FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000341955> ?p ?o ?g. }

• W2000341955 endingPage "38169" @default.
• W2000341955 startingPage "38160" @default.
• W2000341955 abstract "The archaeal transcriptional initiation machinery closely resembles core elements of the eukaryal polymerase II system. However, apart from the established basal archaeal transcription system, little is known about the modulation of gene expression in archaea. At present, no obvious eukaryal-like transcriptional regulators have been identified in archaea. Instead, we have previously isolated an archaeal gene, the Pyrococcus furiosus lrpA, that potentially encodes a bacterial-like transcriptional regulator. In the present study, we have for the first time addressed the actual involvement of an archaeal Lrp homologue in transcription modulation. For that purpose, we have produced LrpA in Escherichia coli. In a cell-free P. furiosus transcription system we used wild-type and mutated lrpA promoter fragments to demonstrate that the purified LrpA negatively regulates its own transcription. In addition, gel retardation analyses revealed a single protein-DNA complex, in which LrpA appeared to be present in (at least) a tetrameric conformation. The location of the LrpA binding site was further identified by DNaseI and hydroxyl radical footprinting, indicating that LrpA binds to a 46-base pair sequence that overlaps the transcriptional start site of its own promoter. The molecular basis of the transcription inhibition by LrpA is discussed. The archaeal transcriptional initiation machinery closely resembles core elements of the eukaryal polymerase II system. However, apart from the established basal archaeal transcription system, little is known about the modulation of gene expression in archaea. At present, no obvious eukaryal-like transcriptional regulators have been identified in archaea. Instead, we have previously isolated an archaeal gene, the Pyrococcus furiosus lrpA, that potentially encodes a bacterial-like transcriptional regulator. In the present study, we have for the first time addressed the actual involvement of an archaeal Lrp homologue in transcription modulation. For that purpose, we have produced LrpA in Escherichia coli. In a cell-free P. furiosus transcription system we used wild-type and mutated lrpA promoter fragments to demonstrate that the purified LrpA negatively regulates its own transcription. In addition, gel retardation analyses revealed a single protein-DNA complex, in which LrpA appeared to be present in (at least) a tetrameric conformation. The location of the LrpA binding site was further identified by DNaseI and hydroxyl radical footprinting, indicating that LrpA binds to a 46-base pair sequence that overlaps the transcriptional start site of its own promoter. The molecular basis of the transcription inhibition by LrpA is discussed. TATA-binding protein archaeal homologue of transcription factor IIB TFB-responsive element base pair(s) polymerase chain reaction polyacrylamide gel electrophoresis dimethylsuberimidate 3-(cyclohexylamino)propanesulfonic acid Recent studies have revealed that the archaeal transcriptional machinery represents a simplified version of the eukaryal RNA polymerase II transcription apparatus, which involves homologues of the TATA-binding protein (TBP),1the transcription factor IIB (TFIIB; the archaeal homologue is called TFB), and the multi-subunit RNA polymerase II (for a recent review, see Ref. 1Bell S.D. Jackson S.P. Trends Microbiol. 1998; 6: 222-228Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). The initiation process starts when the TBP interacts specifically with the core promoter element, the TATA box, which is located at positions −25 to −30 relative to the transcriptional start site (+1). This complex is stabilized by TFB, which interacts with TBP as well as with the nucleotides −42 to −19 that flank the TATA box (2Hausner W. Wettach J. Hethke C. Thomm M. J. Biol. Chem. 1996; 271: 30144-30148Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). In particular, a sequence upstream of the TATA box (called the TFB-responsive element or BRE) is essential for transcriptional polarity (3Littlefield O. Korkhin Y. Sigler P.B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13668-13673Crossref PubMed Scopus (134) Google Scholar, 4Bell S.D. Kosa P.L. Sigler P.B. Jackson S.P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13662-13667Crossref PubMed Scopus (128) Google Scholar). Formation of this pre-initiation complex results in recruitment of the RNA polymerase complex (1Bell S.D. Jackson S.P. Trends Microbiol. 