FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000139434> ?p ?o ?g. }

• W2000139434 endingPage "21241" @default.
• W2000139434 startingPage "21230" @default.
• W2000139434 abstract "RhoA is known to be involved in myogenic differentiation, but whether it acts as a positive or negative regulator is controversial. To resolve this issue, we investigated the differentiation stage-specific roles of RhoA and its effector, Rho-associated kinase, using C2C12 myoblasts. We found that proliferating myoblasts show high levels of RhoA and serum-response factor activities and strong expression of the downstream target of RhoA, myocardin-related transcription factor-A (MRTF-A or MAL); these activities and expression are markedly lower in differentiating myocytes. We further demonstrated that, in proliferating myoblasts, an increase in MRTF-A, which forms a complex with Smad1/4, strikingly activates the expression level of the Id3 gene; the Id3 gene product is a potent inhibitor of myogenic differentiation. Finally, we found that during differentiation, one of the forkhead transcription factors translocates into the nucleus and suppresses Id3 expression by preventing the association of the MRTF-A-Smad complex with the Id3 promoter, which leads to the enhancement of myogenic differentiation. We conclude that RhoA/Rho-associated kinase signaling plays positive and negative roles in myogenic differentiation, mediated by MRTF-A/Smad-dependent transcription of the Id3 gene in a differentiation stage-specific manner. RhoA is known to be involved in myogenic differentiation, but whether it acts as a positive or negative regulator is controversial. To resolve this issue, we investigated the differentiation stage-specific roles of RhoA and its effector, Rho-associated kinase, using C2C12 myoblasts. We found that proliferating myoblasts show high levels of RhoA and serum-response factor activities and strong expression of the downstream target of RhoA, myocardin-related transcription factor-A (MRTF-A or MAL); these activities and expression are markedly lower in differentiating myocytes. We further demonstrated that, in proliferating myoblasts, an increase in MRTF-A, which forms a complex with Smad1/4, strikingly activates the expression level of the Id3 gene; the Id3 gene product is a potent inhibitor of myogenic differentiation. Finally, we found that during differentiation, one of the forkhead transcription factors translocates into the nucleus and suppresses Id3 expression by preventing the association of the MRTF-A-Smad complex with the Id3 promoter, which leads to the enhancement of myogenic differentiation. We conclude that RhoA/Rho-associated kinase signaling plays positive and negative roles in myogenic differentiation, mediated by MRTF-A/Smad-dependent transcription of the Id3 gene in a differentiation stage-specific manner. Myogenic differentiation involves a sequence of processes as follows: withdrawal of myoblasts from the cell cycle, expression of myogenic differentiation markers in myocytes, and formation of multinucleated myotubes by myocyte fusion. These processes are controlled by the myogenic regulatory factor (MRF) 2The abbreviations used are: MRF, myogenic regulatory factor; ROCK, Rho-associated kinase; MRTF-A, myocardin-related transcription factor; Id, inhibitor of DNA binding; FKHR, forkhead in human rhabdomyosarcoma; SRF, serum response factor; MHC, myosin heavy chain; SBE, Smad binding element; GM, growth medium; DM, differentiation medium; ChIP, chromatin immunoprecipitation; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HA, hemagglutinin; ca, constitutively active; BMP, bone morphogenetic protein. family and belong to basic helix-loop-helix proteins, consisting of MyoD, Myf5, myogenin, and MRF4 (1Molkentin J.D. Olson E.N. Curr. Opin. Genet. Dev. 1996; 6: 445-453Crossref PubMed Scopus (390) Google Scholar, 2Olson E.N. Klein W.H. Genes Dev. 1994; 8: 1-8Crossref PubMed Scopus (605) Google Scholar, 3Sabourin L.A. Rudnicki M.A. Clin. Genet. 