FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000238106> ?p ?o ?g. }

• W2000238106 endingPage "558" @default.
• W2000238106 startingPage "558" @default.
• W2000238106 abstract "Okra, Abelmoschus esculentus L., is a popular vegetable grown in Iraq. Three pathogens have been identified as causal agents of damping-off of okra in Iraq: Pythium spp., Rhizoctonia solani, and Fusarium solani (1). In California and Brazil, Phytophthora nicotianae has also been reported as a pathogen of okra (2). P. nicotianae can cause significant damage when soils are cool to warm (20 to 30°C) and wet. Damping-off is now considered one of the most important and destructive diseases of okra in Iraq with disease incidence reaching 50 to 75% in some fields. In March and April 2012, symptoms of damping-off were observed in two okra fields of ~0.75 and 1.50 ha located north and south of Baghdad, Iraq, respectively. The symptoms included dark brown lesions that coalesced, girdling the stem at the base, and causing seedling collapse within a few days. Symptomatic tissues were surface-sterilized in 1% NaOCl for 1 min and plated on potato dextrose agar (PDA). Emerging fungal colonies were transferred to new plates of PDA and incubated at 25°C. P. nicotianae was identified by morphological and molecular techniques. Spherical, bipapillate sporangia had a mean length of 48 μm, mean width of 40 μm, and 1.0 to 1.4:1.0 ratio of length to breadth with 40-μm-long chlamydospores. Oospores and antheridia were not observed when two isolates were grown on PDA or in water. Swelling and radiating hyphae developed in water culture. No hyphal growth was observed on PDA when the culture was incubated at 35°C. These morphological and cultural characteristics were similar to those reported by van Breda de Haan (4) concerning P. nicotianae. The identification of two isolates was confirmed by sequencing the internal transcribed spacer (ITS) region of rDNA using forward and reverse primers (ITS1: I1, TCCGTAGGTGAACCTGCGG; and ITS4: I4, TCCTCCGCTTATTGATATGC, respectively) at the BCCM/LMG Microbiology Collection Laboratory for Microbiology, University of Ghent, Belgium (MUCL 54380). The ITS rDNA consensus sequence for the two isolates showed 99% identity with the ITS sequences of known P. nicotianae isolates, and was deposited in GenBank. Pathogenicity tests of one of the isolates of P. nicotianae were performed on okra seedlings of a local cultivar grown in a 1:1 mixture of sterile soil and peat moss in pots (each 5 cm tall × 10 cm wide). The soil peat mix in each pot was infested with a half PDA plate of fungal growth (7 days old), from which the mycelium and agar were homogenized and added to the soil. A half PDA plate without P. nicotianae was added to potting mix for the non-inoculated treatment. Ten okra seeds were sown in each pot and three pots were used for each treatment. Plants were irrigated as needed with sterilized water, and maintained in a greenhouse at 25 ± 2°C with 100% relative humidity for 48 h by covering the pots with polyethylene bag. Thereafter, the bags were removed and the pots kept in the greenhouse at ambient relative humidity (approximately 50%) for 5 days. Inoculated plants showed seed decay and damping-off after 7 days, whereas control plants remained healthy. The pathogen reisolated from inoculated seedling had the same morphological and molecular (ITS rDNA) characteristics as described above. References: (1) A. J. Al Ashoor. Ph.D. Thesis, University of Koofa, Iraq, 2009. (2) D. C. Erwin. Phytopathology 54:114, 1964. (3) D. S. M. Maria et al. Summa Phytopatológica 29:193, 2003. (4) C. Waterhouse. Key to the Species of Phytophthora De Bary. Comm. Mycol. Papers No. 92, 1963." @default.
• W2000238106 created "2016-06-24" @default.
• W2000238106 creator A5037728610 @default.
• W2000238106 date "2013-04-01" @default.
• W2000238106 modified "2023-10-14" @default.
• W2000238106 title "First Report of Damping-Off of Okra Caused by <i>Phytophthora nicotianae</i> in Iraq" @default.
• W2000238106 doi "https://doi.org/10.1094/pdis-08-12-0735-pdn" @default.
