FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000359273> ?p ?o ?g. }

• W2000359273 endingPage "13536" @default.
• W2000359273 startingPage "13530" @default.
• W2000359273 abstract "Although the activation domains within early growth response gene protein 1 (Egr-1) have been mapped, little is known of the kinases which phosphorylate Egr-1 and how phosphorylation correlates with the transcriptional activity of Egr-1. In this study we report that casein kinase II (CKII) co-immunoprecipitates with Egr-1 from NIH 3T3 cell lysates. The association of Egr-1 and CKII requires the C terminus of Egr-1 and CKII phosphorylates Egr-1 in vitro. The in vitro phosphorylation of Egr-1 by CKII and that induced by serum in vivo was compared by examining the CNBr-digested fragments of the phosphorylated Egr-1. CKII strongly phosphorylates fragments 7 and 10 which cover part of the activation/nuclear localization and DNA binding domains of Egr-1. CKII also phosphorylates, albeit weakly, fragments 5 and 8 which cover part of activation domain and the entire repression domain of Egr-1, respectively. Strong phosphorylation on fragment 10 as well as fragment 5 was also observed in Egr-1 immunoprecipitated from serum-induced, 32P-labeled cells. CKII phosphorylation of Egr-1 resulted in a decrease of its DNA binding as well as its transcriptional activities. Although the activation domains within early growth response gene protein 1 (Egr-1) have been mapped, little is known of the kinases which phosphorylate Egr-1 and how phosphorylation correlates with the transcriptional activity of Egr-1. In this study we report that casein kinase II (CKII) co-immunoprecipitates with Egr-1 from NIH 3T3 cell lysates. The association of Egr-1 and CKII requires the C terminus of Egr-1 and CKII phosphorylates Egr-1 in vitro. The in vitro phosphorylation of Egr-1 by CKII and that induced by serum in vivo was compared by examining the CNBr-digested fragments of the phosphorylated Egr-1. CKII strongly phosphorylates fragments 7 and 10 which cover part of the activation/nuclear localization and DNA binding domains of Egr-1. CKII also phosphorylates, albeit weakly, fragments 5 and 8 which cover part of activation domain and the entire repression domain of Egr-1, respectively. Strong phosphorylation on fragment 10 as well as fragment 5 was also observed in Egr-1 immunoprecipitated from serum-induced, 32P-labeled cells. CKII phosphorylation of Egr-1 resulted in a decrease of its DNA binding as well as its transcriptional activities. egr-1 1The abbreviations used are: egr-1early growth response gene 1Egr-1early growth response gene 1 proteinCKIIcasein kinase IIPMSFphenylmethylsulfonyl fluorideCNBrcyanogen bromidePAGEpolyacrylamide gel electrophoresisPBSphosphate-buffered salineGSTglutathione S-transferaseHPLChigh performance liquid chromatography. (1Sukhatme V.P. Cao X. Chang L.C. Tsai-Morris C.H. Stamenkovich D. Ferreira P.C. Cohen D.R. Edwards S.A. Shows T.B. Curran T. Le Beau M. Adamson E.D. Cell. 1988; 53: 37-43Abstract Full Text PDF PubMed Scopus (1034) Google Scholar), also known as krox-24 (2Lemaire P. Relevant O. Bravo R. Charnay P. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4691-4695Crossref PubMed Scopus (452) Google Scholar), zif268 (3Christy B.A. Lau L.F. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7857-7861Crossref PubMed Scopus (573) Google Scholar), Tis8 (4Lim R.W. Varnum B.C. Herschman H.R. Oncogene. 1987; 1: 263-270PubMed Google Scholar), and NGFI-A (5Milbrandt J. Science. 1987; 238: 797-799Crossref PubMed Scopus (936) Google Scholar), is an immediate-early gene. It encodes a transcription factor with three zinc fingers and recognizes a GC-rich sequence, 5′-CGCCCCCGC-3′ (6Christy B. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 8737-8741Crossref PubMed Scopus (456) Google Scholar) which has been identified in the promoter regions of a number of genes. Egr-1 regulates these genes by binding to this consensus sequence. Besides inducing genes involved in cell proliferation, Egr-1 is also implicated in a number of differentiation processes in cardiac (7Rudnicki M.A. Jackowski G. Saggin L. McBurney M.W. Dev. Biol. 1990; 138: 348-358Crossref PubMed Scopus (89) Google Scholar), neural (1Sukhatme V.P. Cao X. Chang L.C. Tsai-Morris C.H. Stamenkovich D. Ferreira P.C. Cohen D.R. Edwards S.A. Shows T.B. Curran T. Le Beau M. Adamson E.D. Cell. 1988; 53: 37-43Abstract Full Text PDF PubMed Scopus (1034) Google Scholar), osteoblast (8Sukhatme V.P. J. Am. Soc. Nephrol. 1990; 1: 859-866Crossref PubMed Google Scholar), and myeloid cells (9Nguyen H.Q. Hoffman-Liebermann B. Liebermann D.A. Cell. 1993; 72: 197-209Abstract Full Text PDF PubMed Scopus (353) Google Scholar). early growth response gene 1 early growth response gene 1 protein casein kinase II phenylmethylsulfonyl fluoride cyanogen bromide polyacrylamide gel electrophoresis phosphate-buffered saline glutathione S-transferase high performance liquid chromatography. It is likely that the different effects mediated by Egr-1 in various cells result from its phosphorylation and dephosphorylation (10Cao X.M. Koski R.A. Gashler A. McKiernan M. Morris C.F. Gaffney R. Hay R.V. Sukhatme V.P. Mol. Cell. Biol. 1990; 10: 1931-1939Crossref PubMed Scopus (298) Google Scholar). Reports that cells treated with kinase and phosphatase inhibitors (11Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1992; 267: 12991-12997Abstract Full Text PDF PubMed Google Scholar, 12Huang R.P. Adamson E.D. Biochem. Biophys. Res. Commun. 