2000; 57: 16-25Crossref PubMed Scopus (565) Google Scholar). The MRFs interact with ubiquitous basic helix-loop-helix proteins such as E12/E47 (E proteins) via their helix-loop-helix motifs, and the basic domains of the dimerized proteins activate transcription by binding to a conserved DNA sequence known as the E-box in the promoter regions of target genes. A family of inhibitors of DNA binding (Id) (Id1, Id2, Id3, and Id4), which has a helix-loop-helix domain but lacks the basic DNA-binding domain, counteracts the active MRF/E protein complexes by forming transcriptionally inactive complexes, consisting of either MRF/Id or E protein/Id (4Benezra R. Davis R.L. Lockshon D. Turner D.L. Weintraub H. Cell. 1990; 61: 49-59Abstract Full Text PDF PubMed Scopus (1804) Google Scholar, 5Jen Y. Weintraub H. Benezra R. Genes Dev. 1992; 6: 1466-1479Crossref PubMed Scopus (398) Google Scholar, 6Ruzinova M.B. Benezra R. Trends Cell Biol. 2003; 13: 410-418Abstract Full Text Full Text PDF PubMed Scopus (494) Google Scholar). The Rho family GTPases are involved in a variety of cytoskeleton-associated cellular events, such as reorganization of the actin cytoskeleton, microtubule dynamics, transcriptional regulation, and cell differentiation, including myogenic differentiation (7Etienne-Manneville S. Hall A. Nature. 2002; 420: 629-635Crossref PubMed Scopus (3875) Google Scholar). The RhoA-dependent activation of serum response factor (SRF) is required for the expression of MyoD and skeletal (SK) α-actin. Thus, RhoA acts through SRF to positively regulate myogenic differentiation (8Carnac G. Primig M. Kitzmann M. Chafey P. Tuil D. Lamb N. Fernandez A. Mol. Biol. Cell. 1998; 9: 1891-1902Crossref PubMed Scopus (110) Google Scholar, 9Gauthier-Rouviere C. Vandromme M. Tuil D. Lautredou N. Morris M. Soulez M. Kahn A. Fernandez A. Lamb N. Mol. Biol. Cell. 1996; 7: 719-729Crossref PubMed Scopus (73) Google Scholar, 10Takano H. Komuro I. Oka T. Shiojima I. Hiroi Y. Mizuno T. Yazaki Y. Mol. Cell. Biol. 1998; 18: 1580-1589Crossref PubMed Scopus (132) Google Scholar, 11Wei L. Zhou W. Croissant J.D. Johansen F.E. Prywes R. Balasubramanyam A. Schwartz R.J. J. Biol. Chem. 1998; 273: 30287-30294Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) and has therefore been referred to as a positive regulator of myogenic differentiation. However, recent studies have revealed that the expression of constitutively active RhoA results in failed myotube formation, and the inactivation of one of the downstream effectors of RhoA, Rho-associated kinase (ROCK), enhances myotube formation (12Castellani L. Salvati E. Alemà S. Falcone G. J. Biol. Chem. 2006; 281: 15249-15257Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 13Charrasse S. Comunale F. Grumbach Y. Poulat F. Blangy A. Gauthier-Rouvière C. Mol. Biol. Cell. 2006; 17: 749-759Crossref PubMed Scopus (107) Google Scholar, 14Meriane M. Roux P. Primig M. Fort P. Gauthier-Rouvière C. Mol. Biol. Cell. 2000; 11: 2513-2528Crossref PubMed Scopus (98) Google Scholar, 15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Thus, apparently conflicting roles of RhoA signaling in myogenic differentiation have been reported. It is well documented that actin polymerization in response to RhoA signaling enhances SRF activity, as a consequence of the nuclear translocation of myocardin-related transcription factors (MRTF-A/B, also referred to as MAL1/2) (16Miralles F. Posern G. Zaromytidou A.I. Treisman R. Cell. 2003; 113: 329-342Abstract Full Text Full Text PDF PubMed Scopus (1068) Google Scholar). MRTF-A is reportedly involved in heart and smooth muscle gene expression (17Cen B. Selvaraj A. Prywes R. J. Cell. Biochem. 2004; 93: 74-82Crossref PubMed Scopus (137) Google Scholar, 18Pipes G.C. Creemers E.E. Olson E.N. Genes Dev. 2006; 20: 1545-1556Crossref PubMed Scopus (393) Google Scholar). Consistent with these findings, the expression of dominant-negative forms of MRTF-A and MRTF-B (dn-MRTF-A and dn-MRTF-B), which inhibit SRF activation, generates abnormally thin muscle fibers in vivo (19Li S. Czubryt M.P. McAnally J. Bassel-Duby R. Richardson J.A. Wiebel F.F. Nordheim A. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1082-1087Crossref PubMed Scopus (231) Google Scholar) and inhibits myogenic differentiation in vitro (20Selvaraj A. Prywes R. J. Biol. Chem. 2003; 278: 41977-41987Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The molecular mechanism underlying the contribution of the MRTFs to myogenic differentiation, however, remains unclear. One of the forkhead family transcription factors, FKHR (also named Foxo1), is required for myocyte fusion (15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 21Bois P.R. Grosveld G.C. EMBO J. 2003; 22: 1147-1157Crossref PubMed Scopus (142) Google Scholar, 22Bois P.R. Brochard V.F. Salin-Cantegrel A.V. Cleveland J.L. Grosveld G.C. Mol. Cell. Biol. 2005; 25: 7645-7656Crossref PubMed Scopus (25) Google Scholar). Because ROCK directly phosphorylates FKHR in myocytes, resulting in the export of FKHR from the nucleus, the inactivation of RhoA/ROCK signaling is prerequisite for the nuclear localization of FKHR and myocyte fusion (15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). In various other cell types, FKHR that is phosphorylated by Akt, but not by ROCK, is also exported from the nucleus, leading to the inhibition of FKHR-mediated transcription (23Birkenkamp K.U. Coffer P.J. Biochem. Soc. Trans. 2003; 31: 292-297Crossref PubMed Google Scholar). However, the target partners of FKHR and its function in myogenic differentiation remain unknown, except for a Foxo1a-cyclic GMP-dependent kinase I interaction (22Bois P.R. Brochard V.F. Salin-Cantegrel A.V. Cleveland J.L. Grosveld G.C. Mol. Cell. Biol. 2005; 25: 7645-7656Crossref PubMed Scopus (25) Google Scholar). Here, we investigated the role of RhoA/ROCK signaling during myogenic differentiation using C2C12 cells and demonstrated that transcription of the Id3 gene is controlled by MRTF-A/Smad in an FKHR-dependent manner. In proliferating myoblasts, where RhoA activity and MRTF-A expression are relatively high, RhoA-triggered MRTF-A/Smad1/4 pre-dominantly activates transcription of the Id3 gene. Simultaneously, FKHR, possibly phosphorylated by ROCK, is retained in the cytoplasm. In contrast, in differentiating myocytes, where RhoA activity and MRTF-A expression are decreased, FKHR translocates into the nucleus, where it interacts with MRTF-A/Smad1/4, causing the MRTF-A-Smad1/4 complex to dissociate from the Id3 promoter, and thereby suppressing the MRTF-A/Smad-dependent Id3 expression. Taken together, the results of this study uncover why there are conflicting views regarding the role of RhoA/ROCK signaling in myogenic differentiation; differentiation stage-specific RhoA/ROCK signaling and activities of its downstream transcription factors, MRTF-A and FKHR, regulate the Smad-dependent transcription of the Id3 gene. Reagents and Antibodies—Y-27632 was purchased from Cal-biochem. Tat-C3 was prepared according to a method described elsewhere (24Park J. Kim J.S. Jung K.C. Lee H.J. Kim J.I. Kim J. Lee J.Y. Park J.B. Choi S.Y. Mol. Cells. 2003; 16: 216-223PubMed Google Scholar). Commercially available antibodies were as follows: anti-FLAG (M2), anti-α-sarcomeric actin (5C5), and anti-α-tubulin (DM1A) antibodies (Sigma); anti-hemagglutinin (HA) (3F10) antibody (Roche Applied Science); anti-MyoD, anti-myogenin, anti-SRF, anti-Smad1/5/8, and anti-Id3 antibodies (Santa Cruz Biotechnology); anti-myosin heavy chain (MHC) antibody (MF20) (Developmental Studies Hybridoma Bank); anti-FKHR antibody (Cell Signaling); horseradish peroxidase-linked anti-rabbit or -mouse IgG (GE Healthcare); horseradish peroxidase-linked anti-rat IgG (Rockland). Anti-MRTF-A and -MRTF-B antibodies were generated in rabbits using recombinant proteins consisting of amino acids 776-901 of human MRTF-A and amino acids 931-1061 of human MRTF-B as the epitopes. IgGs were affinity-purified from the antisera raised against MRTF-A and MRTF-B on their respective affinity columns and used in this study (25Morita T. Mayanagi T. Sobue K. J. Cell Biol. 2007; 3: 1027-1042Crossref Scopus (227) Google Scholar). Plasmid Constructs—The cDNAs of mouse RhoA, Smad1, Smad4, MRTF-A, and FKHR were amplified by reverse transcriptase (RT)-PCR and inserted into a mammalian expression plasmid, pCS2+ or pcDNA3.1, with the indicated tags. Expression plasmids for the constitutively active form of RhoA (RhoA-V14) and pseudo-phosphorylated Smad1 (26Qin B.Y. Chacko B.M. Lam S.S. de Caestecker M.P. Correia J.J. Lin K. Mol. Cell. 2001; 8: 1303-1312Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) were constructed by site-directed mutagenesis. The expression plasmid for N-terminally deleted MRTF-A, which acts as a constitutively active form, was constructed