1998; 6: 222-228Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Although important progress has recently been made with the elucidation of the archaeal transcriptional mechanism, very little is yet known about the actual regulation of this process. A limited number of studies reported that expression of genes involved in nitrogen metabolism, methanogenesis, and sugar metabolism are subject to substrate-dependent regulation at the transcriptional level (5Cohen-Kupiec R. Blank C. Leigh J.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1316-1320Crossref PubMed Scopus (86) Google Scholar, 6Cohen-Kupiec R. Marx C.J. Leigh J.A. J. Bacteriol. 1999; 181: 256-261Crossref PubMed Google Scholar, 7Morgan R.M. Pihl T.D. Nolling J. Reeve J.N. J. Bacteriol. 1997; 179: 889-898Crossref PubMed Google Scholar, 8Nölling J.R. Reeve J.N. J. Bacteriol. 1997; 179: 899-908Crossref PubMed Google Scholar, 9Voorhorst W.G. Gueguen Y. Geerling A.C. Schut G. Dahlke I. Thomm M. van der Oost J. de Vos W.M. J. Bacteriol. 1999; 181: 3777-3783Crossref PubMed Google Scholar). Unfortunately, data about the molecular mechanisms underlying this regulation are still scarce. One of the few transcriptional regulators that have recently been studied in more detail concerns GvpE, an activator that is required for the expression of genes involved in gas vesicle synthesis in halophilic archaea. In a molecular modeling study, GvpE has been proposed to resemble a eukaryal leucine-zipper dimer that might interact with a palindrome sequence of its target promoter centered 40–50 bp upstream of the transcriptional start site (10Krüger K. Hermann T. Armbruster V. Pfeifer F. J. Mol. Biol. 1998; 279: 761-771Crossref PubMed Scopus (61) Google Scholar). Another putative transcriptional regulator that has been studied in more detail is Tfx from Methanobacterium thermoautotrophicum (11Hochheimer A. Hedderich R. Thauer R.K. Mol. Microbiol. 1999; 32: 641-650Crossref Scopus (32) Google Scholar). Thetfx-encoding gene is located upstream of the operon encoding molybdenum formylmethanofuran dehydrogenase (fmdECB). Tfx binds to a site located 167 bp downstream of the transcriptional start site of fmdE. It was proposed that Tfx is a transcriptional activator required for the expression of fmdECB. Obvious homologues of Tfx can only be found within the domain of the archaea. Analysis of the available archaeal genomic sequences shows that the majority of the identified homologues of regulators are bacterial-like (12Kyrpides N.C. Ouzounis C.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8545-8550Crossref PubMed Scopus (79) Google Scholar). Recently a mechanism by which a bacterial-like regulator affects the archaeal transcriptional machinery was described. It was shown that MDR1 from Archaeoglobus fulgidus, a homologue of the iron-dependent bacterial repressor DxtR, represses transcription by binding to its own promoter in a metal-dependent manner. Upon binding of MDR1 to the promoter, RNA polymerase recruitment is prevented but not binding of TBP or TFB (13Bell S.D. Cairns S.S. Robson R.L. Jackson S.P. Mol. Cell. 1999; 4: 971-982Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). One particular group of bacterial-like regulators present in all available archaeal genomes is the family of Lrp/AsnC regulators. Members of this family have been identified in more than a dozen different bacterial species, in which they generally appear to be involved in regulation of amino acid metabolism. The most extensively studied example is the leucine-responsive regulatory protein (Lrp) fromEscherichia coli (14Calvo J.M. Matthews R.G. Microbiol. Rev. 1994; 58: 466-490Crossref PubMed Google Scholar, 15Newman E.B. Lin R. Annu. Rev. Microbiol. 