidylethanolamine phosphatidylethanolamine 4-morpholineethanesulfonic acid gas chromatography mass spectrometry tandem mass spectrometry free fatty acid fatty amide hydrolase green fluorescent protein yellow fluorescent protein immobilized metal ion affinity chromatography. In plants, NAEs are thought to be involved in various physiological functions. For example, because NAE levels observed in various dry seeds decline rapidly after imbibition, a possible role of these compounds in the regulation of seed germination has been proposed (13.Chapman K.D. Venables B. Markovic R. Blair Jr., R.W. Bettinger C. Plant Physiol. 1999; 120: 1157-1164Crossref PubMed Scopus (61) Google Scholar). It was further observed that the addition of 25 μm NAE12:0 to growth medium of Arabidopsis thaliana leads to a decrease in the size of the main and lateral roots and in root hair formation. This reduction in growth was associated with a modification of cytoskeletal organization (14.Blancaflor E.B. Hou G. Chapman K.D. Planta. 2003; 217: 206-217Crossref PubMed Scopus (71) Google Scholar). NAE12:0 is also able to delay cut Dianthus caryophyllus (carnation) senescence by decreasing oxidative damage and enhancing antioxidant defense (15.Zhang Y. Guo W.M. Chen S.M. Han L. Li Z.M. J. Plant Physiol. 2007; 164: 993-1001Crossref PubMed Scopus (25) Google Scholar), whereas NAE14:0 inhibits the elicitor-induced medium alkalinization and activates phenylalanine ammonia lyase gene expression involved in plant defense against pathogen attack (16.Tripathy S. Venables B.J. Chapman K.D. Plant physiol. 1999; 121: 1299-1308Crossref PubMed Scopus (55) Google Scholar). Both in plant and animal cells (for a review, see Ref. 17.Kilaru A. Blancaflor E.B. Venables B.J. Tripathy S. Mysore K.S. Chapman K.D. Chem. Biodivers. 2007; 4: 1933-1955Crossref PubMed Scopus (58) Google Scholar), NAEs are formed by the hydrolysis (by PLDs) of N-acylphosphatidylethanolamine (NAPE). NAPE is an unusual derivative of phosphatidylethanolamine (PE) with a third fatty acid linked to the amine position of the ethanolamine headgroup. In animals, the formation of NAEs is catalyzed by a PLD with a high specificity toward NAPE (NAPE-PLD). In plants, PLDβ and PLDγ isoforms, but not PLDα, hydrolyzed NAPE into NAE in vitro, and this is thought to operate in response to several biotic and abiotic stresses. Both in animals and in plants, NAEs signaling is terminated by the action of fatty acid amide hydrolases, which hydrolyze NAEs to free fatty acid and ethanolamine. FAAH has been identified and characterized in mammals and plants (for a review, see Ref. 17.Kilaru A. Blancaflor E.B. Venables B.J. Tripathy S. Mysore K.S. Chapman K.D. Chem. Biodivers. 2007; 4: 1933-1955Crossref PubMed Scopus (58) Google Scholar). In Arabidopsis, FAAH has been shown to modulate NAE content. Moreover, lines overexpressing FAAH displayed enhanced seedling growth as well as increased cell size (18.Wang Y.S. Shrestha R. Kilaru A. Wiant W. Venables B.J. Chapman K.D. Blancaflor E.B. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 12197-12202Crossref PubMed Scopus (64) Google Scholar) and were also more susceptible to bacterial pathogens (19.Kang L. Wang Y.S. Uppalapati S.R. Wang K. Tang Y. Vadapalli V. Venables B.J. Chapman K.D. Blancaflor E.B. Mysore K.S. Plant J. 2008; 56: 336-349Crossref PubMed Scopus (53) Google Scholar). Although the role of NAEs and their catabolism have been extensively investigated, little is known about their precursors, the NAPEs. NAPEs represent a minor phospholipid class but are present in all tissues of plants and animals. The principal function of NAPEs is to serve as a precursor for the production of lipid mediator NAEs, but it has also been suggested that NAPEs could serve as a membrane stabilizer to maintain cellular compartmentalization during tissue damage (20.Sandoval J.A. Huang Z.H. Garrett D.C. Gage D.A. Chapman K.D. Plant Physiol. 