as described previously (16Miralles F. Posern G. Zaromytidou A.I. Treisman R. Cell. 2003; 113: 329-342Abstract Full Text Full Text PDF PubMed Scopus (1068) Google Scholar). The promoter region of the mouse Id3 gene, spanning from -2000 to +55, was isolated from the genome of C2C12 myoblasts using PCR and inserted into the pGL3-Basic plasmid (Promega) (Id3 (-2000/+55)-Luc). Deletions and mutant derivatives from Id3 (-2000/+55)-Luc, as indicated, were constructed using the PCR-mediated method. The mutations in the Smad-binding element (SBE) were introduced into pGL3-Id3-Luc as follows: the mutant SBE was changed from GTCTG to ATGTA and from CAGAC to CGTGC. The tetracycline-regulated inducible expression plasmids for HA-tagged RhoA-V14 and FLAG-tagged constitutively active MRTF-A (ca-MRTF-A) were constructed in the pTRE-tight expression plasmid (Clontech). The 3×CArG-Luc, referred to as 3D.ALuc (27Copeland J.W. Treisman R. Mol. Biol. Cell. 2002; 13: 4088-4099Crossref PubMed Scopus (163) Google Scholar), which consists of three copies of c-fos serum-responsive element without the ternary complex factor binding element or the basal promoter region of the Xenopus actin gene (28Mohun T. Garrett N. Treisman R. EMBO J. 1987; 6: 667-673Crossref PubMed Scopus (101) Google Scholar), was constructed to assay the transcriptional activity of SRF. All these constructs were confirmed by sequencing. Cell Cultures and Transfection—C2C12 mouse myoblasts were maintained in Dulbecco's modified Eagle's medium supplemented with 20% fetal calf serum (growth medium (GM)). To induce myogenic differentiation, the culture medium was shifted to Dulbecco's modified Eagle's medium supplemented with 2% horse serum (differentiation medium (DM)) at the indicated times. HEK293T cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Transfection of the indicated expression plasmids into these cells was performed using Lipofectamine 2000 (Invitrogen). Stable transfectants of C2C12 cells carrying the tetracycline-regulated inducible expression system of HA-RhoA-V14 and FLAG-ca-MRTF-A were isolated as follows. First, we selected C2C12 stable transfectants carrying the pTet-Off plasmid by geneticin. Second, we introduced the expression plasmid, pTER-HA-RhoA-V14 or pTRE-FLAG-ca-MRTF-A into stable C2C12-pTet-Off transfectants and isolated cells carrying both the pTet-Off plasmid and the respective expression plasmid (C2C12-HA-RhoA-V14 and C2C12-FLAG-ca-MRTF-A), by selection with hygromycin B. Promoter Assays—Proliferating C2C12 myoblasts cultured in GM were co-transfected with the indicated plasmid and pSV-β-gal (Promega). Luciferase and β-galactosidase activities were assayed 2 days after changing the medium from GM to DM as follows. The cell extracts were prepared by passive lysis buffer (Promega) according to the manufacturer's instructions and then assayed for luciferase activity using the luciferase kit (Promega). The promoter activity was expressed in relative units normalized to the β-galactosidase activity in the cell extracts. These assays were done in triplicate and were performed independently at least three times. Immunocytochemistry—The cells were fixed with 4% formal-dehyde for 30 min, permeabilized, and blocked with 0.1% Triton X-100 and 0.2% bovine serum albumin in phosphate-buffered saline, for 1 h at room temperature. The cells were then incubated with the anti-MHC antibody for 2 h followed by Alexa Fluor 568 anti-mouse IgG (Molecular Probes), with or without Hoechst 33258, for 2 h at room temperature. Fluorescence images were collected using a cooled charge-coupled device camera (Roper Scientific, Tucson, AZ), mounted on an Olympus IX-70 microscope with the appropriate filters, and MetaMorph software. GTP-bound RhoA Pulldown Assay—RhoA activity was determined by a GTP-bound RhoA pulldown assay using the Rho activation assay kit (Upstate Biotech), according to the manufacturer's protocol. Chromatin Immunoprecipitation (ChIP) Assay—ChIP assays were carried out using the ChIP assay kit (Upstate Biotech), according to the manufacturer's protocol with some modifications. DNAs isolated from the input chromatin fragments and those from chromatin fragments precipitated by the anti-MRTF-A antibody or control IgG were subjected to PCR using primers