1995; 49: 747-775Crossref PubMed Scopus (140) Google Scholar). Lrp is a global regulator that controls the expression of approximately 75 genes, many of which are involved in transport, degradation, or biosynthesis of amino acids. Lrp can either activate or repress transcription, and this action can be modulated by the effector leucine, which either decreases or increases its particular action. In some cases, like the negative autoregulation, leucine has no effect at all. The paralogous E. coli AsnC appears to be a specific transcriptional activator of asparagine synthetase A. Activation is reduced in the presence of the effector asparagine, but again, the negative autoregulation of AsnC itself is not affected by asparagine (16Kolling R. Lother H. J. Bacteriol. 1985; 164: 305-310Crossref Google Scholar, 17de Wind N. de Jong M. Meijer M. Stuitje A.R. Nucleic Acids Res. 1985; 13: 8797-8811Crossref PubMed Scopus (33) Google Scholar). Two Lrp/AsnC homologues fromSulfolobus solfataricus have been studied in more detail. One of these was cloned, sequenced, and shown to be expressed during growth on complex medium (18Charlier D. Roovers M. Thia-Toong T.L. Durbecq V. Glansdorff N. Gene. 1997; 201: 63-68Crossref PubMed Scopus (22) Google Scholar). The other Lrp/AsnC homologue, called Lrs14, was studied in more detail (19Napoli A. van der Oost J. Sensen C.W. Charlebois R.L. Rossi M. Ciaramella M. J. Bacteriol. 1999; 181: 1474-1480Crossref PubMed Google Scholar). It was shown that the purified recombinant protein binds to its promoter at a region overlapping the TATA box. In addition, it was shown that the lrs14transcript accumulates in the late growth stages of S. solfataricus. In the genome sequence of Pyrococcus furiosus (Center of Marine Biotechnology, University of Utah) at least 10 homologues of genes encoding Lrp/AsnC-like proteins can be identified. 2A. B. Brinkman and J. van der Oost, unpublished information. ThelrpA gene, encoding one of these homologues, was previously identified downstream of the gdh gene that encodes glutamate dehydrogenase (20Eggen R.I. Geerling A.C. Waldkotter K. Antranikian G. de Vos W.M. Gene. 1993; 132: 143-148Crossref PubMed Scopus (51) Google Scholar, 21Kyrpides N.C. Ouzounis C.A. Trends Biochem. Sci. 1995; 20: 140-141Abstract Full Text PDF PubMed Scopus (36) Google Scholar). In this paper, we describe the cloning, functional expression, and characterization of LrpA and show that LrpA binds to its own promoter and specifically inhibits in vitrotranscription from this promoter. Using the combined data of gel mobility shift assays, in vitro transcription analyses, and footprinting, we identified the sequence elements responsible for LrpA binding and propose a mechanism by which LrpA binds its promoter. Identification of LrpA homologues was done using the Advanced BLAST program at NCBI. Alignments were made using the program ClustalX. Motif searches were performed using the PROSITE Pattern and Profile Searches program at the ExPaSy Molecular Biology Server and the program HELIX-TURN-HELIX (32Dodd I.B. Egan J.B. Nucleic Acids Res. 1990; 18: 5019-5026Crossref PubMed Scopus (450) Google Scholar). Inverted repeats were identified using the GeneQuest program, which is part of the DNA Star package. The gene encodinglrpA was PCR-amplified using primers BG240 and BG241 (see Table I, italic and underlined sequences indicate the restriction sites BspHI and BamHI, respectively). The resulting 444-bp PCR fragment was cloned into pGEM-T (Promega Corp.), resulting in pLUW600, and the sequence of the insert was verified by DNA sequencing. Subsequently, pLUW600 was digested withBspHI and BamHI, and the resulting 428-bp fragment was cloned into the T7 expression vectors pGEF+ (22Rink R. Fennema M. Smids M. Dehmel U. Janssen D.B. J. Biol. Chem. 1997; 272: 14650-14657Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar), pET9d, and pET24d (23Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6005) Google Scholar) (Novagen, Inc.), resulting in the constructs pLUW601, pLUW604, and pLUW605, respectively. These constructs were transformed into E. coli BL21(DE3), BL21(DE3) (pLysS), and BL21(DE3) (pLysE) (Novagen, Inc.) and tested for expression (not shown). The optimal result was obtained with E. coli BL21(DE3) in combination with the pET9d-derivative pLUW604. This combination was used for further expression experiments. pLUW613 was