1995; 109: 269-275Crossref PubMed Scopus (42) Google Scholar). More recently, N-palmitoyl-PE was proposed to act as an inhibitor of macrophage phagocytosis through inhibition of the activation of Rac1 and Cdc42 (21.Shiratsuchi A. Ichiki M. Okamoto Y. Ueda N. Sugimoto N. Takuwa Y. Nakanishi Y. J. Biochem. 2009; 145: 43-50Crossref PubMed Scopus (24) Google Scholar). In the animal and plant kingdoms, therefore, the signaling events mediated by NAEs appear to be involved in many physiological processes that have been extensively studied. The genes encoding the enzymes involved in the synthesis (from NAPEs) and the degradation of NAEs have been cloned and characterized. By contrast, little is known about the physiological roles of NAPEs or about the first step of this lipid signaling pathway, namely the N-acylation of PE to form NAPEs. In animals, the synthesis of NAPEs is catalyzed by an N-acyltransferase, where the O-linked acyl unit from a phospholipid donor is transferred to the ethanolamine headgroup of PE (22.Schmid H.H. Schmid P.C. Natarajan V. Prog. Lipid Res. 1990; 29: 1-43Crossref PubMed Scopus (421) Google Scholar). Recently, a rat LRAT-like protein 1 or RLP1 was shown to display such an activity, but according to the authors, RLP-1 can function as a PE N-acyltransferase, catalytically distinguishable from the known Ca2+-dependent N-acyltransferase (23.Jin X.H. Okamoto Y. Morishita J. Tsuboi K. Tonai T. Ueda N. J. Biol. Chem. 2007; 282: 3614-3623Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). However, a different situation is observed in plants. NAPE synthase activity was shown to directly acylate PE with free fatty acids (24.Chapman K.D. Moore Jr., T.S. Plant Physiol. 1993; 102: 761-769Crossref PubMed Scopus (37) Google Scholar, 25.Chapman K.D. Sriparameswaran A. Plant Cell Physiol. 1997; 38: 1359-1367Crossref Scopus (10) Google Scholar), but a gene encoding a NAPE synthase activity remained unidentified until now. The present work shows that the A. thaliana acyltransferase At1g78690p catalyzes the synthesis of NAPEs from PE and acyl-CoAs in vitro as well as in vivo when this enzyme is expressed in E. coli and overexpressed in plants. A tDNA insertion mutant of At1g78690 was identified in the SALK collection (SALK_029716). The location and orientation of the tDNA insert was confirmed by DNA sequencing of PCR products amplified with tDNA and insert-specific primers (LBa1, 5′-TGGTTCACGTAGTGGGCCATCG-3′; LP1, 5′-TCTCCTGTGTATCCTCTCGTGTG-3′) and gene-specific primers (LP1 and RP1 (5′-TCAGATCTTGCTGCCCATTCC-3′)). Transgenic Arabidopsis was generated by the floral dip method with the Agrobacterium tumefaciens (strain C58C1) harboring the specific construct (26.Clough S.J. Bent A.F. Plant J. 1998; 16: 735-743Crossref PubMed Google Scholar). Arabidopsis seeds were planted and grown on MS medium supplemented with 0.7% agar, 2.5 mm MES-KOH, pH 5.7. The At1g78690 sequence was amplified using the PhusionTM High-Fidelity DNA polymerase by a set of sense and antisense primers containing the appropriate restriction sites for cloning the sequence of interest in the pET-15b vector (Novagen). The PCR product was purified with the UltraCleanTM GelSpinTM DNA extraction kit (MO BIO Laboratories, Inc.) according to the manufacturer's protocol. This product of purification and pET-15b vector were submitted to endonuclease enzymes (NcoI and XhoI; Biolabs), and the 5′ extremities were dephosphorylated (alkaline phosphatase; Biolabs). Then the vector was purified using the UltraCleanTM Standard Mini plasmid prep kit (MO BIO Laboratories) according to the manufacturer's protocol. The quantity and purity of this preparation were determined at 260 and 280 nm. All constructs were verified by sequencing. Finally, this insert was introduced into pET-15b vector by ligation (T4 DNA ligase of Biolabs). C41 (DE3) E. coli bacteria (Avidis, Saint-Beauzire, France) was further transformed with the pET-15b containing the At1g78690 sequence by the heat shock method. Independent clones were obtained by ampicillin selection. To obtain At1g78690p tagged with His6 and the construction needed for tissue and cellular location, the cDNA of At1g78690 or the promoter