FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000417926> ?p ?o ?g. }

• W2000417926 endingPage "29259" @default.
• W2000417926 startingPage "29251" @default.
• W2000417926 abstract "The metalloprotease disintegrin cysteine-rich (MDC) proteins are a recently identified family of transmembrane proteins that function in proteolytic processing of cell surface molecules and in cell adhesion. Since lymphocytes must interact with a constantly changing environment, we hypothesized that lymphocytes would express unique MDC proteins. To identify MDC proteins expressed in human lymph node, a polymerase chain reaction-based strategy combined with degenerate oligonucleotide primers was employed. We report here the identification of MDC-L (ADAM 23), a novel member of the MDC protein family. The results obtained from cDNA cloning and Northern blot analysis of mRNA isolated from various lymphoid tissues indicate that a 2.8-kilobase mRNA encoding a transmembrane form, MDC-Lm, and a 2.2-kilobase mRNA encoding a secreted form, MDC-Ls, are expressed in a tissue-specific manner. MDC-L mRNA was shown to be predominantly expressed in secondary lymphoid tissues, such as lymph node, spleen, small intestine, stomach, colon, appendix, and trachea. Furthermore, immunohistochemical staining with an anti-MDC-L antibody demonstrated that cells with typical lymphocyte morphology are responsible for expression of the MDC-L antigen in these lymphoid tissues. MDC-Lm was found to be expressed on the surface of human peripheral blood lymphocytes and transformed B- and T-lymphocyte cell lines as an 87-kDa protein. Thus, we have identified a novel lymphocyte-expressed MDC protein family member. The metalloprotease disintegrin cysteine-rich (MDC) proteins are a recently identified family of transmembrane proteins that function in proteolytic processing of cell surface molecules and in cell adhesion. Since lymphocytes must interact with a constantly changing environment, we hypothesized that lymphocytes would express unique MDC proteins. To identify MDC proteins expressed in human lymph node, a polymerase chain reaction-based strategy combined with degenerate oligonucleotide primers was employed. We report here the identification of MDC-L (ADAM 23), a novel member of the MDC protein family. The results obtained from cDNA cloning and Northern blot analysis of mRNA isolated from various lymphoid tissues indicate that a 2.8-kilobase mRNA encoding a transmembrane form, MDC-Lm, and a 2.2-kilobase mRNA encoding a secreted form, MDC-Ls, are expressed in a tissue-specific manner. MDC-L mRNA was shown to be predominantly expressed in secondary lymphoid tissues, such as lymph node, spleen, small intestine, stomach, colon, appendix, and trachea. Furthermore, immunohistochemical staining with an anti-MDC-L antibody demonstrated that cells with typical lymphocyte morphology are responsible for expression of the MDC-L antigen in these lymphoid tissues. MDC-Lm was found to be expressed on the surface of human peripheral blood lymphocytes and transformed B- and T-lymphocyte cell lines as an 87-kDa protein. Thus, we have identified a novel lymphocyte-expressed MDC protein family member. metalloprotease disintegrin cysteine-rich protein a disintegrin and metalloprotease epidermal growth factor matrix metalloprotease tissue necrosis factor-α-converting enzyme polymerase chain reaction 5′-rapid amplification of cDNA ends reverse transcriptase polyacrylamide gel electrophoresis kilobase(s) base pair(s) phosphate-buffered saline fetal calf serum N-tris(hydroxymethyl)methylglycine MDC,1 or ADAMs, are a family of transmembrane glycoproteins with a unique domain structure (1Blobel C.P. Cell. 1997; 90: 589-592Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar, 2Wolfsberg T.G. White J.M. Dev. Biol. 1996; 180: 389-401Crossref PubMed Scopus (217) Google Scholar). The prototypical MDC protein comprises pro, metalloprotease, disintegrin, cysteine-rich, EGF, transmembrane, and cytoplasmic domains. The metalloprotease domain is homologous to the reprolysins, members of the zinc binding metzincin superfamily that also includes the matrix metalloproteases (MMPs), the astacins, and serralysins (3Stocker W. Grams F. Baumann U. Reinemer P. Gomis-Ruth F.