made by cloning fragment A into pGEM-T (Promega, Corp.). Mutations in fragment A were introduced using Pfu polymerase in the PCR-based overlap extension method (24Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2102) Google Scholar). For each mutation a sense/antisense primer pair was designed. BG730 and BG731 introduced mutation 621; BG759 and BG760 introduced mutation 623; BG792 and BG793 introduced mutation 629; BG794 and BG795 introduced mutation 630 (see Table I). BG289 and BG290 were used as flanking primers for the PCR of fragment A (see below). All mutant fragments A were cloned into pGEM-T (Promega) and sequenced, resulting in pLUW621, pLUW623, pLUW629, and pLUW630.Figure 1A, sequence of thelrpA promoter. The transcriptional start (+1) is indicated with a horizontal arrow. Underline, BRE element;box, TATA element; bold italics, ATG start codon of lrpA. B, the gdh-lrpA locus and DNA fragments used in this study. HindIII restriction sites indicate the genomic fragment carrying the glutamate dehydrogenase-encoding gene (gdh) and the gene encoding the Lrp-like regulator (LrpA). Filled squares show the TATA boxes of the gdh and lrpA promoters. Dotted lines display the enlarged intergenic region betweengdh and lrpA with the TATA boxes of thelrpA promoter, the lrpA transcriptional start site (+1), and DNA fragments (A–G) used in experiments.kb, kilobases.View Large Image Figure ViewerDownload (PPT)Table IDNA oligonucleotides used in this studyNameSequence (5′ → 3′)BG109TTTACAGAACCGTCATCCATTTCBG240GCGCGTCATGATTGATGAGAGAGACAAAATTATACBG241CGCGCGGATCCTTACTTAAGTTTTTCAAGGATTATAGBG289CAGAACATAACTGGATACTACTGGABG290CAAGAGCCTTGACTCTCTTCCTCBG367GGATGGGTCAAGCACTGATTCCBG427CTCTAGAATGTTCAACACTATGGCTCBG430GGGGCATAGCTTTATATATTCTAGTGCTGATBG431ATCAGCACTAGAATATATAAAGCTATGCCCCBG498CATCAATCATTTTTCGAACCACCTAGGTATAACBG615TCGAACCACCTAGGTATAACATBG638TAGTGCTGATGTTATACCTABG730GCTGATGTTATAAATAAATGGTTCGAAAAABG731TTTTTCGAACCATTTATTTATAACATC AGCBG759TAGTGCTGATGGGCGCACTAGGTGGTTCGABG760TCGAACCACCTAGTGCGCCCATCAGCACTABG792GTTATACCGCTTGTTGGCGAAAAATGATTGATGAGBG793TTTTTCGCCAACAAGCGGTATAACATCAGCACTAGBG794ATACCTAGGTTTGGAGAAAAATGATTGATGAGAGBG795AATCATTTTTCTCCAAACCTAGGTATAACATC Open table in a new tab The P. furiosus LrpA protein was produced in 2-liter Erlenmeyer flasks containing 1 liter of LB medium with 50 μg/ml kanamycin. The culture was inoculated withE. coli BL21(DE3) containing pLUW604. Cells were grown in a rotary shaker at 37 °C until an A600 of 0.5 was reached, and 0.4 mmisopropyl-1-thio-β-d-galactopyranoside was added to induce expression. After overnight incubation, the cells were harvested, washed in 125 mm citrate buffer, pH 5.0 and resuspended in 90 ml of the same buffer. Cells were lysed by a triple passage through a French pressure cell at 1000 p.s.i. After lysis, MgCl2 and DNaseI were added to final concentrations of 10 mm and 10 μg/ml, respectively. The sample was left at room temperature for 15 min. Subsequently, the cell-free extract was incubated at 80 °C for 30 min and centrifuged at 20,000 rpm for 30 min. The remaining soluble fraction was loaded on a 60-ml cation exchange column (S-Sepharose, Amersham Pharmacia Biotech) that had been equilibrated with 125 mm citrate buffer, pH 5.0. The column was eluted with the same buffer using a flow rate of 3 ml/min and a linear gradient of NaCl from 0 to 1 m. Fractions containing LrpA, as determined by SDS-PAGE, were pooled and concentrated by centrifugation in Centricon units (10-kDa cut off) until a volume of 0.5 ml was reached. A 200-μl sample was loaded on a gel filtration column (Superdex 200, Amersham Pharmacia Biotech) with 20 mm Tris, pH 8.0, and 100 mm NaCl with a flow rate of 0.5 ml/min. The elution pattern from this gel filtration showed three peaks corresponding to molecular masses of approximately 30, 60, and 120 kDa, respectively. Approximately 14 mg of purified LrpA was obtained from one liter of culture. DNA probes used for gel mobility shift experiments were generated using PCR. The following primers were used: BG289 and BG290 for fragment A; BG367 and BG290 for fragment B; BG289 and BG431 for fragment C; BG430 and BG290 for fragment D; BG638 and BG498 for fragment E; BG638 and BG615 for fragment F; BG427 and BG109 for fragment G (see Table