of this gene (964 bp before the start codon) was amplified using the PhusionTM High-Fidelity DNA polymerase and a set of sense and antisense primers containing the attB region (respecting the reading frame for the different constructions). The PCR products were cloned in the PDONR221 vector using Gateway technology. After verification by sequencing, the pDONR221 containing the sequence of interest (cDNA or gene promoter) were purified as previously and used for the LR reaction with different destination vectors: pDESTTM17 (for His6-At1g78690p), pK7WG2D (for p35S:At1g78690), pK7YWG2 and pK7WGY2 (for p35S:YFP-At1g78690 in the C terminus and N terminus, respectively), or pKGWFS7 (for pAt1g78690:GUS). C41 (DE3) E. coli bacteria were grown overnight in LB medium with 0.1 mg/ml ampicillin at 37 °C at 200 rpm. The overnight culture was diluted (1:20), and the culture was continued in 250-ml flasks at 37 °C. When the culture reached an absorbance A600 of 0.6, expression of the At1g78690 was induced by the addition of 1 mm isopropyl β-d-thiogalactoside. The culture was then allowed to grow for 3 h at 30 °C. The cells were harvested by centrifugation, and the pellet was resuspended in 500 μl of water. The lipids were extracted according to Ref. 27.Testet E. Laroche-Traineau J. Noubhani A. Coulon D. Bunoust O. Camougrand N. Manon S. Lessire R. Bessoule J.J. Biochem. J. 2005; 387: 617-626Crossref PubMed Scopus (66) Google Scholar. A culture of E. coli C41-transformed At1g78690-His6 cDNA was obtained. After 3 h of isopropyl β-d-thiogalactoside induction, cells were harvested by centrifugation at 5000 rpm at 4 °C. The proteins were solubilized by incubation of the pellet with 10 mm phosphate buffer, pH 8, 0.5 m NaCl, 10 mm n-dodecyl-β-d-maltoside at 4 °C for 1 h. The solution was centrifuged for 20 min at 13,000 × g at 4 °C. The supernatant was used for protein purification. The At1g78690-His6 was purified using the Ni SepharoseTM 6 Fast Flow kit (GE Healthcare) according to the manufacturer's protocol. The equilibration buffer was 20 mm phosphate buffer, 0.5 m NaCl, 25 mm imidazole, pH 8, and the NAPE synthase was eluted with 20 mm phosphate buffer, 0.5 m NaCl, 200 mm imidazole, pH 8. Protein concentration was determined using the Lowry method with bovine serum albumin as a standard. 50 ml of E. coli culture were centrifuged, and the pellet was resuspended in 2.5 ml of 0.2 m Tris/HCl (pH 8) buffer. 2.5 ml of 0.2 m Tris/HCl, 1 m sucrose,1 mm EDTA (pH 8) buffer was added and gently mixed before the addition of 25 μl lysozyme (1 g/liter) and 10 ml of water. Digestion of cell walls was performed at 20 °C under gentle shaking for 30 min. Membranes were spun down by centrifugation (15 min at 150,000 × g, using a Hitachi centrifuge). The pellet was washed with 50 mm Tris/HCl (pH 8) buffer before centrifugation (15 min at 150,000 × g, using a Hitachi centrifuge) and resuspended in 50 mm Tris/HCl (pH 8) buffer. The protein concentration was determined using the Lowry method with BSA as a standard. The NAPE synthase assays were conducted for 10 min at 30 °C in 100 μl of assay mixture (15 mm phosphate buffer, pH 8) containing 1 nmol of labeled acyl donor ([14C]palmitoyl-CoA (60 mCi/mmol), [14C]stearoyl-CoA (58 mCi/mmol), [14C]palmitic acid (56 mCi/mmol) or [14C]stearic acid (51 mCi/mmol)) and in the presence of 1 nmol of PE. The reaction was initiated by the addition of 50 μg of membrane proteins or 40 μg of purified enzyme. Reactions were stopped by the addition of 2 ml of chloroform/methanol (2:1, v/v) and 500 μl of water. The lipids were extracted as described below. The radioactivity incorporated into NAPE was quantified using a Storm 860 PhosphorImager (GE HealthCare). Complete seedlings or tissue cuttings were stained in multiwell plates. Histochemical assays for GUS activity were performed according to the protocol described in Ref. 28.Beeckman T. Engler G. Plant Mol. Biol. Rep. 1994; 12: 37-42Crossref Scopus (120) Google Scholar. The plants were observed with a Leica binocular loupe (Leica MZ16F) coupled with a camera (DFC 420), and data processing was done with Leica application suite version 2.5.0 R1. Four-week-old tobacco (Nicotiana tabacum cv. Petit Havana) greenhouse plants grown at 22–24 °C were used for Agrobacterium tumefasciens (strain GV3101)-mediated transient expression as described in Ref. 29.Chatre L. Brandizzi F. Hocquellet A. Hawes C. Moreau P. Plant Physiol. 