1994; 200: 1271-1276Crossref PubMed Scopus (41) Google Scholar) show differences in their Egr-1 DNA binding ability support this hypothesis. However, little is known about which kinase(s) phosphorylates Egr-1 and if its functional domain(s) is phosphorylated. In addition, the identification of a repressor protein that associates with Egr-1 implies that protein-protein interactions can also regulate its transcriptional activity (13Gashler A.L. Swaminathan S. Sukhatme V.P. Mol. Cell. Biol. 1993; 13: 4556-4571Crossref PubMed Scopus (213) Google Scholar, 14Russo M.W. Matheny C. Milbrandt J. Mol. Cell. Biol. 1993; 13: 6858-6865Crossref PubMed Scopus (89) Google Scholar). The protein kinase CKII is an inducible kinase found in both the cytoplasmic and nuclear compartments, although recently CKII was reported to be a predominantly nuclear protein (15Meek D.W. Simon S. Kikkawa U. Eckhart W. EMBO J. 1990; 9: 3253-3260Crossref PubMed Scopus (252) Google Scholar). It is a tetrameric Ser/Thr-specific protein kinase complex containing two catalytic (α, 44 kDa, α′, 42 kDa) subunits and two regulatory (β, 25 kDa) subunits (15Meek D.W. Simon S. Kikkawa U. Eckhart W. EMBO J. 1990; 9: 3253-3260Crossref PubMed Scopus (252) Google Scholar). CKII is known to associate with a number of nuclear proteins such as DNA topoisomerase II (16Cardenas M.E. Walter R. Hanna D. Gasser S.M. J. Cell Sci. 1993; 104: 533-543Crossref PubMed Google Scholar) and FKBP25, the 25-kDa FK506-binding protein (17Jin Y.J. Burakoff S.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7769-7773Crossref PubMed Scopus (112) Google Scholar). CKII also phosphorylates a number of transcription factors and nuclear proteins such as the serum response factor (18Manak J.R. Prywes R. Oncogene. 1993; 8: 703-711PubMed Google Scholar), c-Jun (19Lin A. Frost J. Deng T. Smeal T. Alawi N. Kikkawa U. Hunter T. Brenner D. Karin M. Cell. 1992; 70: 777-789Abstract Full Text PDF PubMed Scopus (312) Google Scholar), and p53 (20Filhol O. Baudier J. Delphin C. Loue-Mackenbach P. Chambaz E.M. Cochet C. J. Biol. Chem. 1992; 267: 20577-20583Abstract Full Text PDF PubMed Google Scholar). Little is known of the physiological role of CKII or how it regulates the activity of transcription factors in vivo. In this report, we demonstrate that CKII associates with cellular Egr-1 both in vivo and in vitro and phosphorylates it in vitro. We have also identified the CKII phosphorylated CNBr peptides of Egr-1 and have studied the effect of CKII phosphorylation on Egr-1 DNA binding activity in vitro and its transcriptional activity in vivo. 588, an antibody to the last 14 amino acids at the C terminus of Egr-1, was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). 5232 (10Cao X.M. Koski R.A. Gashler A. McKiernan M. Morris C.F. Gaffney R. Hay R.V. Sukhatme V.P. Mol. Cell. Biol. 1990; 10: 1931-1939Crossref PubMed Scopus (298) Google Scholar) and 1133 are polyclonal antibodies generated against full-length Egr-1 fusion proteins. Anti-Egr-1 monoclonal antibody 4F18 was a gift from Amgen Inc. (Thousand Oaks, CA). Anti-mouse and anti-rabbit IgG conjugated to horseradish peroxidase were purchased from Sigma. A monoclonal antibody to the CKII α-subunit was purchased from Boehringer Mannheim (Mannheim, Germany) and the CKII polyclonal antibody against its α-subunit was purchased from Upstate Biotechnology Inc. (Lake Placid, NY). The pCMVCKII α-subunit plasmid was a gift from Dr. Steven Sloan (Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, Philadelphia). A near full-length GST-Egr-1 fusion construct was obtained by digesting pCMV-Egr-1 (21Madden S.L. Cook D.M. Morris J.F. Gashler A. Sukhatme V.P. Rauscher III, F.J. Science. 1991; 253: 1550-1553Crossref PubMed Scopus (409) Google Scholar) with NcoI to give a 1.92-kb fragment that was cloned into the pGEX-KG (22Guan K.L. Dixon J.E. Anal. Biochem. 1991; 192: 262-267Crossref PubMed Scopus (1641) Google Scholar) NcoI site. The resulting plasmid was named pGEX-NCO 1.9 and its protein product designated F-1. The Egr-1 deletion N-1 was produced by digesting pCMV-Egr-1-TTL (21Madden S.L. Cook D.M. Morris J.F. Gashler A. Sukhatme V.P. Rauscher III, F.J. Science. 1991; 253: 1550-1553Crossref PubMed Scopus (409) Google Scholar), which contains a stop codon at nucleotide position 768 of the egr-1 cDNA, with NcoI and inserting it into the NcoI site of pGEX-KG such that a protein encoding only the first 171 amino acids was expressed. This plasmid was called pGEX-Egr-1-TTL. The Egr-1 deletions C-2 and C-1 were made by digesting pCMV-Egr-1-TTL with RsaI (nucleic acids 1221-2253) and PvuII (779-2060) and cloning the corresponding DNA fragments into the blunted XbaI site in pGEX-KG to produce pGEX-RSA 1.0 and pGEX-PVU 1.2, respectively. Recombinant Egr-1 was expressed in Escherichia coli (DH5α) and bound to glutathione-Sepharose 4B beads (Pharmacia Biotech, Uppsala, Sweden) as described by Smith and Johnson (23Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar) except that bacteria were grown to an A600 of 0.5 before inducing the fusion protein production with 0.2 mM of isopropyl β-D-thiogalactopyranoside for 3 h. GST fusion proteins thus expressed were bound to glutathione-Sepharose beads and stored in phosphate-buffered saline (PBS) with 0.2% sodium azide at 4°C and were used for phosphorylation and binding