I). PCR reactions consisted of a 5-min denaturation step at 95 °C, 30 cycles consisting of 95, 45, and 72 °C, with 30 s for each step, followed by a 7-min final extension step at 72 °C. PCR products were end-labeled using T4 kinase and radioactive [γ-32P]ATP. Binding reactions were performed in a total volume of 20 μl containing 40 mm HEPES-NaOH, pH 7.3, 200 mmKCl, 2.5 mm MgCl2, 2 mmdithiothreitol, 1 mm CaCl2, 100 mmEDTA, 10% glycerol, and varying concentrations of purified LrpA. Standard reactions contained 2 μg of poly(dI·dC)·poly(dI·dC) as nonspecific competitor DNA, but this was omitted from reactions with smaller fragments (fragment E and F) and during determination of the dissociation constant (Kd) for the LrpA-DNA complex. Each reaction contained 1 to 10 ng of [γ-32P]ATP end-labeled DNA. Reactions were incubated at room temperature for at least 10 min and separated on a non-denaturing 8% acrylamide gel buffered in 1× Tris borate EDTA buffer (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). In the case of fragment E, a 20% gel was used. Gels were dried, exposed to phosphor screens, and analyzed. Quantification was done using ImageQuant software (Molecular Dynamics, Inc.). DNaseI and hydroxyl radical footprinting was performed using non-radioactive probes containing the IRD800 label in combination with a Li-Cor sequencer (Li-Cor, Inc.). For this purpose DNA probes were prepared as follows. Fragments B and G (see Fig. 1 B) were cloned into pGEM-T (Promega), and clones were selected containing the insert in both orientations. These constructs were used as a template in PCR reactions with a IRD800-labeled T7 primer (MWG-Biotech, GmbH) in combination with BG290, BG367, BG427, or BG109. These PCR reactions produced fragments B or G carrying the IRD800 label on a 68-bp extension originating from pGEM-T at the 5′ end of either the non-template or the template strand. 10 ng of this DNA was used per reaction. Binding reactions for DNaseI and hydroxyl radical footprinting were identical to the binding reaction conditions in gel mobility shift experiments (see above) except that glycerol and poly(dI·dC)·poly(dI·dC) were omitted. DNaseI cleavage was done by adding 20 μl of a solution containing 5 mmCaCl2, 10 mm MgCl2, and 2 milliunits of DNaseI. After 1 min the DNaseI reaction was stopped by the addition of 20 μl of 4 m ammonium acetate and 30 mm EDTA. The DNA was extracted with 60 μl of phenol, precipitated with 96% ethanol in the presence of 20 μg of glycogen, and washed with 70% ethanol. The pellet was dissolved in 1 μl of formamide loading buffer, heated at 95 °C for 5 min, and chilled on ice. Subsequently, 0.8 μl was analyzed on a Li-Cor 4000 sequencer using a 5.5% KBPlus 41-cm denaturing sequence gel (Li-Cor) with 0.2-mm spacers and settings 2000 V, 25 mA, 50 watt, and 45 °C. Hydroxyl radicals were generated by adding 3 μl of 40 mmsodium ascorbate, 3 μl of 1.2% H2O2, and 3 μl of 4 mm(NH4)2Fe(SO4)2·6H2O, 8 mm EDTA. After 2 min the reaction was stopped by the addition of 26 μl of 0.1 m thiourea, 20 mmEDTA. DNA was extracted with phenol, precipitated as described above, and analyzed on a Li-Cor 4000L sequencer (Li-Cor) using a 66-cm denaturing sequencing gel with 0.25-mm spacers and settings 2250 V, 30.6 mA, 68 watt, and 45 °C. Images of the footprints were analyzed using the program Scion Image for Windows, available from the National Institutes of Health. Transcription reactions were performed essentially as described previously (26Hethke C. Geerling A.C. Hausner W. de Vos W.M. Thomm M. Nucleic Acids Res. 1996; 24: 2369-2376Crossref PubMed Scopus (68) Google Scholar) except that 300 mm KCl was used instead of 250 mm. A standard reaction mixture (50 μl) contained 1 μg of linearized template DNA (pLUW479 (26Hethke C. Geerling A.C. Hausner W. de Vos W.M. Thomm M. Nucleic Acids Res. 1996; 24: 2369-2376Crossref PubMed Scopus (68) Google Scholar), pLUW613, pLUW621, pLUW623, pLUW629, pLUW629, or piC31/2 (27Hausner W. Frey G. Thomm M. J. Mol. Biol. 1991; 222: 495-508Crossref PubMed Scopus (85) Google Scholar)), 250 ng of recombinant TBP, 280 ng of recombinant TFB, 135 ng of native RNA polymerase, and varying concentrations of LrpA. This reaction mixture was incubated for 30 min at 70 °C. RNA