2005; 13: 1244-1254Crossref Scopus (75) Google Scholar. Polar lipids were separated by two-dimensional TLC using chloroform/methanol/1-propanol/methyl acetate/0.25% KCl (solvent A; 10:4:10:10:3.6, by volume) for migration in the first dimension and using pyridine/chloroform/formic acid (25/15/3.5, by volume) for migration in the second dimension. The lipids were then visualized and quantified by GC, as described by Testet et al. (27.Testet E. Laroche-Traineau J. Noubhani A. Coulon D. Bunoust O. Camougrand N. Manon S. Lessire R. Bessoule J.J. Biochem. J. 2005; 387: 617-626Crossref PubMed Scopus (66) Google Scholar). Lipids were extracted from rosette leaf by the addition of 2 ml of hexane/2-propanol/water (20/55/25, by volume) and heated at 70 °C until total leaf discoloration. The solvent was evaporated to dryness under N2. The lipids were extracted according to Ref. 27.Testet E. Laroche-Traineau J. Noubhani A. Coulon D. Bunoust O. Camougrand N. Manon S. Lessire R. Bessoule J.J. Biochem. J. 2005; 387: 617-626Crossref PubMed Scopus (66) Google Scholar. Plant lipids were separated on a Kieselgel G type 60 column. Chloroform, chloroform/methanol (6:1, v/v), and chloroform/methanol (2:1, v/v) were used to elute yellow pigments, chlorophyll + MGDG, and phospholipids, respectively. Each fraction was evaporated under N2 and further analyzed by TLC using solvent A. The unidentified lipid synthesized by E. coli transformed with pET15b::At1g78690 was isolated as described previously. The lipid was evaporated to dryness and suspended in 1 ml of diethyl ether. The reaction mix was composed by 235 μl of MES-NaOH 40 mm, CaCl2 15 mm, with 62.5 units of Streptomyces chromofuscus PLD. The reaction was carried out at 32 °C with shaking (120 rpm) for 30 min. The reaction was stopped by the addition of 2 ml of chloroform/methanol (2:1, v/v). Then lipids were extracted and separated by TLC. Aliquots of lipids extracted from bacteria transformed by the cDNA of At1g78690 or E. coli (wild type) were dried gently under a stream of N2. The lipids were suspended in methanol solution. All experiments were performed using an ion trap mass spectrometer (LCQ Advantage; Thermo Fisher) fitted with an orthogonal electrospray ionization source, by analyzing negative ions. Methanolic lipid solutions were diluted at 1:10 and infused by means of a syringe pump at a flow rate of 300 μl/h (KD Scientific). The spray voltage was 4.5 kV, the capillary voltage was 10 V, and its temperature was 200 °C. Tandem mass spectrometry was performed in the ion trap by collision-induced dissociation with helium gas buffer at 0.1 pascals. Data were collected and analyzed with XcaliburTM software. Total RNA from 3-week-old leaves of wild type (Col0), tDNA, and overexpressing At1g78690 lines was extracted using the RNeasy plant minikit (Qiagen). Reverse transcription-PCR was carried out with the SuperScript RT II kit (Invitrogen) using 1 μg of total RNA as template and oligo(dT) as primers. To determine the relative transcript levels of At1g78690, reverse transcription-PCR assays were performed using the following oligonucleotides: GGCCAAGTGCTAGACGAAAC as a 5′-primer and CAACCGCTTGGCTAAGAGTC as a 3′-primer. A standard curve was established using serially diluted cDNA. PCR efficiency ranged from 95 to 105%. All samples were assayed in triplicate wells. Real time PCR was performed on an iCyclerTM (Bio-Rad). Samples were amplified in a 25-μl reaction containing 1× SYBR Green Master Mix (Bio-Rad) and a 260 nm concentration of each primer. The thermal profile consisted of one cycle at 95 °C for 3 min followed by 42 cycles at 95 °C for 30 s and at 58 °C for 30 s. For each run, data acquisition and