-X. McKay D.B. Bode W. Protein Sci. 1995; 4: 823-840Crossref PubMed Scopus (638) Google Scholar). The prodomain regulates the activity of the metalloprotease by blocking access to the zinc ion; removal of the prodomain or inactivation of a conserved cysteine thiol group results in a gain of proteolytic activity. The disintegrin domains of MDC proteins are homologous to small nonenzymatic peptides isolated from the venom of snakes. Snake venom disintegrin peptides interfere with platelet aggregation by inhibiting binding of fibrinogen to the integrin αIIbβ3 (4Niewiarowski S. McLane M.A. Kloczewiak M. Stewart G.J. Semin. Hematol. 1994; 31: 289-300PubMed Google Scholar). The functions previously attributed to the individual domains suggests roles for MDC proteins in cell adhesion and the proteolysis of extracellular proteins. The first mammalian MDC proteins identified were the fertilins (5Blobel C.P. Wolfsberg T.G. Turck C.W. Myles D.G. Primakoff P. White J.M. Nature. 1992; 356: 248-252Crossref PubMed Scopus (612) Google Scholar). These proteins function in the attachment and fusion of the sperm and egg during fertilization. A similar cell fusion function for the MDC protein meltrin-α (MDC-12) was shown for the formation of multinucleated myotubes (6Yagami-Hiromasa T. Sato T. Kurisaki T. Kamijo K. Nabeshima Y.-i. Fujisawa-Sehara A. Nature. 1995; 377: 652-656Crossref PubMed Scopus (439) Google Scholar). These MDC proteins have, in addition to the domains described above, a fusion peptide-like sequence not found in all members of the MDC protein family. However, the interaction of the fertilin disintegrin domain on the sperm surface with the integrin α6β1 on the surface of the egg is also required for membrane adhesion and fusion (7Myles D.G. Kimmel L.H. Blobel C.P. White J.M. Primakoff P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4195-4198Crossref PubMed Scopus (233) Google Scholar, 8Yuan R. Primakoff P. Myles D.G. J. Cell Biol. 1997; 137: 105-112Crossref PubMed Scopus (203) Google Scholar, 9Almeida E.A.C. Huovila A.-P.J. Sutherland A.E. Stephens L.E. Calarco P.G. Shaw L.M. Mercurio A.M. Sonnenberg A. Primakoff P. Myles D.G. White J.M. Cell. 1995; 81: 1095-1104Abstract Full Text PDF PubMed Scopus (471) Google Scholar). Additional evidence for the functionality of the disintegrin domain comes from studies using recombinantly expressed metargidin (MDC-15) disintegrin domain, which was shown to specifically interact with the integrin αvβ3 (10Zhang X.-P. Kamata T. Yokoyama K. Puzon-Mclaughlin W. Takada Y. J. Biol. Chem. 1998; 273: 7345-7350Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Thus, the disintegrin domains of MDC proteins appear to be a new family of integrin ligands. More recently, MDC proteins have been shown to function in ectodomain shedding of several cell surface proteins. Tissue necrosis factor-α converting enzyme (TACE; MDC-17) was the first mammalian MDC protein shown to have secretase activity (11Black R.A. Rauch C.T. Kozlosky C.J. Peschon J.J. Slack J.L. Wolfson M.F. Castner B.J. Stocking K.L. Reddy P. Srinivasan S. Nelson N. Boiani N. Schooley K.A. Gerhart M. Davis R. Fitzner J.N. Johnson R.S. Paxton R.J. March C.J. Cerretti D.P. Nature. 1997; 385: 729-733Crossref PubMed Scopus (2728) Google Scholar, 12Moss M.L. Jin S.-L.C. Milla M.E. Burkhart W. Carter H.L. Chen W.-J. Clay W.C. Didsbury J.R. Hassler D. Hoffman C.R. Kost T.A. Lambert M.H. Leesnitzer M.A. McCauley P. McGeehan G. Mitchell J. Moyer M. Pahel G. Rocque W. Overton L.K. Schoenen F. Seaton T. Su J.-L. Warner J. Willard D. Becherer J.D. Nature. 