experiments. Confluent NIH 3T3 cells were induced with 20% serum for 1 h. Cytoplasmic and nuclear extracts were prepared as described elsewhere (24Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar, 25Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1993; 268: 16949-16957Abstract Full Text PDF PubMed Google Scholar) with phosphatase and protease inhibitors added to all buffers at the following concentrations: 50 mM NaF, 100 µM sodium orthovanadate, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 µg/ml pepstatin A, and 1 mM PMSF. Cytoplasmic extracts were prepared by low speed centrifugation of homogenized cells, and nuclear extracts were produced by extracting nuclear proteins with a high salt buffer. Immunoprecipitation was performed with 0.5 mg of nuclear protein in a buffer containing 1% Triton X-100, 1% sodium deoxycholate, 150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1 mM PMSF, and the protease and phosphatase inhibitors as listed above. Samples were precleared with protein A-agarose beads prior to immunoprecipitation with the appropriate antibody. Immunocomplexes bound to protein A-agarose beads were washed in immunoprecipitation buffer four times and once in PBS. The protein samples were separated by 7.5% or 10% SDS-polyacrylamide gel electrophoresis (PAGE) after boiling in Laemmli (26Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar) buffer. Western blots were performed as described by Towbin et al. (27Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44939) Google Scholar). After the transfer, nitrocellulose membranes were blocked overnight at 4°C with 5% skim milk in PBST (PBS and 0.1% Tween 20) and incubated with the appropriate primary and secondary antibodies in PBST containing 1% skim milk for 1 h each. The bands were visualized either by using a chromogenic reaction (0.6 mg/ml 3′3′-diaminobenzidine, 0.03% hydrogen peroxide, 50 mM Tris-HCl, pH 7.5, and 0.03% cobalt chloride) or by using the Amersham ECL kit (Amersham International Plc, UK). The DNA fragments corresponding to the CNBr peptides of Egr-1 were amplified from pUC-Egr-1 by the polymerase chain reaction (28Saiki R.K. Gelfand D.H. Stoffel S. Scharf S.J. Higuchi R. Horn G.T. Mullis K.B. Erlich H.A. Science. 1988; 239: 487-491Crossref PubMed Scopus (13517) Google Scholar), using oligonucleotides complementary to 5′ and 3′ ends of each fragment as primers (Table I) and cloned downstream of the T3, T7 promoters in pCRScript (Stratagene, La Jolla, CA) or the SP6 promoter in pSP65 (Promega, Madison, WI). The oligonucleotides had an EcoRI site at the 5′ end and a SalI site at the 3′ end to facilitate cloning into the vectors mentioned, although blunt end ligation was also used. The oligonucleotides were designed with an extra ATG codon at the 5′ oligonucleotide to ensure ease of visualization of the corresponding peptides on synthesis in the presence of [35S]methionine using the TNT reticulocyte lysate kit (Promega). The peptides produced were analyzed by 16.5% SDS-PAGE by the procedure of Schägger and Von Jagow (29Schägger H. Von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10505) Google Scholar) with a minor modification as described in the Sigma Technical Bulletin no. MWM-100.Table IPCR primers for CNBr fragmentsFragment no.Oligonucleotide sequence5′3′5′ 3′5′ 3′5GGGAATTCATGATGCTGCTGAGCAACGTCGACTTACGCCTTCTCATTATT6GGGAATTCATGATGGTGGAGACGAGTGTCGACTTAGCTCACGAGGCCATC7GGGAATTCATGATGGTGGAGACGAGTGCTGACTTAGGGAACCTGGAAACC8GGGAATTCATGATGATCCCTGACTATGTCGACTTAGCGGCTGGGTTTGAT9GGGAATTCATGATGGCGCAAGTACCCGTGGACTTAGCAGATTCGACACTG10GGGAATTCATGATGCGTAACTTGAGTGTCGACTTAGTCTGAAAGACCAGT Open table in a new tab Cells in 150-mm dishes were labeled for 5 h as described previously by Cao et al. (10Cao X.M. Koski R.A. Gashler A. McKiernan M. Morris C.F. Gaffney R. Hay R.V. Sukhatme V.P. Mol. Cell. Biol. 1990; 10: 1931-1939Crossref PubMed Scopus (298) Google Scholar) except that [32P]orthophosphate was used at a final concentration of 1 mCi/ml. Cells were lysed in radioimmune precipitation buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH 7.4, and 150 mM NaCl) with appropriate protease and phosphatase inhibitors as listed above. Egr-1 was immunoprecipitated from the lysates and the immunoprecipitates were washed five times with radioimmune precipitation buffer. The proteins were separated by 7.5% SDS-PAGE and transferred to a nitrocellulose membrane. The Egr-1 band, located after an overnight exposure to x-ray film, was excised from the membrane, cut into small pieces, and used for CNBr digestion. CNBr (70 mg/ml in 70% formic acid) digestion was carried out overnight in the dark at room temperature. The supernatant containing digested peptides was transferred to a new tube and lyophilized. The dried peptides were washed with distilled H2O twice and then resuspended in sample buffer and analyzed by 16.5% SDS-PAGE as described above. The assays were carried out as described previously (25Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1993; 268: 16949-16957Abstract Full Text PDF PubMed Google Scholar) except that the binding buffer contained 1 mM EDTA, 0.05% Nonidet P-40, 20 mM HEPES, 12% glycerol, 10 mM NaF, 10 mM MgCl2, 10 µM ZnCl2, and 1 mM dithiothreitol. GST-Egr-1 fusion protein, F-1 used in this assay was eluted from glutathione beads with 20 mM reduced glutathione in 20 mM Tris-HCl, pH 8.0. The glutathione-Sepharose beads containing GST-Egr-1 fusion proteins (50 µl) were resuspended in 100 µl of CKII assay buffer (200 mM NaCl, 10 mM MgCl2, and 25 mM Tris-HCl, pH 7.4, 10 µM ATP) in the presence of 2-5 µCi of [γ-32P]ATP. The kinase reaction was started by adding 1 unit of CKII (Promega) and incubating samples at 37°C for 30 min. The beads were washed with the Triton buffer (1% Triton X-100, 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM PMSF) four times and separated by 10% SDS-PAGE, dried, and exposed to x-ray film. For phosphoamino acid analysis the gel was blotted onto polyvinylidene difluoride membrane, and the Egr-1 band was excised. Phosphoamino acid analysis was performed as described by Boyle et al. (30Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1276) Google Scholar) and Kamps (31Kamps M.P. Methods Enzymol. 