flanking the SBE motif in the mouse Id3 promoter (-531 to -316). These primer sequences were as follows: Id3 sense primer, CTCTGGTCACAAGATAATTCC; Id3 antisense primer, GCGCCCAAGTTCTCTGAG. Gel-shift Assay—A probe containing the SBE motif sequence of the Id3 promoter was amplified by PCR and end-labeled with [32P]dCTP by the Klenow fragment. The sequence of the sense strand of this probe was AATTCCTGACGCCAGTGAGTCTGGAGGTCAGACGAGCAGCAAATTGGGGA. The gel-shift assay was carried out using whole-cell extracts from C2C12 myoblasts (29Brennan T.J. Olson E.N. Genes Dev. 1990; 4: 582-595Crossref PubMed Scopus (174) Google Scholar). Semiquantitative RT-PCR—The total RNAs were extracted from C2C12 cells cultured under the indicated conditions, and the expression level of Id1, Id2, Id3, twist, myostatin, c-fos, and c-myc mRNAs was quantified by RT-PCR normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, as described previously (30Hayashi K. Nakamura S. Nishida W. Sobue K. Mol. Cell. Biol. 2006; 26: 9456-9470Crossref PubMed Scopus (75) Google Scholar). The specific primer sets were as follows: Id1 sense primer, TGGACGAGCAGCAGGTGAACG; Id1 antisense primer, GCACTGATCTCGCCGTTCAGG; Id2 sense primer, AGCCTTCAGTCCGGTGAGGTCC; Id2 antisense primer, TCAGATGCCTGCAAGGACACG; Id3 sense primer, TGCTACGAGGCGGTGTGCTG; Id3 antisense primer, AGTGAGCTCAGCTGTCTGGATCGG; twist sense primer, CCTCGGACAAGCTGAGCAAGAT; twist antisense primer, CTAGTGGGACGCGGACATGGA; myostatin sense primer, ACGCTACCACGGAAACAATC; myostatin antisense primer, TGGTCCTGGGAAGGTTACAG; c-fos sense primer, GGATTTGACTGGAGGTCTGC; c-fos antisense primer, AAGTAGTGCAGCCCGGAGTA; c-myc sense primer, CAGCAGAGCGAGCTGCAGC; c-myc antisense primer, TCTTTGCGCGCAGCCTGGTA; HA-RhoA-V14 sense primer, TACCCATACGATGTTCCAGAT; HA-RhoA-V14 antisense primer, CTAAACTATCAGGGCTGTCG; GAPDH sense primer, TCTTCACCACCATGGAGAAGG; GAPDH antisense primer, GAAGGCCATGCCAGTGAG. Quantitative Real Time RT-PCR—The expression of Id3 mRNA in C2C12 cells was analyzed by real time RT-PCR using SYBR GreenER qPCR SuperMix (Invitrogen). The levels of Id3 mRNA were normalized to GAPDH mRNA expression. The primers used in these analyses are as follows: Id3 sense primer, TCCTGGCACCTCCCGAAC; Id3 antisense primer, TAAGTGAAGAGGGCTGGGTTAAG; GAPDH sense primer, CGTGCCGCCTGGAGAAAC; GAPDH antisense primer, TGGGAGTTGCTGTTGAAGTCG. Knockdown Using siRNA—Proliferating C2C12 cells were transfected with siRNA using Lipofectamine RNAiMAX (Invitrogen) and were cultured in GM for 2 days. The siRNAs against Id3 were purchased from Sigma, and their sequences were as follows: Id3 siRNA1, 5′-GCAUGGAUGAGCUUCGAUCTT-3′; Id3 siRNA2, 5′-CUGGUCAGCAGCUGGGCAATT-3′. In control experiments, scrambled siRNA (Santa Cruz Biotechnology) was used. Immunoprecipitation, Immunoblotting, and Cellular Fractionation—The whole-cell extracts were prepared from C2C12 and HEK293T cells transfected with the indicated expression plasmids by lysis in buffer containing 50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.1% Nonidet P-40, 5% glycerol, and protease inhibitor mixture tablets (Roche Applied Science), and sonication with a Digital Sonifier (Branson). The extracts thus obtained were incubated with the indicated antibodies for 3 h at 4 °C, and the immune complexes were collected by incubation with protein A- or protein G-Sepharose beads for 1 h at 4 °C. Proteins in the immunoprecipitates were detected by immunoblotting using the indicated antibodies. The target proteins were detected with a SuperSignal chemiluminescence detection kit (Pierce). In immunoblotting analysis of the Id3 protein, we used Can Get Signal (TOYOBO) to detect chemifluorescent signals. The cytosol and nuclear fractions were prepared as described elsewhere (15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). DNA Affinity Binding Assay—The proteins translated by in vitro transcription/translation systems (Promega) were incubated with a double-stranded biotinylated DNA probe (1 mg) in gel-shift binding buffer (29Brennan T.J. Olson E.N. Genes Dev. 1990; 4: 582-595Crossref PubMed Scopus (174) Google Scholar) containing 5 mg of poly(dI-dC), 20 mg of herring sperm DNA, and 0.5% Nonidet P-40 for 30 min on ice (31Suzuki T. Fujisawa J.I. Toita M. Yoshida M. Proc. Natl. Acad. Sci. U. S. A. 1993; 