1997; 385: 733-736Crossref PubMed Scopus (1490) Google Scholar, 13Peschon J.J. Slack J.L. Reddy P. Stocking K.L. Sunnarborg S.W. Lee D.C. Russell W.E. Castner B.J. Johnson R.S. Fitzner J.N. Boyce R.W. Nelson N. Kozlosky C.J. Wolfson M.F. Rauch C.T. Cerretti D.P. Paxton R.J. March C.J. Black R.A. Science. 1998; 282: 1281-1284Crossref PubMed Scopus (1371) Google Scholar). Additionally, meltrin-γ (MDC-9) is involved in ectodomain shedding of membrane anchored heparin-binding EGF-like growth factor, and considerable evidence supports the proteolytic processing of notch by theDrosophila MDC protein Kuzbian (14Izumi Y. Hirata M. Hasuwa H. Iwamoto R. Umata T. Miyado K. Tamai Y. Kurisaki T. Sehara-Fujisawa A. Ohno S. Mekada E. EMBO J. 1998; 17: 7260-7272Crossref PubMed Scopus (475) Google Scholar, 15Rooke J. Pan D. Xu T. Rubin G.M. Science. 1996; 272: 1227-1231Crossref Scopus (303) Google Scholar, 16Pan D. Rubin G.M. Cell. 1997; 90: 271-280Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 17Qi H. Rand M.D. Wu X. Sestan N. Wang W. Rakic P. Xu T. Artavanis-Tsakonas S. Science. 1999; 283: 91-94Crossref PubMed Scopus (375) Google Scholar). Many other proteins are shed from cell surfaces by metalloproteases, implicating other MDC proteins in proteolytic processing (18Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (562) Google Scholar). Thus, MDC proteins may function in a variety of processes. First, they may control the release of ligands from the cell surface as in the case of tissue necrosis factor-α. Second, MDC proteins may rapidly regulate adhesive events by cleaving receptors or counter receptors from the cell surface, such as in the shedding of l-selectin (19Kahn J. Ingraham R.H. Shirley F. Migaki G.I. Kishimoto T.K. J. Cell Biol. 1994; 125: 461-470Crossref PubMed Scopus (184) Google Scholar, 20Freehan C. Darlak K. Kahn J. Walcheck B. Spatola A.F. Kishimoto T.K. J. Biol. Chem. 1996; 271: 7019-7024Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). Third, the similarity between membrane-bound MMPs and MDC proteins suggests a role in extracellular matrix proteolysis. Finally, MDC protein themselves may function as ligands for integrin receptors. The work presented here describes MDC-L, a novel member of the MDC protein family, expressed by lymphocytes in the tissues examined. Two transcripts, one encoding a prototypical MDC protein and the other encoding a secreted form, demonstrated tissue specific regulation. The transmembrane form of MDC-L was expressed as an 87-kDa protein on the surface of peripheral blood lymphocytes and both B- and T-lymphocyte cell lines. We hypothesize that MDC-L may play a role in the adhesive and proteolytic events that occur during lymphocyte emigration or function in ectodomain shedding of lymphocyte proteins such as FasL, CD40L, or an as yet unidentified lymphocyte protein (21Tanaka M. Itai T. Adachi M. Nagata S. Nat. Med. 1998; 4: 31-36Crossref PubMed Scopus (611) Google Scholar, 22Pietravalle F. Lecoanet-Henchoz S. Blasey H. Aubry J.-P. Elson G. Edgerton M.D. Bonnefoy J.-Y. Gauchat J.-F. J. Biol. Chem. 1996; 271: 5965-5967Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). The T-lymphocyte cell line A139.1 was obtained from Dr. H. Fickenscher (Universitaet Erlangen-Nuernberg, Erlangen, Germany) and cultured in 45% RPMI 1640, 45% AIM-V, 10% fetal calf serum (FCS) containing 100 units/ml IL-2 (23Fickenscher H. Bokel C. Knappe A. Biesinger B. Meinl E. Fleischer B. Fleckenstein B. Broker B.M. J. Virol. 