1991; 201: 21-27Crossref PubMed Scopus (99) Google Scholar). The assay was essentially similar to that described by Jin and Burakoff (17Jin Y.J. Burakoff S.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7769-7773Crossref PubMed Scopus (112) Google Scholar). CKII (50 units) was allowed to autophosphorylate in the presence of [γ-32P]ATP, and the reaction was stopped by adding 50 mM EDTA. The volume was increased to 1.0 ml with Triton buffer. The labeled kinase was precleared with Sepharose beads containing GST alone (50 µl) for 1 h at 4°C. The supernatant was removed after centrifugation at 5000 rpm for 5 min and divided into five tubes containing the three Egr-1 deletions, an almost full-length Egr-1, and GST alone (50 µl each). The volume was again increased to 1.0 ml with Triton buffer, and the samples were mixed for 1 h at 4°C. The beads were then washed three times with Triton buffer and once with TBS (10 mM Tris-HCl, pH 8.0, 150 mM NaCl), resuspended in Laemmli buffer, boiled for 5 min, and analyzed by 12.5% SDS-PAGE and exposure to x-ray film. The transfection experiment was performed as described previously (25Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1993; 268: 16949-16957Abstract Full Text PDF PubMed Google Scholar). Cells were transfected with pCMV-Egr-1 (0-10 µg), pCMVCKII α-subunit (1-5 µg), pCMV-β-galactosidase (2 µg), and 5 µg of a chloramphenicol acetyltransferase reporter plasmid containing three Egr-1 binding sites upstream of a minimal fos promoter (25Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1993; 268: 16949-16957Abstract Full Text PDF PubMed Google Scholar). The total amount of DNA transfected was kept constant at 40 µg/plate using salmon sperm DNA. Cellular extracts were prepared and assayed for CKII activity as described by Heller-Harrison and Czech (32Heller-Harrison R.A. Czech M.P. J. Biol. Chem. 1991; 266: 14435-14439Abstract Full Text PDF PubMed Google Scholar). 10 µg of protein extracts were assayed at 37°C in a total reaction volume of 30 µl in CKII assay buffer containing 1 mM synthetic substrate peptide RRREEETEEE (33Kuenzel E.A. Krebs E.G. Proc, Natl. Acad. Sci. U. S. A. 1985; 82: 737-741Crossref PubMed Scopus (168) Google Scholar), 100 µM ATP, and 5 µCi of [γ-32P]ATP. Controls consisted of assays done in the absence of substrate peptide and were subtracted as background. Reactions were terminated by adding an equal volume of 0.01 mM ATP and 0.4 N HCl prior to trichloroacetic acid precipitation. The samples (15 µl) were spotted on Whatman P81 paper and washed in 0.5% H2PO4 three times for 10 min each, and the samples were counted. A kinase activity was found to be associated with Egr-1 immunoprecipitated from nuclear extracts of serum induced NIH 3T3 and MRC5 cells. This activity was determined to be similar to that of CKII based on its ability to utilize GTP during phosphorylation and its inhibition by heparin (data not shown). To further investigate this, Egr-1 was immunoprecipitated from nuclear extracts by a monoclonal Egr-1 antibody. Conversely, CKII was also precipitated from the same nuclear extracts by a monoclonal CKII antibody. The immunoprecipitated samples were resolved by SDS-PAGE, blotted onto nitrocellulose and probed with a polyclonal antibody to the CKII α-subunit. The polyclonal antibody recognizes the CKII α-subunit immunoprecipitated by the monoclonal CKII antibody (Fig. 1 A, lane 1) as well as that co-immunoprecipitated with Egr-1 (lane 2). CKII was also co-immunoprecipitated with other Egr-1 polyclonal antibodies 588 and 5232, but not with preimmune serum (data not shown). The converse was also true when CKII was immunoprecipitated from cytoplasmic and nuclear extracts with a monoclonal CKII antibody, and the immunoblot was probed with an anti Egr-1 polyclonal antibody. Egr-1 was found to be associated with CKII immunoprecipitated from nuclear extract (Fig. 1B, lane 2), but not from the cytoplasmic sample (Fig. 1B, lane 1). The association of Egr-1 and CKII in vitro and the localization of CKII binding domain on Egr-1 was further investigated. A near full-length GST-Egr-1 fusion protein (amino acids 29-533) as well as three Egr-1 deletions coupled to GST were made (Fig. 1C). All the fusion proteins appeared as multiple bands on SDS-PAGE stained with Coomassie Blue (Fig. 1D). This could be due to the degradation of Egr-1 products or could also be due to the multiple initiation sites. The near full-length GST-Egr-1 fusion protein, F-1, migrates as an about 100-kDa protein on SDS-PAGE, although theoretically it is only 82 kDa. This anomalous behavior is observed with cellular Egr-1 as well which runs at 