analysis were done using the iCyclerTMQ software (version 3.0a; Bio-Rad). The transcript abundance in tDNA and overexpressing samples relative to Col0 samples was determined using a comparative Ct method. The relative abundance of ACT2 (At1g49240) and EIF4 (At3g13920) mRNA in each sample was determined and used to normalize for differences in total RNA amounts. To identify and characterize lysolipid acyltransferases from A. thaliana other than the well characterized lysophosphatidic acid acyltransferase (30.Kim H.U. Li Y. Huang A.H.C. Plant Cell. 2005; 17: 1073-1089Crossref PubMed Scopus (160) Google Scholar), we sought homologies between the lysophosphatidylcholine acyltransferase from S. cerevisiae, (YPR140wp) that we previously described (31.Testet E. Akermoun M. Shimoji M. Cassagne C. Bessoule J.J. J. Lipid Res. 2002; 43: 1150-1154Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar) and open reading frames of A. thaliana. Two sequences were identified: At1g78690 and At3g05510. In the present paper, we describe results obtained for At1g78690p (the function of At3g05510p is completely different and will be described in a further article). The At1g78690p sequence presents three of the four conserved domains generally associated with glycerolipid acyltransferases (Fig. 1) and particularly the blocks I (NHX4D) and III (FPEGT) that might be the catalytic sites of these enzymes (32.Lewin T.M. Wang P. Coleman R.A. Biochemistry. 1999; 38: 5764-5771Crossref PubMed Scopus (233) Google Scholar). The calculated molecular mass of At1g78690p is 31.74 kDa for 284 amino acids. The pHi is estimated at 8.84. The sequence analysis (TMpred program; available on the World Wide Web) of At1g78690p predicts the presence of two transmembrane helixes from amino acid 14 to 37 (score 671) and from amino acid 163 to 182 (score 526). However, other prediction sites do not mention these structures (HMMTOP, TMMOD, and PHOBIUS). The presence of myristoylation sites, prenylation sites, and glycosylphosphatidylinositol anchor addition sites was also sought using the NMT, PrePS, and Big-PI Plant Predictor programs (all available on the World Wide Web). The analysis of this sequence with these programs did not evidence post-translational modifications. In addition, no targeting signal was evidenced using WolfPSORT Prediction, Target P, and MITOPROT (all available on the World Wide Web). The complete cDNA of At1g78690p was transformed into the E. coli C41 strain. After induction with isopropyl β-d-thiogalactoside, the lipids were extracted and analyzed by TLC. As shown in Fig. 2A, the lipid extract of bacteria transformed with pET15b-At1g78690 contained an additional lipid class (RF = 0.68) compared with those of bacteria transformed with the empty plasmid. Following two-dimensional TLC, it appeared that this lipid co-migrated with NAPE standard (Fig. S1). This spot was further scraped from the TLC plate and submitted to hydrolysis catalyzed by S. chromofuscus PLD. After the reaction, lipids were extracted from the incubation mixture and separated on a TLC plate. As shown in Fig. 2B, the hydrolysis of the lipid of interest by PLD led to two products identified as NAE (RF = 0.93) (Fig. 2B) and phosphatidic acid (RF = 0.31). These results are in perfect agreement with the claim that At1g78690p catalyzes the synthesis of NAPE when expressed in E. coli. To check this assumption, the lipid extracts of bacteria transformed with the cDNA of At1g78690p or with the empty vector were further analyzed by mass spectrometry. In contrast with results obtained with the lipid extract from bacteria transformed with the empty vector, several pseudomolecular ions corresponding to NAPE species were detected in the lipid extract purified from bacteria expressing At1g78690p (Fig. S2; m/z 928–1010 mass range). These ions were further characterized by MS/MS, yielding characteristic fragment ions of NAPE species (33.Chapman K.D. Moore Jr., T.S. Arch. Biochem. Biophys. 1993; 301: 21-33Crossref PubMed Scopus (69) Google Scholar, 34.Hansen H.H. Hansen S.H. Bjørnsdottir I. Hansen H.S. J. Mass Spectrom. 