1997; 71: 2252-2263Crossref PubMed Google Scholar). The Epstein-Barr virus-transformed B-lymphocyte cell line RD105U was provided by Dr. W. Hildebrand (University of Oklahoma Health Sciences Center, Oklahoma City, OK) and cultured in RPMI 1640, 10% FCS, 1%l-glutamine, containing 1% penicillin/streptomycin. The T-lymphocyte cell line Hut78 was obtained from American Type Culture Collection (Rockville, MD) and grown in Iscove's modified Dulbecco's medium, 20% FCS, 4 mml-glutamine, 1.5 g/liter NaHCO3. Manipulation of recombinant DNA was by standard techniques (24Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Restriction enzymes, T4 DNA ligase, and Taqpolymerase were purchased from Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were synthesized by the Molecular Biology Resource Facility at the University of Oklahoma Health Sciences Center. The degenerate oligonucleotide primers used were B1 (GARGGNGARGAYTGYGAYTG), B2 (GGNGARGAYTGYGAYTGYGG), C1 (CARTAYTCNGGNARRTCRCA), and C2 (TAYTCNGGNARRTCRCAYTC) in which N signifies any deoxynucleotide, R signifies either A or G, and Y signifies either T or C (25Weskamp G. Blobel C.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2748-2751Crossref PubMed Scopus (75) Google Scholar). Nested PCR was performed as follows. For reaction 1, 500 ng of human lymph node cDNA (CLONTECH, Palo Alto, CA) was combined with 0.5 μg of primers B1 and C1 in a hot start PCR using the AmpliWax (Perkin Elmer) protocol. The PCR products were then separated from the oligonucleotides by centrifugal filtration. For reaction 2, the reaction 1 products were combined with 0.5 μg of primers B2 and C2 in a hot start PCR protocol. The PCR products obtained from reaction 2 were subcloned into pCRII-TOPO (Invitrogen, Carlsbad, CA) and the nucleotide sequence of both strands determined. A 190-bp EcoRI fragment from a pCRII-TOPO MDC-L subclone was electroeluted from a 5% polyacrylamide gel (PAGE) and labeled with [α-32P]dCTP (Amersham Pharmacia Biotech) by the random primer method. After removal of the unincorporated nucleotides, the radiolabeled 190-bp EcoRI fragment was used to probe a λgt10 human lymph node cDNA library (CLONTECH). Positive plaques were isolated, plated at a lower density, and probed until all the plaques on a plate were positive. The cDNA from the positive phage were subcloned into pCRII-TOPO vector after PCR of a phage lysate with λgt10 forward and reverse primers (26Herrmann J. Lee P. Saya H. Nakajima M. BioTechniques. 1990; 8: 376-378PubMed Google Scholar). The nucleotide sequence of both strands was determined using universal and gene specific primers. The 5′ rapid amplification of cDNA ends (RACE) was performed using Marathon-Ready cDNA (CLONTECH) as recommended by supplier with the primers AP1 and the gene-specific primer MET12 (CTGTCCATCCCGATGTATGGGGC). The PCR products obtained were separated from the primers by centrifugal filtration and subjected to a second PCR with the primers AP2 and MET12. The 600-bp product obtained was subcloned into pCRII-TOPO and both strands sequenced using universal and gene-specific primers. The multiple tissue northern and mRNA dot blot were purchased from CLONTECH. Hybridization of the mRNA dot blot was performed with the same probe used for cDNA cloning. The MDC-Lm-specific probe was a 790-bpBamHI/SalI (vector site) fragment from the 3′ end of MDC-Lm cDNA that had been extracted from an agarose gel. The MDC-Ls-specific probe was a HindIII fragment from the 3′-untranslated region of MDC-Ls cDNA. All probes were radiolabeled with [α-32P]dCTP by the random primer method to a specific activity greater than 1 × 109 cpm/μg. Polyadenylated RNA transferred to nylon membranes were hybridized with the specified probe as described (27Verca G.D. Northemann W. Shiels B.R. Widera G. Broome S. BioTechniques. 1990; 8: 370-371PubMed Google Scholar). The nylon membranes were exposed to x-ray film at −80 °C for 3 days. After exposure of the nylon membranes to film, the bound probe was stripped by heating at 95 °C for 10 min in 0.5% SDS, rinsing in H2O, and storing at −20 °C. RT-PCR was carried out using the mRNA capture kit and Titan One Tube RT-PCR system (Roche Molecular Biochemicals) and the specified gene-specific primers. Primers used for RT-PCR of human lymph node mRNA were L1 (CGGGATCCGTTCAGGAACATGAG), Lm1 (GTCATCGCAGTCGGGAGGGATCC), and Ls1 (GTTTATGATCTTAGTAGGGTTGCC). Peripheral blood leukocytes were isolated by incubating fresh normal human blood with either