15: 610-614Crossref Scopus (246) Google Scholar). Streptavidin M-280 Dynabeads (Dynal) were then added, and the mixture was further incubated with rotation for 2 h at 4 °C. The DNA-bound proteins were analyzed by immunoblotting with the indicated antibodies. The sequence of the sense strand of this probe was as follows: AATTCCTGACGCCAGTGAGTCTGGAGGTCAGACGAGCAGCAAATTGGGGA. RhoA/ROCK Signaling Orchestrates Myogenic Differentiation in a Stage-specific Manner—As described in the Introduction, conflicting roles of RhoA signaling in myogenic differentiation have been reported. We hypothesized that RhoA signaling may be differentially involved in myogenic differentiation in a stage-specific manner. To test our hypothesis, we studied the effects of RhoA on myogenic phenotypes at both the proliferating and differentiating stages (Fig. 1A). First, we analyzed the roles of RhoA and ROCK in myogenic differentiation using the cell-permeable Rho-specific inhibitor, tat-C3, and the ROCK inhibitor, Y-27632. As shown in Fig. 1B, treatment of the proliferating myoblasts with tat-C3 or Y-27632 suppressed the formation of myotubes after myogenic differentiation was induced, as determined by monitoring the expression of MHC and myotube formation. In contrast, when these treatments were given after the cells had started differentiating (treatment during the last 2 days in DM), MHC-positive myotube formation was markedly enhanced. In accordance with previous studies (12Castellani L. Salvati E. Alemà S. Falcone G. J. Biol. Chem. 2006; 281: 15249-15257Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), treatment with Y-27632 during the entire differentiation period (all 4 days in DM) also enhanced myogenic differentiation (data not shown). We performed the additional experiments using Y-27632, because its effect on myotube formation was greater than that of tat-C3 (Fig. 1B). Consistent with the morphological changes it caused, treatment with Y-27632 during differentiation enhanced the expression levels of myogenic markers, such as myogenin, SK α-actin, and MHC proteins, whereas these enhancements were not observed when the Y-27632 treatment was given during proliferation (Fig. 1C). MyoD expression in the Y-27632-treated proliferating myoblasts was down-regulated compared with that in control cells. To verify whether RhoA signaling regulates myogenic differentiation, we isolated stable C2C12 cell lines carrying a tetracycline-inducible expression system for constitutively active RhoA, RhoA-V14. The induction of RhoA-V14 expression during differentiation strikingly inhibited myotube formation (Fig. 1D) and the expression of SK α-actin and MHC, but it did not affect myogenin expression (Fig. 1E). These results indicated that RhoA/ROCK signaling in proliferating myoblasts is prerequisite for maintaining the capacity of myogenic differentiation, which features the up-regulation of MyoD expression, but RhoA/ROCK signaling suppresses differentiation in differentiating myocytes. RhoA and SRF Activities and MRTF-A Expression Are Down-regulated during Myogenic Differentiation—We next examined the endogenous activities of RhoA and its downstream molecules during myogenic differentiation. Consistent with a previous study (15Nishiyama T. Kii I. Kudo A. J. Biol. Chem. 2004; 279: 47311-47319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), we found the RhoA activity was decreased during differentiation (Fig. 2A). The activity of SRF, which is a well characterized downstream target of RhoA, rapidly decreased in association with the RhoA activity (Fig. 2B). The expression level of an SRF cofactor, MRTF-A, also decreased after the induction of myogenic differentiation, although the levels of SRF and another cofactor, MRTF-B, remained unchanged (Fig. 2C). Thus, the strong activation of RhoA and SRF and of MRTF-A expression in proliferating myoblasts and their down-regulation in differentiating myocytes is adapted to effect the appropriate myogenic processes. Inactivation of ROCK Results in the Down-regulation of Id3 Expression—To study the mechanism underlying the enhanced myogenic differentiation caused by Y-27632 (Fig. 1), we analyzed the expressional changes of factors that are known to be inhibitory for myogenic differentiation, such as Ids1-3 (4Benezra R. Davis R.L. Lockshon D. Turner D.L. Weintraub H. Cell. 1990; 61: 49-59Abstract Full Text PDF PubMed Scopus (1804) Google Scholar, 32Atherton G.T. Travers H. Deed R. Norton J.D. Cell Growth & Differ. 