1999; 34: 761-767Crossref PubMed Scopus (27) Google Scholar). In agreement with the fatty acid composition of E. coli, only NAPEs containing C16:0, C16:1, C18:0, and C18:1 chains were detected. As an example, the MS/MS spectrum of the m/z 980.6 species (pseudomolecular ion [M − H]−) and its fragmentation scheme are shown in Fig. 2, C and D. Diagnostic fragment ions correspond to fatty acid carboxylate anions (palmitoleic acid at m/z 253.1 and oleic acid at m/z 281.1) and to the losses of these carboxylic acids. As already described for this type of compound (34.Hansen H.H. Hansen S.H. Bjørnsdottir I. Hansen H.S. J. Mass Spectrom. 1999; 34: 761-767Crossref PubMed Scopus (27) Google Scholar), the loss of the sn-2-carboxylate was more abundant than the loss from the sn-1-position (m/z 727.3 > m/z 699.3, and m/z 253.1 > m/z 281.1; Fig. 2C). Furthermore, the characteristic neutral loss of the N-acylethanolamine moiety following the first loss of carboxylate was also observed (m/z 417.1 and 389.1), making it possible to assign the m/z 980.6 ion to N-stearic-1-oleic-2-palmitoleic-3-phosphatidylethanolamine. More generally, results obtained by MS and MS/MS analysis are consistent with the production of NAPEs in E. coli cells expressing At1g78690p. Therefore, we assumed that the At1g78690 gene codes for a NAPE synthase from A. thaliana, but this hypothesis remained to be confirmed both in vitro and in planta. The ability of At1g78690p to synthesize NAPE was analyzed by performing enzymatic assays with 14C-labeled free fatty acids (C16:0 or C18:0) or labeled acyl-CoAs (C16:0 or C18:0) and unlabeled PE as substrates. Initial experiments were carried out by using membranes purified from E. coli transformed with the empty vector pET15b (control) or with pET15b-At1g78690 plasmid (50 μg of proteins/assay; 10-min incubation). Results are shown in Table 1. Whatever the experimental conditions used, no significant amount (<1 pmol) of NAPE was synthesized by membranes purified from E. coli transformed with the empty vector. A similar result was obtained when membranes purified from bacteria expressing At1g78690p were incubated with PE and FFA. By contrast, the same membranes synthesized about 33 pmol of NAPE when palmitoyl-CoA or stearoyl-CoA was used as acyl donor.TABLE 1Determination of the acyl donorNAPE synthesizedC16:0 FFAC16:0-CoAC18:0 FFAC18:0-CoApmolE. coli pET15b membranes0 min0.09 ± 0.000.11 ± 0.090.16 ± 0.120.10 ± 0.0910 min0.06 ± 0.040.26 ± 0.070.17 ± 0.020.12 ± 0.02E. coli pET15b ::At1g78690 membranes0 min0.19 ± 0.040.08 ± 0.020.12 ± 0.110.01 ± 0.0110 min1.23 ± 0.3132.51 ± 1.190.07 ± 0.0533.65 ± 0.97Purified protein0 min0.11 ± 0.020.20 ± 0.060.02 ± 0.010.01 ± 0.0210 min0.07 ± 0.021.82 ± 0.310.24 ± 0.043.72 ± 0.09 Open table in a new tab In a second set of experiments, we used the protein At1g78690p fused with a poly-His tag purified on an IMAC column. The NAPE synthase activity associated with the purified fraction was further determined in the presence of PE and FFA or acyl-CoA as above (40 μg proteins/assay, 10-min incubation). As in the case of in vitro assays" @default.
• W2000030207 created "2016-06-24" @default.
• W2000030207 creator A5012613845 @default.
• W2000030207 creator A5013665346 @default.
• W2000030207 creator A5030163616 @default.
• W2000030207 creator A5030322867 @default.
• W2000030207 creator A5030922078 @default.
• W2000030207 creator A5047359880 @default.
• W2000030207 creator A5053746637 @default.
• W2000030207 creator A5075960913 @default.
• W2000030207 date "2009-07-01" @default.
• W2000030207 modified "2023-10-18" @default.
• W2000030207 title "Discovery and Characterization of an Arabidopsis thaliana N-Acylphosphatidylethanolamine Synthase" @default.
• W2000030207 cites W1517790776 @default.
• W2000030207 cites W1899136466 @default.
• W2000030207 cites W1979963836 @default.
• W2000030207 cites W1992429152 @default.
• W2000030207 cites W1993559798 @default.
• W2000030207 cites W2009287523 @default.
• W2000030207 cites W2016078643 @default.