anti-CD2, CD19, CD14, and CD16 monoclonal antibodies (Caltag Laboratories, Burlingame, CA), then adding sheep anti-mouse IgG magnetic beads (Dynal, Oslo, Norway), and separating the cells with a magnet. The isolated cells were quantitated, and 1 × 105 cells were used for RT-PCR. Primers used for leukocyte RT-PCR were L2 (TCTGGTCCTGGATAATGGTGAGTT), Lm2 (CACACTCATTCCCTGCAAAGCAAA), Ls2 (TGGTTTTAGGGTTGCTAGATTTAG), Actin1 (GGCATCCTCACCCTGAAGTACCCC), and Actin2 (CGTCATACTCCTGCTTGCTGATCC). Nested PCR was performed using a standard 30-cycle PCR reaction with 2 μl of the initial RT-PCR reaction as template and the primers L3 (TCCATTGCCTACAGATATCATATCC) and L4 (CCCCACAGCTCTGTCCACTGC). The products were verified by gel electrophoresis and cleavage with the restriction enzymes BamHI, HindIII, andDraI. The MDC-L disintegrin domain (residues Gly418–Glu476) was PCR-amplified from the λgt10 subclone 2.2.5 with the oligonucleotides MDC-01 (CGGGATCCGGTGAGGACTGCGACTGCGGG) and MDC-02 (AACTGCAGTTATTCAGGCAGGTCGCACTC), digested with BamHI andPstI, subcloned into the hexahistidine (H6) expression vector pQE30 (Qiagen Inc., Valencia, CA), and transformed intoEschericia coli M15[pREP4]. Cells harboring the pQE30 MDC-L disintegrin domain recombinant plasmid were grown in SB media plus 100 μg/ml ampicillin and 50 μg/ml kanamycin at 37 °C to anA 600 nm of 0.5–0.7. Isopropyl-β-d-thiogalactopyranoside was added to a final concentration of 2 mm, and the cells were further incubated at 37 °C for 2 h. The cell culture was centrifuged at 4,000 × g for 10 min, and the pellet was resuspended in sonication buffer (50 mm sodium phosphate, pH 7.8, 300 mm NaCl, 5 mm 2-mercaptoethanol) and stored at −80 °C. The thawed cell suspension was sonicated, centrifuged at 11,000 × g for 20 min at 4 °C, the supernatant diluted 1:3 in sonication buffer, and affinity-purified on Ni-NTA agarose. Material bound to the Ni-NTA-agarose was washed with 50 mm sodium phosphate, pH 6.0, 300 mm NaCl, 5 mm 2-mercaptoethanol, 10% glycerol and then eluted with the same buffer at pH 4.0. The purified fusion protein was dialyzed in phosphate-buffered saline (PBS) and examined by 15% Tris-Tricine PAGE. The correct amino acid composition was verified by electrospray mass spectrometry. The MDC-Lm EGF domain (residues Thr627–Ser666) was PCR amplified from the λgt10 subclone 4.2.2 with the oligonucleotides MDC-E1 (TCAGAATTCACCAATTGCTCATCCAAG) and MDC-E2 (CAATCTAGACTAGGAGAAGTGGAAGACCAC), digested with EcoRI and XbaI, and subcloned into the malE gene fusion vector pMALc2 (New England Biolabs, Beverly, MA). Maltose-binding protein-MDC-L fusion proteins were purified and analyzed as described (28Bowditch R.D. Halloran C.E. Aota S. Obara M. Plow E.F. Yamada K.M. Ginsberg M.H. J. Biol. Chem. 1991; 266: 23323-23328Abstract Full Text PDF PubMed Google Scholar). For the production of polyclonal antibodies, two rabbits were hyperimmunized with either purified H6-MDC-L disintegrin domain or maltose-binding protein-MDC-L EGF domain fusion proteins following standard techniques (29Harlow E. Lane D. Antibodies. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988Google Scholar). Purified immunoglobulin was obtained by protein A-Sepharose affinity chromatography (Amersham Pharmacia Biotech). Affinity-purified anti-MDC-L disintegrin domain antibody was obtained by incubating 5 mg of purified immunoglobulin with the disintegrin domain affinity resin overnight at 4 °C, washing extensively with PBS, and eluting with 0.1 m glycine, pH 3.0, 0.5 m NaCl. Eluted antibody was immediately neutralized with 0.1 m Tris, pH 8.0, and then dialyzed in PBS. SDS-PAGE was performed under reducing and non-reducing conditions (30Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207538) Google Scholar). Immunoblots were performed by the transfer of SDS-PAGE separated proteins to nitrocellulose (Micron Separations Inc., Westborough, MA), blocking in 2% Blotto, and incubating with polyclonal antiserum at