1996; 7: 1059-1066PubMed Google Scholar, 33Melnikova I.N. Christy B.A. Cell Growth & Differ. 1996; 7: 1067-1079PubMed Google Scholar, 34Melnikova I.N. Bounpheng M. Schatteman G.C. Gilliam D. Christy B.A. Exp. Cell Res. 1999; 247: 94-104Crossref PubMed Scopus (42) Google Scholar), twist (35Spicer D.B. Rhee J. Cheung W.L. Lassar A.B. Science. 1996; 272: 1476-1480Crossref PubMed Scopus (278) Google Scholar), myostatin (36Langley B. Thomas M. Bishop A. Sharma M. Gilmour S. Kambadur R. J. Biol. Chem. 2002; 277: 49831-49840Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar), c-fos (37Li L. Chambard J.C. Karin M. Olson E.N. Genes Dev. 1992; 6: 676-689Crossref PubMed Scopus (189) Google Scholar), and c-myc (38Miner J.H. Wold B.J. Mol. Cell. Biol. 1991; 11: 2842-2851Crossref PubMed Scopus (145) Google Scholar) (Fig. 3A). In agreement with previous reports (4Benezra R. Davis R.L. Lockshon D. Turner D.L. Weintraub H. Cell. 1990; 61: 49-59Abstract Full Text PDF PubMed Scopus (1804) Google Scholar, 32Atherton G.T. Travers H. Deed R. Norton J.D. Cell Growth & Differ. 1996; 7: 1059-1066PubMed Google Scholar, 33Melnikova I.N. Christy B.A. Cell Growth & Differ. 1996; 7: 1067-1079PubMed Google Scholar, 34Melnikova I.N. Bounpheng M. Schatteman G.C. Gilliam D. Christy B.A. Exp. Cell Res. 1999; 247: 94-104Crossref PubMed Scopus (42) Google Scholar), the expression levels of Id1, Id2, and Id3 mRNAs were significantly down-regulated during myogenic differentiation. The Id3 mRNA, but not the mRNA for twist, myostatin, c-fos, or c-myc, was further down-regulated in response to Y-27632 treatment. These results suggest that the Y-27632 treatment-induced enhancement of myogenic differentiation might have been due to the down-regulation of Id3 expression. To confirm the specific inhibition of ROCK by Y-27632, siRNA-mediated ROCK1 and ROCK2 knockdown was carried out. The expression of Id3 was decreased by knockdown of ROCK in proliferating myoblasts (data not shown). Furthermore, we addressed a role of RhoA, upstream effector of ROCK, in the transcription of Id3 gene. The induction of RhoA-V14 increased the expression of Id3 in tetracycline-regulated C2C12 cells (Fig. 3B). Both analyses by semi-quantitative and real time RT-PCR revealed that the up-regulation of Id3 expression is modest in proliferating myoblasts but is marked in differentiating myocytes. These results indicated that the transcription of Id3 gene is up-regulated by RhoA/ROCK1 signaling but is not regulated by the pathway mediated through ROCK2. Forced Activation of MRTF-A in Differentiating Myocytes Inhibits Myogenic Differentiation via the Induction of Id3 Expression—Because the expression of MRTF-A was reduced in differentiating myocytes compared with its high levels in proliferating myoblasts (Fig. 2C), we focused on downstream events in the RhoA/MRTF-A pathway. To examine the effect of MRTF-A on differentiating myocytes, we isolated stable C2C12 cell lines carrying a tetracycline-inducible expression system for constitutively active MRTF-A (ca-MRTF-A). Using these cell lines, we found that the induction of ca-MRTF-A after the start of differentiation markedly suppressed myotube formation (Fig. 4A) as well as the expression of myogenic differentiation markers, including myogenin, SK α-actin, and MHC (Fig. 4B). We also analyzed the expression levels of factors that are inhibitory for myogenic differentiation. Id3 expression was solely up-regulated at both the protein and mRNA levels in myocytes expressing ca-MRTF-A during differentiation, but the other inhibitory fact" @default.
• W2000139434 created "2016-06-24" @default.
• W2000139434 creator A5026631659 @default.
• W2000139434 creator A5055208886 @default.
• W2000139434 creator A5071406482 @default.
• W2000139434 creator A5072243886 @default.
• W2000139434 date "2008-07-01" @default.
• W2000139434 modified "2023-09-27" @default.
• W2000139434 title "Rho/Rho-associated Kinase Signal Regulates Myogenic Differentiation via Myocardin-related Transcription Factor-A/Smad-dependent Transcription of the Id3 Gene" @default.