80 kDa instead of its predicted molecular mass of 56 kDa (11Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1992; 267: 12991-12997Abstract Full Text PDF PubMed Google Scholar). The three Egr-1 deletions coupled to GST, C-2 (shorter C terminus fragment from amino acids 322-533), C-1 (longer C terminus Egr-1 fragment from amino acids 175-533), and N-1 (N terminus fragment of Egr-1 from amino acids 29-171) each had apparent molecular masses that matched their calculated molecular masses of 51, 66, and 43 kDa, respectively, as shown in Fig. 1, C and D. Purified CKII can be autophosphorylated on its β-subunit, and [γ-32P]ATP was used to tag CKII by autophosphorylation. The labeled CKII was incubated with the various GST-Egr-1 fusion proteins attached to glutathione-Sepharose beads. As shown in Fig. 1E, the association of CKII with Egr-1 was indicated by the presence of the 25-kDa phosphorylated β-subunit band with F-1, but not with GST alone. It was also found that CKII associated with C-2 as well as with C-1, but to a lesser extent. However, no association occurred with N-1. These results indicated that the CKII association domain within Egr-1 lies between amino acids 322 and 519. This region contains the three zinc fingers as well as the 5′ and 3′ nuclear localization signals as identified by Gashler et al. (13Gashler A.L. Swaminathan S. Sukhatme V.P. Mol. Cell. Biol. 1993; 13: 4556-4571Crossref PubMed Scopus (213) Google Scholar) and Russo et al. (14Russo M.W. Matheny C. Milbrandt J. Mol. Cell. Biol. 1993; 13: 6858-6865Crossref PubMed Scopus (89) Google Scholar). The last 14 amino acids at the C terminus of Egr-1 are unlikely to be involved in CKII binding as immunoprecipitation with 588 (an anti-Egr-1 antibody raised against the last 14 amino acids) did not disrupt the interaction between the two proteins (results not shown). In order to ascertain whether CKII phosphorylates Egr-1 in vitro, F-1 was incubated with CKII and 32P-labeled ATP. As shown in Fig. 2A, F-1 (lane 1) but not GST alone (lane 2) was phosphorylated by CKII. Phosphoamino acid analysis was performed on the phosphorylated F-1, and as shown in Fig. 2B the phosphorylation occurs more on serine than on threonine residues. To test this in vivo, Egr-1 was immunoprecipitated from platelet-derived growth factor-induced, [32P]orthophosphate-labeled, NIH 3T3 cells, and in this case strong phosphorylation on serine and weak phosphorylation on threonine residues were observed (Fig. 2C). The specificity of Egr-1 phosphorylation by CKII was investigated. Phosphorylation of the F-1 fusion protein by CKII was performed with different concentrations of the kinase. Increasing the amount of CKII resulted in a corresponding increase in the phosphorylation of Egr-1 (Fig. 3A, lanes 1-5). It has been reported that CKII phosphorylates a specific substrate, RRREEETEEE (33Kuenzel E.A. Krebs E.G. Proc, Natl. Acad. Sci. U. S. A. 1985; 82: 737-741Crossref PubMed Scopus (168) Google Scholar) and can also phosphorylate consensus sequences SXD/E, SXXD/E, or SXXXD/E (34Meggio F. Marin O. Pinna L.A. Cell. Mol. Biol. Res. 1994; 40: 401-409PubMed Google Scholar). The phosphorylation on Egr-1 is competitively inhibited by the CKII specific substrate peptide (lanes 6-9) as well as by FX, a peptide from Egr-1 containing an SXD consensus sequence (lanes 10-13) suggesting that Egr-1 phosphorylation by CKII is specific. To determine the CKII phosphorylation site(s) on Egr-1, a CNBr peptide map was generated. Theoretically, CNBr treatment of Egr-1 is predicted to produce six large peptides, separable on a polyacrylamide gel, as well as five small peptides lacking in kinase phosphorylation sites (Fig. 4A). The DNA fragments corresponding to the six large CNBr peptides (numbered 5-10) were first amplified by polymerase chain reaction. The amplified DNA was then cloned in vectors containing a SP6, T7, or T3 promoter. The [35S]methionine-labeled CNBr peptides were then synthesized in vitro with a rabbit reticulocyte lysate system and resolved by 16.5% SDS-PAGE. The peptides thus produced were in close agreement to their predicted molecular mass indicated in Fig. 4A (data not shown). In parallel to the above experiment, F-1 was phosphorylated by CKII, digested by CNBr, and resolved by 16.5% SDS-PAGE. Fragment 10 was strongly phosphorylated and fragment 7 moderately phosphorylated as compared to the other fragments (Fig. 4B, lane 1, 2-h exposure). The phosphorylation on fragments 5 and 8 was also observed on longer exposure of the autoradiograph (Fig. 4B, lane 2, 6-h exposure), whereas fragment 6 is detected only on overnight exposure (not shown). Some of the high molecular mass bands as shown by asterisks in Fig. 4B are due to incomplete CNBr digestion of Egr-1. CKII phosphorylation sites on Egr-1 in vitro were compared with those found in vivo from serum-induced, 32P-labeled NIH 3T3 cells. Egr-1 was immunoprecipitated from these cells and digested with CNBr. Fragments 5 and 10 were strongly phosphorylated, whereas fragment 7 was moderately phosphorylated in vivo (Fig. 4B, lane 3). Phosphorylation of fragments 6 and 8 was also observed only on longer exposure of the gel. Hence, serum-induced phosphorylation of fragments 5, 7, and 10 could be due to endogenous CKII, but the differential levels of phosphorylation on these fragments suggest that CKII is not the only kinase that phosphorylates Egr-1 in vivo. To further delineate