• W2000030207 cites W2021355433 @default.
• W2000030207 cites W2023794283 @default.
• W2000030207 cites W2023948994 @default.
• W2000030207 cites W2031071131 @default.
• W2000030207 cites W2031406492 @default.
• W2000030207 cites W2054178359 @default.
• W2000030207 cites W2058994001 @default.
• W2000030207 cites W2062286749 @default.
• W2000030207 cites W2069798480 @default.
• W2000030207 cites W2070257767 @default.
• W2000030207 cites W2075130308 @default.
• W2000030207 cites W2088199863 @default.
• W2000030207 cites W2088956398 @default.
• W2000030207 cites W2093005998 @default.
• W2000030207 cites W2097636957 @default.
• W2000030207 cites W2101172468 @default.
• W2000030207 cites W2110093486 @default.
• W2000030207 cites W2116122104 @default.
• W2000030207 cites W2137647403 @default.
• W2000030207 cites W2147041747 @default.
• W2000030207 cites W2147780949 @default.
• W2000030207 cites W2154142977 @default.
• W2000030207 cites W2154861643 @default.
• W2000030207 cites W2155114462 @default.
• W2000030207 cites W2158209536 @default.
• W2000030207 cites W2159835864 @default.
• W2000030207 cites W2164756163 @default.
• W2000030207 cites W2168600251 @default.
• W2000030207 doi "https://doi.org/10.1074/jbc.m109.005744" @default.
• W2000030207 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2707190" @default.
• W2000030207 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19447891" @default.
• W2000030207 hasPublicationYear "2009" @default.
• W2000030207 type Work @default.
• W2000030207 sameAs 2000030207 @default.
• W2000030207 citedByCount "24" @default.
• W2000030207 countsByYear W20000302072012 @default.
• W2000030207 countsByYear W20000302072014 @default.
• W2000030207 countsByYear W20000302072015 @default.
• W2000030207 countsByYear W20000302072017 @default.
• W2000030207 countsByYear W20000302072018 @default.
• W2000030207 countsByYear W20000302072019 @default.
• W2000030207 countsByYear W20000302072020 @default.
• W2000030207 countsByYear W20000302072021 @default.
• W2000030207 countsByYear W20000302072022 @default.
• W2000030207 crossrefType "journal-article" @default.
• W2000030207 hasAuthorship W2000030207A5012613845 @default.
• W2000030207 hasAuthorship W2000030207A5013665346 @default.
• W2000030207 hasAuthorship W2000030207A5030163616 @default.
• W2000030207 hasAuthorship W2000030207A5030322867 @default.
• W2000030207 hasAuthorship W2000030207A5030922078 @default.
• W2000030207 hasAuthorship W2000030207A5047359880 @default.
• W2000030207 hasAuthorship W2000030207A5053746637 @default.
• W2000030207 hasAuthorship W2000030207A5075960913 @default.
• W2000030207 hasBestOaLocation W20000302071 @default.
• W2000030207 hasConcept C104317684 @default.
• W2000030207 hasConcept C112243037 @default.
• W2000030207 hasConcept C143065580 @default.
• W2000030207 hasConcept C181199279 @default.
• W2000030207 hasConcept C185592680 @default.
• W2000030207 hasConcept C2775988993 @default.
• W2000030207 hasConcept C2779491563 @default.
• W2000030207 hasConcept C55493867 @default.
• W2000030207 hasConcept C59822182 @default.
• W2000030207 hasConcept C86803240 @default.
• W2000030207 hasConceptScore W2000030207C104317684 @default.
• W2000030207 hasConceptScore W2000030207C112243037 @default.
• W2000030207 hasConceptScore W2000030207C143065580 @default.
• W2000030207 hasConceptScore W2000030207C181199279 @default.
• W2000030207 hasConceptScore W2000030207C185592680 @default.
• W2000030207 hasConceptScore W2000030207C2775988993 @default.
• W2000030207 hasConceptScore W2000030207C2779491563 @default.
• W2000030207 hasConceptScore W2000030207C55493867 @default.
• W2000030207 hasConceptScore W2000030207C59822182 @default.
• W2000030207 hasConceptScore W2000030207C86803240 @default.
• W2000030207 hasIssue "28" @default.
• W2000030207 hasLocation W20000302071 @default.
• W2000030207 hasLocation W20000302072 @default.
• W2000030207 hasLocation W20000302073 @default.

• next