• W2000139434 cites W1952579501 @default.
• W2000139434 cites W1967487834 @default.
• W2000139434 cites W1969066867 @default.
• W2000139434 cites W1974510381 @default.
• W2000139434 cites W1983019887 @default.
• W2000139434 cites W198477152 @default.
• W2000139434 cites W1996008839 @default.
• W2000139434 cites W1996563680 @default.
• W2000139434 cites W2003573512 @default.
• W2000139434 cites W2003879283 @default.
• W2000139434 cites W2004966843 @default.
• W2000139434 cites W2011002905 @default.
• W2000139434 cites W2013046038 @default.
• W2000139434 cites W2019731805 @default.
• W2000139434 cites W2027547668 @default.
• W2000139434 cites W2033642648 @default.
• W2000139434 cites W2034342175 @default.
• W2000139434 cites W2037914020 @default.
• W2000139434 cites W2046121393 @default.
• W2000139434 cites W2048555187 @default.
• W2000139434 cites W2049496770 @default.
• W2000139434 cites W2059088759 @default.
• W2000139434 cites W2064013576 @default.
• W2000139434 cites W2067953703 @default.
• W2000139434 cites W2071203800 @default.
• W2000139434 cites W2074950809 @default.
• W2000139434 cites W2076073579 @default.
• W2000139434 cites W2076282408 @default.
• W2000139434 cites W2081544530 @default.
• W2000139434 cites W2092846222 @default.
• W2000139434 cites W2093723806 @default.
• W2000139434 cites W2094579915 @default.
• W2000139434 cites W2098996804 @default.
• W2000139434 cites W2101927529 @default.
• W2000139434 cites W2105308330 @default.
• W2000139434 cites W2110074960 @default.
• W2000139434 cites W2118256368 @default.
• W2000139434 cites W2122740586 @default.
• W2000139434 cites W2123525273 @default.
• W2000139434 cites W2125164793 @default.
• W2000139434 cites W2127384423 @default.
• W2000139434 cites W2128466236 @default.
• W2000139434 cites W2137346711 @default.
• W2000139434 cites W2137350093 @default.
• W2000139434 cites W2139602514 @default.
• W2000139434 cites W2143850042 @default.
• W2000139434 cites W2145183379 @default.
• W2000139434 cites W2147927258 @default.
• W2000139434 cites W2153289066 @default.
• W2000139434 cites W2153535814 @default.
• W2000139434 cites W2159511823 @default.
• W2000139434 cites W2164713351 @default.
• W2000139434 doi "https://doi.org/10.1074/jbc.m710525200" @default.
• W2000139434 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3258938" @default.
• W2000139434 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18477564" @default.
• W2000139434 hasPublicationYear "2008" @default.
• W2000139434 type Work @default.
• W2000139434 sameAs 2000139434 @default.
• W2000139434 citedByCount "52" @default.
• W2000139434 countsByYear W20001394342012 @default.
• W2000139434 countsByYear W20001394342013 @default.
• W2000139434 countsByYear W20001394342014 @default.
• W2000139434 countsByYear W20001394342015 @default.
• W2000139434 countsByYear W20001394342016 @default.
• W2000139434 countsByYear W20001394342017 @default.
• W2000139434 countsByYear W20001394342018 @default.
• W2000139434 countsByYear W20001394342019 @default.
• W2000139434 countsByYear W20001394342020 @default.
• W2000139434 countsByYear W20001394342021 @default.
• W2000139434 countsByYear W20001394342022 @default.
• W2000139434 countsByYear W20001394342023 @default.
• W2000139434 crossrefType "journal-article" @default.
• W2000139434 hasAuthorship W2000139434A5026631659 @default.
• W2000139434 hasAuthorship W2000139434A5055208886 @default.
• W2000139434 hasAuthorship W2000139434A5071406482 @default.
• W2000139434 hasAuthorship W2000139434A5072243886 @default.
• W2000139434 hasBestOaLocation W20001394341 @default.
• W2000139434 hasConcept C104317684 @default.
• W2000139434 hasConcept C138885662 @default.
• W2000139434 hasConcept C179926584 @default.
• W2000139434 hasConcept C185592680 @default.
• W2000139434 hasConcept C2780286377 @default.
• W2000139434 hasConcept C2781080636 @default.
• W2000139434 hasConcept C41895202 @default.
• W2000139434 hasConcept C54355233 @default.
• W2000139434 hasConcept C62478195 @default.
• W2000139434 hasConcept C69053785 @default.
• W2000139434 hasConcept C86339819 @default.
• W2000139434 hasConcept C86803240 @default.

• next