the phosphorylation sites, CKII in vitro phosphorylated Egr-1 was digested with trypsin. Small peptides were separated on HPLC, and the fractions containing 32P-labeled peptides were subjected to microsequencing. The results indicate that these trypsin-generated peptides are parts of fragments 5, 6, 7, and 8 (see Fig. 4A (c)). The labeled peptides contain CKII sites (34Meggio F. Marin O. Pinna L.A. Cell. Mol. Biol. Res. 1994; 40: 401-409PubMed Google Scholar) which are S101XXD in fragment 5, T145XXXE in fragment 6, S194XD in fragment 7, and S299XD in fragment 8, all of which are potential sites for CKII phosphorylation. There are three CKII recognition sites (S376XXD, T389XE, and T516XXXD) in fragment 10. T389 and T516 are unlikely to be responsible for the strong phosphorylation of fragment 10 as phosphorylation on threonine is much weaker than that on serine. Thus S376 is likely to be the major phosphorylation site by CKII within fragment 10. The reason S376XXD could not be detected by this method, despite heavy phosphorylation in fragment 10, is because trypsin digestion resulted in a peptide around S376 of only four amino acids (NFS376R) which are not resolved by HPLC. We further confirmed phosphorylation of fragments 6, 8, and 10 by sequencing these peptides from excised gel sections (data not shown). Identification of the exact sites of CKII phosphorylation would require a site-directed mutational approach. The three zinc fingers of Egr-1 are located from amino acids 332-416. As fragment 10 contains the second and third zinc fingers, it is likely that phosphorylation on this fragment alters its DNA binding activity. To study the effect of CKII phosphorylation on Egr-1 DNA binding activity, GST-Egr-1 fusion protein (F-1) was phosphorylated with CKII prior to carrying out the DNA binding reaction in a gel mobility shift assay. The phosphorylation of Egr-1 by CKII resulted in a decrease in its DNA binding activity in a stoichiometric manner (Fig. 5, lanes 2-6). This decrease in DNA binding activity can be blocked competitively in a dose-dependent manner by the increasing concentrations of either CKII specific substrate peptide (Fig. 5, lanes 7-10) or by the FX peptide which has SXD as the CKII phosphorylation site (lanes 11-14). In order to study the effect of CKII phosphorylation on Egr-1 transcriptional activity in vivo, NIH 3T3 cells were co-transfected with a chloramphenicol acetyltransferase reporter plasmid comprised of three Egr-1 binding sites, an Egr-1 expression plasmid, pCMV-Egr-1, and a CKII expression plasmid, pCMVCKII (containing the CKII α-subunit). The CKII activity in untransfected and transfected cells was determined to ensure that the pCMVCKII plasmid produced active CKII in NIH 3T3 cells. A 1.6-fold increase in CKII activity was observed on transfecting cells with 2 µg of the pCMVCKII α-subunit (data not shown), which was in close agreement with previously reported results in COS-1 cells (32Heller-Harrison R.A. Czech M.P. J. Biol. Chem. 1991; 266: 14435-14439Abstract Full Text PDF PubMed Google Scholar). Transfection of cells with increasing concentrations of pCMV-Egr-1 results in an increase in transcriptional activity reflected by an increase in chloramphenicol acetyltransferase activity (Fig. 6A, top panel). However, when the increasing concentrations (1, 2, and 5 µg) of CKII plasmids were co-transfected with egr-1, a corresponding decrease in egr-1 transcriptional activity was observed (Fig. 6A, lower panels). Nuclear extracts were prepared from cells transfected with or without pCMVCKII in the presence of pCMV-Egr-1 and gel mobility shift analysis was performed using the Egr-1 binding site as a probe. A decrease in DNA binding activity was found when CKII was co-transfected with pCMV-Egr-1 (Fig. 6B, panel i, lane 2). Western analysis of these extracts showed that there was no change in the amount of Egr-1 protein present in each sample (Fig. 6B, panel ii). Thus, in the presence of the CKII plasmid there is a decrease in the DNA binding ability of Egr-1 in accordance with the in vitro mobility shift data (Fig. 5). To show that this decrease is a result of phosphorylation of the Egr-1 protein by CKII, transfected cells were labeled with [32P]orthophosphate. Egr-1 was immunoprecipitated with Egr-1 antibody, resolved by 7.5% SDS-PAGE, and transferred to a nitrocellulose membrane, and autoradiography was performed. A 2-fold increase in Egr-1 phosphorylation was observed when cells were co-transfected with pCMV-Egr-1 in the presence of pCMVCKII as compared to that in the absence of pCMVCKII (Fig. 6C, panel i). Western blot analysis was performed on the same nitrocellulose membrane to confirm that there was no difference in the amount of Egr-1 protein (Fig. 6C, panel ii). To activate or repress transcription, transcription factors must locate to the nucleus, bind DNA, and interact with the basal transcription apparatus (35Hill C.S. Treisman R. Cell. 1995; 80: 199-211Abstract Full Text PDF PubMed Scopus (1198) Google Scholar). Accordingly, extracellular signals that regulate transcription factor activity may affect one or more of these processes. Most commonly regulation is achieved by phosphorylation of the transcription factor(s) which in turn modulate either its trans-activating activity or DNA binding activity (36Hunter T. Karin M. Cell. 1992; 70: 375-387Abstract Full Text PDF PubMed Scopus (1120) Google Scholar). Although Egr-1, a