a 1:10,000 dilution. The bound antibody was detected by subsequent incubation with a biotinylated secondary antibody, incubation with avidin-conjugated peroxidase (Vector Laboratories, Inc., Burlingame, CA), and visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech). Peripheral blood lymphocytes were isolated from normal donors by centrifugation through Ficoll-Paque plus (Amersham Pharmacia Biotech). Whole cell lysates were prepared by incubating saline-washed cell pellets in lysis buffer (10 mm HEPES, pH 7.4, 150 mm NaCl, 50 mm β-octyl-d-glucopyranoside, 1 mm Pefabloc (Roche Molecular Biochemicals), 10 mm leupeptin, 1 mg/ml ethylmaleimide). Immunoprecipitations were performed by surface biotinylation of 2 × 107 cells with 0.5 mg of sulfo-NHS-biotin (Pierce) in PBS for 2 h. The cells were then washed three times in PBS and lysed on ice for 30 min in 0.5 ml of radioimmune precipitation buffer (50 mm Tris, pH 8.0, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid, 0.1% SDS). After centrifugation at 16,000 × g for 10 min, 100 μl of the supernatant was incubated with 5 μl of protein A-Sepharose pre-armed with the specified antiserum for 1 h on ice. The resin was washed three times with radioimmune precipitation buffer, boiled in SDS-PAGE loading buffer, centrifuged, subjected to SDS-PAGE, transferred to nitrocellulose, and biotinylated proteins detected as described above. Human tissues were obtained from either normal portions of surgical specimens or from autopsy specimens at University Hospital and Children's Hospital of the University of Oklahoma Health Sciences Center and were procured according to institutional guidelines. Tissues were fixed in 10% paraformaldehyde, processed, paraffin-embedded, and sectioned using conventional techniques. Snap-frozen tonsil and stomach were used to evaluate possible antigen loss when studying paraformaldehyde-fixed, paraffin-embedded tissues. Tissue sections were treated as described (31Laszik Z. Jansen P.J. Cummings R.D. Tedder T.F. McEver R.P. Moore K.L. Blood. 1996; 88: 3010-3021Crossref PubMed Google Scholar). Briefly, deparaffinized sections were treated with 1.25% H2O2 in methanol for 30 min to block endogenous peroxidase activity. Immunohistochemical staining for MDC-L antigen was performed using standard strepavidin biotin peroxidase methodology at room temperature. The slides were incubated with PBS containing 5% swine serum to inhibit nonspecific antibody binding, followed by addition of the primary affinity-purified antibody diluted in PBS containing 1% bovine serum albumin for 60 min. Biotin-conjugated swine anti-rabbit secondary antibody was applied for 20 min, followed by strepavidin-horseradish peroxidase(Dako Corp., Carpinteria, CA) for 30 min. Diaminobenzidine (Sigma) was used as chromogen. Hematoxylin was used for nuclear counterstaining. Protein concentrations were determined by the BCA assay (Pierce). The MDC-L disintegrin domain affinity column was generated by cross-linking 2.6 mg of H6-MDC-L disintegrin domain in 0.1 m NaHCO3, pH 8.0, 0.5 m NaCl to 0.3 g of CNBr-activated Sepharose. The affinity matrix was then incubated in 0.1 m Tris, pH 8.0, 500 mm NaCl for 2 h at room temperature, washed several times with alternating 0.1 m glycine, pH 3.0, 0.5 m ,NaCl and 0.1m Tris, pH 8.0, 0.5 m NaCl, and stored in PBS at 4 °C. Data base searches were performed using the National Center for Biotechnology Information's BLAST sequence similarity searching program. Molecular modeling were performed using the SWISS-MODEL protein modeling server (32Guex N. Peitsch M.C. Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9641) Google Scholar). To determine whether lymphocytes express any MDC protein family members, human lymph node cDNA was subjected to two consecutive rounds of PCR with two sets of internally nested degenerate oligonucleotide primers. These degenerate primers were based on the coding sequence of conserved regions within the disintegrin domains of MDC proteins (25Weskamp G. Blobel C.