• W2000238106 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30722238" @default.
• W2000238106 hasPublicationYear "2013" @default.
• W2000238106 type Work @default.
• W2000238106 sameAs 2000238106 @default.
• W2000238106 citedByCount "3" @default.
• W2000238106 countsByYear W20002381062017 @default.
• W2000238106 countsByYear W20002381062019 @default.
• W2000238106 countsByYear W20002381062022 @default.
• W2000238106 crossrefType "journal-article" @default.
• W2000238106 hasAuthorship W2000238106A5037728610 @default.
• W2000238106 hasConcept C128905523 @default.
• W2000238106 hasConcept C144027150 @default.
• W2000238106 hasConcept C174618031 @default.
• W2000238106 hasConcept C2776096895 @default.
• W2000238106 hasConcept C2776203682 @default.
• W2000238106 hasConcept C2778138406 @default.
• W2000238106 hasConcept C2778342517 @default.
• W2000238106 hasConcept C2778660310 @default.
• W2000238106 hasConcept C2780100698 @default.
• W2000238106 hasConcept C2780104187 @default.
• W2000238106 hasConcept C2780269520 @default.
• W2000238106 hasConcept C2780476228 @default.
• W2000238106 hasConcept C2780644372 @default.
• W2000238106 hasConcept C33034023 @default.
• W2000238106 hasConcept C523546767 @default.
• W2000238106 hasConcept C54355233 @default.
• W2000238106 hasConcept C59822182 @default.
• W2000238106 hasConcept C86803240 @default.
• W2000238106 hasConcept C90080823 @default.
• W2000238106 hasConceptScore W2000238106C128905523 @default.
• W2000238106 hasConceptScore W2000238106C144027150 @default.
• W2000238106 hasConceptScore W2000238106C174618031 @default.
• W2000238106 hasConceptScore W2000238106C2776096895 @default.
• W2000238106 hasConceptScore W2000238106C2776203682 @default.
• W2000238106 hasConceptScore W2000238106C2778138406 @default.
• W2000238106 hasConceptScore W2000238106C2778342517 @default.
• W2000238106 hasConceptScore W2000238106C2778660310 @default.
• W2000238106 hasConceptScore W2000238106C2780100698 @default.
• W2000238106 hasConceptScore W2000238106C2780104187 @default.
• W2000238106 hasConceptScore W2000238106C2780269520 @default.
• W2000238106 hasConceptScore W2000238106C2780476228 @default.
• W2000238106 hasConceptScore W2000238106C2780644372 @default.
• W2000238106 hasConceptScore W2000238106C33034023 @default.
• W2000238106 hasConceptScore W2000238106C523546767 @default.
• W2000238106 hasConceptScore W2000238106C54355233 @default.
• W2000238106 hasConceptScore W2000238106C59822182 @default.
• W2000238106 hasConceptScore W2000238106C86803240 @default.
• W2000238106 hasConceptScore W2000238106C90080823 @default.
• W2000238106 hasIssue "4" @default.
• W2000238106 hasLocation W20002381061 @default.
• W2000238106 hasLocation W20002381062 @default.
• W2000238106 hasOpenAccess W2000238106 @default.
• W2000238106 hasPrimaryLocation W20002381061 @default.
• W2000238106 hasRelatedWork W157370152 @default.
• W2000238106 hasRelatedWork W2000238106 @default.
• W2000238106 hasRelatedWork W2068973865 @default.
• W2000238106 hasRelatedWork W2103952356 @default.
• W2000238106 hasRelatedWork W2107193029 @default.
• W2000238106 hasRelatedWork W2111463028 @default.
• W2000238106 hasRelatedWork W2113179654 @default.
• W2000238106 hasRelatedWork W2157353299 @default.
• W2000238106 hasRelatedWork W2316774331 @default.
• W2000238106 hasRelatedWork W4241791661 @default.
• W2000238106 hasVolume "97" @default.
• W2000238106 isParatext "false" @default.
• W2000238106 isRetracted "false" @default.
• W2000238106 magId "2000238106" @default.
• W2000238106 workType "article" @default.