purification and electrophoresis was performed as described previously (28Frey G. Thomm M. Brüdigam B. Gohl H.P. Hausner W. Nucleic Acids Res. 1990; 18: 1361-1367Crossref PubMed Scopus (41) Google Scholar). For analysis of the in vitrotranscriptional start site, cell-free transcription reactions were performed as described above but with unlabeled precursors. In a control reaction, nucleotides were omitted from cell-free transcription reactions. The end-labeled DNA primer 5′-GTATAATTTTGTCTCTCTCATCA-3′ was used complementary to nucleotides +20 to +42 relative to the transcriptional start of lrpA. The primer extension assay was performed as described previously (26Hethke C. Geerling A.C. Hausner W. de Vos W.M. Thomm M. Nucleic Acids Res. 1996; 24: 2369-2376Crossref PubMed Scopus (68) Google Scholar, 28Frey G. Thomm M. Brüdigam B. Gohl H.P. Hausner W. Nucleic Acids Res. 1990; 18: 1361-1367Crossref PubMed Scopus (41) Google Scholar). For determination of the in vivo transcriptional start site, primer extension was performed with total RNA of P. furiosus, which was isolated as described previously (29Ward D.E. Kengen S.W. van Der Oost J. de Vos W.M. J. Bacteriol. 2000; 182: 2559-2566Crossref PubMed Scopus (63) Google Scholar). Chemical cross-linking was performed as described by Davies and Stark (30Davies G.E. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1970; 66: 651-656Crossref PubMed Scopus (719) Google Scholar), with the following modifications. For cross-linking experiments with free LrpA, different concentrations of LrpA were diluted in cross-linking buffer (80 mm triethanolamine-HCl, pH 8.0, 100 mm NaCl, 1 mm EDTA, 0.1 mmdithiothreitol), and the final volume was adjusted to 16 μl. Dimethylsuberimidate (DMSI, 25 mg/ml freshly made in cross-linking buffer) was added to a final concentration of 5 mg/ml so that the final volume was 20 μl. After a 1-h incubation at room temperature, SDS-PAGE loading buffer (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar) was added, and 100 ng of each sample was separated on a 10% Tricine SDS-PAGE gel (31Schagger H. Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10480) Google Scholar). The separated proteins were transferred to a nitrocellulose membrane by electroblotting in 10 mm CAPS, pH 11.0, and 10% methanol and detected immunologically using a polyclonal antiserum raised against purified LrpA (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). For cross-linking experiments with LrpA-DNA complexes, about 2 μg of purified LrpA was incubated with 500 ng of DNA (fragment B, see Fig. 1 B) in cross-linking buffer in a final volume of 64 μl. DMSI was added as described above so that the final volume was 80 μl. The samples were loaded on a non-denaturing 5% acrylamide gel, buffered in 1× Tris borate EDTA buffer (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). The gel was stained with ethidium bromide, bands representing specific DNA-LrpA complexes were excised and crushed, and SDS-PAGE loading buffer was added. The recovered samples were heated for 10 min at 100 °C and loaded on a 10% Tricine SDS-PAGE gel and analyzed as described above. A 2.7-kilobase HindIII fragment including the gene encoding glutamate dehydrogenase (gdh) was previously isolated from a genomic library ofP. furiosus (Fig. 1 B) (20Eggen R.I. Geerling A.C. Waldkotter K. Antranikian G. de Vos W.M. Gene. 1993; 132: 143-148Crossref PubMed Scopus (51) Google Scholar). Downstream of thegdh gene, an open reading frame was found with a high degree of similarity to bacterial transcription regulators of the Lrp/AsnC family (21Kyrpides N.C. Ouzounis C.A. Trends Biochem. Sci. 1995; 20: 140-141Abstract Full Text PDF PubMed Scopus (36) Google Scholar). Sequence analysis of the lrpA gene identified a frame-shift in the previously published sequence (GenBankTMaccession number P42180), which introduced a stop codon after lysine 120 in the predicted protein sequence. The corrected P. furiosus lrpA gene is predicted to encode a 141-amino acid protein with a predicted molecular mass of 15.9 kDa. Subsequent BLAST analysis revealed that LrpA shares a high degree of similarity with many (hypothetical) regulatory proteins from a number of archaea includingPyrococcus horikoshii (93% identity), Pyrococcus abyssi (98% identity), Methanococcus jannaschii (54% identity), A. fulgidus (49% identity), M. thermoautotrophicum (37% identity), and S. solfataricus (32% identity, Fig. 2). In addition, all of these archaea contain a number of more distantly related homologues, e.g.in P. horikoshii a total of 9 genes appear to encode LrpA homologues, whereas P. furiosus itself contains at least 10 LrpA homologues. The best characterized LrpA homologues are from bacterial origin, in particular E. coli AsnC (33% identity) and E. coli Lrp (28% identity). A PROSITE pattern search with P. furiosus LrpA identified a putative helix-turn-helix motif of the Lrp/AsnC family (Fig. 2). This motif was also predicted by the program HELIX-TURN-HELIX (32Dodd I.B. Egan J.B. Nucleic Acids Res. 1990; 18: 5019-5026Crossref PubMed Scopus (450) Google Scholar). Using a PCR approach we cloned the lrpA gene into a pET9d vector, resulting in pLUW604. Production of LrpA was achieved after transformation of pLUW604 to E. coli BL21(λDE3). After overnight growth in the presence of 0.4 mmisopropyl-1-thio-β-d-galactopyranoside, cells were harvested and disrupted. Tricine-SDS-PAGE analysis of membrane and soluble fractions indicated that 50% of the produced LrpA was present as soluble protein (Figs. 3, lane 3, and 4). The soluble fraction containing LrpA was further subjected to a heat incubation of 30 min at 80 °C, resulting in the denaturation of most of the E. coli proteins (Fig. 3, lane 5). This heat-stable cell free extract was used for further purification by cation exchange chromatography and gel filtration chromatography (Fig. 3, lanes 6 and 7). The calculated molecular mass of LrpA is 15.9 kDa, which is in good agreement with its migration on SDS-PAGE (Fig. 3). Elution patterns from gel filtration showed peaks corresponding to molecular masses of approximately 30, 60, and 120 kDa. This suggests that LrpA exists as a dimer, tetramer, and octamer in solution. We performed several independent gel filtration experiments with LrpA, and the apparent oligomeric heterogeneity was always observed.Figure 4Analysis of the transcription start site of the lrpA promoter in vitro by primer extension. The sequence of the template DNA strand is shown left of the primer extension product (marked G, A,T, C). Lane 1, control experiment (nucleotides omitted from transcription reaction); lane 2, analysis of the primer extension product.View Large Image Figure ViewerDownload (PPT) We used primer extension analysis to map the transcriptional start site for lrpA. Using in vitro generated run-off transcript RNA (see below), we found that the transcriptional start was located at an adenosine located 14 bp upstream the translational start (see Fig. 1 A). We compared the lrpA promoter sequence to other known promoter sequences from P. furiosus. Although only 14 Pyrococcus promoters have been mapped to date, a clear consensus sequence can be derived for the PyrococcusBRE and TATA elements: AAAnnTTTWWWWW (−35 to −23 sequence relative to the transcriptional start (+1), where n = any base, and W = A or T). The putative BRE and TATA elements of thelrpA promoter match well with the consensus sequence mentioned above (see Fig. 1 A). We used total isolated RNA from P. furiosus grown on cellobiose, pyruvate, and tryptone to determine the transcriptional start in vivo. In all cases the transcriptional start was identical to that found with in vitro generated RNA (not shown); however, relatively weak signals were obtained. Although the results showed that lrpA is expressed during growth on the above-mentioned substrates, they indicate that lrpAtranscript levels are not very abundant under these conditions. Several bacterial" @default.
• W2000341955 created "2016-06-24" @default.
• W2000341955 creator A5007026827 @default.
• W2000341955 creator A5010586842 @default.
• W2000341955 creator A5011014479 @default.
• W2000341955 creator A5018631374 @default.
• W2000341955 creator A5033273986 @default.
• W2000341955 creator A5069567030 @default.
• W2000341955 creator A5069967673 @default.
• W2000341955 creator A5070529020 @default.
• W2000341955 creator A5071660898 @default.
• W2000341955 creator A5085645511 @default.
• W2000341955 date "2000-12-01" @default.