transcription factor, has been shown to play an important role in proliferating and differentiating cells, little is known of its function in relation to its phosphorylation status. In this report we show that Egr-1 is phosphorylated by the protein kinase CKII and that this has a negative effect on its DNA binding and transcription activities. Although the CKII phosphorylation pattern of Egr-1 does not exactly coincide with that of serum-induced Egr-1, it is possible that CKII is one of several kinases which phosphorylate and regulate Egr-1 function. As shown in Fig. 4A, the CKII phosphorylation sites on Egr-1 cover the regions of the protein important for its transcriptional activation (fragment 7), repressor binding (fragment 8), nuclear import, and DNA binding (fragment 10). The CKII sites present on these fragments are of S/TXD/E, S/TXXD/E, and S/TXXXD/E types (34Meggio F. Marin O. Pinna L.A. Cell. Mol. Biol. Res. 1994; 40: 401-409PubMed Google Scholar). The observation that CKII attenuates Egr-1 DNA binding activity appears to be contradictory to earlier reports that Egr-1 DNA binding activity (25Cao X. Mahendran R. Guy G.R. Tan Y.H. J. Biol. Chem. 1993; 268: 16949-16957Abstract Full Text PDF PubMed Google Scholar) is elevated after cell stimulation with growth factors. This could be due to a change in conformation arising from phosphorylation by other kinases beside CKII after serum induction. Furthermore, strong phosphorylation in the activation domain (fragment 5) of Egr-1 in vivo after serum induction might lead to an increase in its transcriptional activity. It has been reported that the CKII α-subunit alone is sufficient to increase CKII activity in vivo for several reasons. First, the α-subunit alone is moderately active without the β subunit (37Kikkawa U. Mann S.K. Firtel R.A. Hunter T. Mol. Cell. Biol. 1992; 12: 5711-5723Crossref PubMed Google Scholar, 38Dobrowolska G. Boldyreff B. Issinger O.G. Biochim. Biophys. Acta. 1991; 1129: 139-140Crossref PubMed Scopus (51) Google Scholar). Second, the α-subunit in nuclei is not bound to β but is complexed to other nuclear components (39Stigare J. Boddelmeijer N. Pigon A. Egyhazi E. Mol. Cell. Biochem. 1993; 129: 77-85Crossref PubMed Scopus (57) Google Scholar). Third, the β-subunit is synthesized in large excess over the α-subunit and only a small fraction of it contributes to the tetrameric holoenzyme complex (40Lüscher B. Litchfield D.W. Eur. J. Biochem. 1994; 220: 521-526Crossref PubMed Scopus (79) Google Scholar). In our experiments, co-transfection of pCMVCKIIα and pCMV-Egr-1 results in a decrease in transcriptional activity in vivo which is possibly due to a decrease in DNA binding activity caused by CKII phosphorylation of the DNA binding fragment. Besides phosphorylating Egr-1, the association of CKII and Egr-1 could also induce further protein-protein interactions. As CKII is a tetrameric protein, it is possible that by anchoring different proteins to its four subunits it could promote interactions between diverse proteins. DNA topoisomerase II, which associates with CKII, is believed to participate in DNA transcription (as well as replication and recombination) as part of a multienzyme complex (41Watt P.M. Hickson I.D. Biochem. J. 1994; 303: 681-695Crossref PubMed Scopus (387) Google Scholar). CKII could thus be the building block for such a multienzyme complex which might possibly include a transcription factor. On the other hand, CKII has also been found to associate with the proteasome complex resulting in its degradation (42Ludemann R. Lerea K.M. Etlinger J.D. J. Biol. Chem. 1993; 268: 17413-17417Abstract Full Text PDF PubMed Google Scholar). Hence, CKII association with Egr-1 could be a prelude to degradation. This would correlate well with the fact that CKII phosphorylation of Egr-1 leads to a decrease in DNA binding and transcriptional activities. It is thus possible that Egr-1 transcriptional activity might be affected via its link with CKII by other CKII associated proteins. Our data show that CKII associates with Egr-1 and regulates its DNA binding and transcriptional activities by phosphorylation. Egr-1 is not the only DNA-binding protein that is inhibited by CKII. Other such proteins are c-Jun (19Lin A. Frost J. Deng T. Smeal T. Alawi N. Kikkawa U. Hunter T. Brenner D. Karin M. Cell. 1992; 70: 777-789Abstract Full Text PDF PubMed Scopus (312) Google Scholar), c-Myb (43Lüscher B. Christenson E. Litchfield D.W. Krebs E.G. Eisenman R.N. Nature. 1990; 344: 517-522Crossref PubMed Scopus (244) Google Scholar), and serum response factor (44Manak J.R. de Bisschop N. Kris R.M. Prywes R. Genes & Dev. 1990; 4: 955-967Crossref PubMed Scopus (118) Google Scholar). It is now necessary to study Egr-1 regulation in the context of CKII. A map of CNBr fragments of Egr-1 has been generated and the fragments phosphorylated by CKII have been identified. This will facilitate not only the further study of Egr-1 phosphorylation by CKII as well as other kinases but also aid in determining the phosphorylated residues on Egr-1 and lead to a better understanding of Egr-1 function in regulating cell growth and differentiation. We are grateful to Dr. Steven Sloan for the gift of the pCMVCKII plasmid and to Amgen Inc. for the Egr-1 monoclonal antibody. We thank Drs. Catherine J. Pallen and Kee Chuan Goh for critical reading of the manuscript and Francis Leong and Sock Yng Oh for photography." @default.