• W2000341955 modified "2023-10-18" @default.
• W2000341955 title "An Lrp-like Transcriptional Regulator from the ArchaeonPyrococcus furiosus Is Negatively Autoregulated" @default.
• W2000341955 cites W1425706641 @default.
• W2000341955 cites W1481299334 @default.
• W2000341955 cites W1553008332 @default.
• W2000341955 cites W1569816451 @default.
• W2000341955 cites W1595785419 @default.
• W2000341955 cites W1605930166 @default.
• W2000341955 cites W1749450568 @default.
• W2000341955 cites W1787507935 @default.
• W2000341955 cites W1873199501 @default.
• W2000341955 cites W1909672973 @default.
• W2000341955 cites W1968493087 @default.
• W2000341955 cites W1971729222 @default.
• W2000341955 cites W1973138933 @default.
• W2000341955 cites W1975085160 @default.
• W2000341955 cites W1979922397 @default.
• W2000341955 cites W1980484671 @default.
• W2000341955 cites W1981765089 @default.
• W2000341955 cites W1992198994 @default.
• W2000341955 cites W2003188984 @default.
• W2000341955 cites W2006311755 @default.
• W2000341955 cites W2007775895 @default.
• W2000341955 cites W2011780221 @default.
• W2000341955 cites W2014976631 @default.
• W2000341955 cites W2018036267 @default.
• W2000341955 cites W2018244729 @default.
• W2000341955 cites W2028275878 @default.
• W2000341955 cites W2033707082 @default.
• W2000341955 cites W2035797443 @default.
• W2000341955 cites W2038572730 @default.
• W2000341955 cites W2039429468 @default.
• W2000341955 cites W2044565761 @default.
• W2000341955 cites W2048881710 @default.
• W2000341955 cites W2052221476 @default.
• W2000341955 cites W2057638760 @default.
• W2000341955 cites W2059730307 @default.
• W2000341955 cites W2063832119 @default.
• W2000341955 cites W2064123428 @default.
• W2000341955 cites W2065199042 @default.
• W2000341955 cites W2070280762 @default.
• W2000341955 cites W2071062575 @default.
• W2000341955 cites W2079102383 @default.
• W2000341955 cites W2088619370 @default.
• W2000341955 cites W2093659250 @default.
• W2000341955 cites W2096419624 @default.
• W2000341955 cites W2098089372 @default.
• W2000341955 cites W2110753148 @default.
• W2000341955 cites W2120876689 @default.
• W2000341955 cites W2122442406 @default.
• W2000341955 cites W2129702857 @default.
• W2000341955 cites W2131240172 @default.
• W2000341955 cites W2137421566 @default.
• W2000341955 cites W2138542468 @default.
• W2000341955 cites W2144926272 @default.
• W2000341955 cites W2147790211 @default.
• W2000341955 cites W2147902635 @default.
• W2000341955 cites W2155523268 @default.
• W2000341955 cites W2156099263 @default.
• W2000341955 cites W2156549255 @default.
• W2000341955 cites W2157985469 @default.
• W2000341955 cites W2164954842 @default.
• W2000341955 cites W2167324750 @default.
• W2000341955 cites W2168477069 @default.
• W2000341955 cites W2171311414 @default.
• W2000341955 cites W2173230794 @default.
• W2000341955 cites W2211060771 @default.
• W2000341955 cites W2220745507 @default.
• W2000341955 doi "https://doi.org/10.1074/jbc.m005916200" @default.
• W2000341955 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10973967" @default.
• W2000341955 hasPublicationYear "2000" @default.
• W2000341955 type Work @default.
• W2000341955 sameAs 2000341955 @default.
• W2000341955 citedByCount "91" @default.
• W2000341955 countsByYear W20003419552012 @default.
• W2000341955 countsByYear W20003419552013 @default.
• W2000341955 countsByYear W20003419552014 @default.
• W2000341955 countsByYear W20003419552015 @default.
• W2000341955 countsByYear W20003419552016 @default.
• W2000341955 countsByYear W20003419552017 @default.
• W2000341955 countsByYear W20003419552018 @default.
• W2000341955 countsByYear W20003419552019 @default.
• W2000341955 countsByYear W20003419552020 @default.
• W2000341955 countsByYear W20003419552021 @default.
• W2000341955 countsByYear W20003419552022 @default.

• next