• W2000359273 created "2016-06-24" @default.
• W2000359273 creator A5000431183 @default.
• W2000359273 creator A5021518210 @default.
• W2000359273 creator A5039813762 @default.
• W2000359273 creator A5044596435 @default.
• W2000359273 creator A5057776021 @default.
• W2000359273 creator A5061768251 @default.
• W2000359273 date "1996-06-01" @default.
• W2000359273 modified "2023-10-16" @default.
• W2000359273 title "Casein Kinase II Associates with Egr-1 and Acts as a Negative Modulator of Its DNA Binding and Transcription Activities in NIH 3T3 Cells" @default.
• W2000359273 cites W1497214669 @default.
• W2000359273 cites W1525712969 @default.
• W2000359273 cites W1528493806 @default.
• W2000359273 cites W1544738532 @default.
• W2000359273 cites W1550381567 @default.
• W2000359273 cites W159325311 @default.
• W2000359273 cites W1594157538 @default.
• W2000359273 cites W1647784204 @default.
• W2000359273 cites W1963887390 @default.
• W2000359273 cites W1975085160 @default.
• W2000359273 cites W1977896169 @default.
• W2000359273 cites W1984767179 @default.
• W2000359273 cites W1993004730 @default.
• W2000359273 cites W1993243592 @default.
• W2000359273 cites W1996223704 @default.
• W2000359273 cites W2004174427 @default.
• W2000359273 cites W2014569682 @default.
• W2000359273 cites W2020478991 @default.
• W2000359273 cites W2021820849 @default.
• W2000359273 cites W2022113523 @default.
• W2000359273 cites W2032118018 @default.
• W2000359273 cites W2039333302 @default.
• W2000359273 cites W2047398483 @default.
• W2000359273 cites W2052537645 @default.
• W2000359273 cites W2068446924 @default.
• W2000359273 cites W2077309544 @default.
• W2000359273 cites W2080997610 @default.
• W2000359273 cites W2082797919 @default.
• W2000359273 cites W2087023891 @default.
• W2000359273 cites W2095416319 @default.
• W2000359273 cites W2100837269 @default.
• W2000359273 cites W2101108802 @default.
• W2000359273 cites W2110964091 @default.
• W2000359273 cites W2155968662 @default.
• W2000359273 cites W2167604659 @default.
• W2000359273 cites W2271762807 @default.
• W2000359273 cites W981365008 @default.
• W2000359273 doi "https://doi.org/10.1074/jbc.271.23.13530" @default.
• W2000359273 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8662759" @default.
• W2000359273 hasPublicationYear "1996" @default.
• W2000359273 type Work @default.
• W2000359273 sameAs 2000359273 @default.
• W2000359273 citedByCount "55" @default.
• W2000359273 countsByYear W20003592732012 @default.
• W2000359273 countsByYear W20003592732013 @default.
• W2000359273 countsByYear W20003592732014 @default.
• W2000359273 countsByYear W20003592732016 @default.
• W2000359273 countsByYear W20003592732017 @default.
• W2000359273 countsByYear W20003592732019 @default.
• W2000359273 countsByYear W20003592732020 @default.
• W2000359273 countsByYear W20003592732021 @default.
• W2000359273 countsByYear W20003592732022 @default.
• W2000359273 countsByYear W20003592732023 @default.
• W2000359273 crossrefType "journal-article" @default.
• W2000359273 hasAuthorship W2000359273A5000431183 @default.
• W2000359273 hasAuthorship W2000359273A5021518210 @default.
• W2000359273 hasAuthorship W2000359273A5039813762 @default.
• W2000359273 hasAuthorship W2000359273A5044596435 @default.
• W2000359273 hasAuthorship W2000359273A5057776021 @default.
• W2000359273 hasAuthorship W2000359273A5061768251 @default.
• W2000359273 hasBestOaLocation W20003592731 @default.
• W2000359273 hasConcept C104317684 @default.
• W2000359273 hasConcept C138885662 @default.
• W2000359273 hasConcept C153911025 @default.
• W2000359273 hasConcept C160110348 @default.
• W2000359273 hasConcept C179926584 @default.
• W2000359273 hasConcept C184235292 @default.
• W2000359273 hasConcept C185592680 @default.
• W2000359273 hasConcept C41895202 @default.
• W2000359273 hasConcept C55493867 @default.
• W2000359273 hasConcept C86339819 @default.
• W2000359273 hasConcept C86803240 @default.
• W2000359273 hasConcept C95444343 @default.
• W2000359273 hasConcept C97029542 @default.
• W2000359273 hasConceptScore W2000359273C104317684 @default.
• W2000359273 hasConceptScore W2000359273C138885662 @default.
• W2000359273 hasConceptScore W2000359273C153911025 @default.
• W2000359273 hasConceptScore W2000359273C160110348 @default.
• W2000359273 hasConceptScore W2000359273C179926584 @default.
• W2000359273 hasConceptScore W2000359273C184235292 @default.
• W2000359273 hasConceptScore W2000359273C185592680 @default.
• W2000359273 hasConceptScore W2000359273C41895202 @default.
• W2000359273 hasConceptScore W2000359273C55493867 @default.
• W2000359273 hasConceptScore W2000359273C86339819 @default.
• W2000359273 hasConceptScore W2000359273C86803240 @default.
• W2000359273 hasConceptScore W2000359273C95444343 @default.
• W2000359273 hasConceptScore W2000359273C97029542 @default.

• next