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2748-2751Crossref PubMed Scopus (75) Google Scholar). A 165–171-bp product was obtained after the secondary PCR (Fig. 1 a). The PCR products were subcloned and the nucleotide sequences determined. Identified among the PCR subclones were sequences encoding the disintegrin domains of human MDC-9 (6Yagami-Hiromasa T. Sato T. Kurisaki T. Kamijo K. Nabeshima Y.-i. Fujisawa-Sehara A. Nature. 1995; 377: 652-656Crossref PubMed Scopus (439) Google Scholar, 34Weskamp G. Kratzchmar J. Reid M.S. Blobel C.P. J. Cell Biol. 1996; 132: 717-726Crossref PubMed Scopus (185) Google Scholar) and MDC-20 (35Hooft van Huijsduijnen R. Gene ( Amst.). 1998; 206: 273-282Crossref PubMed Scopus (63) Google Scholar) (Fig.1 b). However, 8 of the 10 inserts examined possessed an open reading frame encoding a unique polypeptide with significant homology to many of the cellular and snake venom disintegrins (Fig.1 b). Data base searches using GenBank BLAST (33Madden T.L. Tatusov R.L. Zhang J. Methods Enzymol. 1996; 266: 131-141Crossref PubMed Google Scholar) indicated that this novel disintegrin domain was greater than 60% identical to the disintegrin domains of human sperm maturation-related glycoprotein GP-83 and the macaque epididymal apical protein I (GenBank accession nos. AF090327 and X66139, respectively). These results suggest that a novel MDC family member, which we have designated MDC-L (ADAM 23), may be expressed within the human lymph node. Using the isolated cDNA encoding the putative MDC-L disintegrin domain as a probe, a human lymph node cDNA library (6 × 105 plaques) was screened and 29 positive phage were isolated. The cDNA from eight phage that contained inserts larger than 1 kb were subcloned and the nucleotide sequence determined. None of these overlapping partial cDNAs contained the 5′ end of the MDC-L cDNA. Therefore, the missing MDC-L cDNA was acquired by 5′-RACE reactions using human lymph node cDNA. The cDNA clones obtained resulted in the reconstruction of two distinct full-length cDNAs with identical 5′ nucleotide sequences through bp 1608; however, the two cDNAs diverged beyond this point (Fig. 2). Neither cDNA sequence was found in data base searches using GenBank BLAST. The 2,786-bp cDNA form contained an open reading frame encoding a polypeptide with the typical domain structure of other MDC family members, including a signal peptide, as well as pro, metalloprotease, disintegrin, cysteine-rich, EGF, and transmembrane domains (1Blobel C.P. Cell. 1997; 90: 589-592Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar, 25Weskamp G. Blobel C.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2748-2751Crossref PubMed Scopus (75) Google Scholar, 36Wolfsberg T.G. Straight P.D. Gerna R.L. Huovila A.-P.J. Primakoff P. Myles D.G. White J.M. Dev. Biol. 1995; 169: 378-383Crossref PubMed Scopus (360) Google Scholar, 37Wolfsberg T.G. Primakoff P. Myles D.G. White J.M. J. Cell Biol. 1995; 131: 275-278Crossref PubMed Scopus (443) Google Scholar) (Fig. 2). We have designated this putative transmembrane protein MDC-Lm (Fig. 3). The 2,087-bp cDNA form contains an open reading frame encoding a protein with a signal peptide, pro, metalloprotease, and disintegrin domains identical to the deduced MDC-Lm protein; however, the cysteine-rich domain differed in sequence and contained a stop codon midway through (Fig. 2).The putative secreted form of this protein has been designated MDC-Ls (Fig. 3). Both MDC-L cDNA forms contain consensus Kozak (38Kozak M. Nucleic Acids Res. 1984; 12: 857-872Crossref PubMed Scopus (2383) Google Scholar) and polyadenylation signal sequences (39Fitzgerald M. Shenk T. Cell. 1981; 24: 251-260Abstract Full Text PDF PubMed Scopus (448) Google Scholar), suggesting that these mRNAs are synthesized and translated (Fig.2).Figure 3Two forms of MDC-L. Comparison of the domain structures of MDC-Lm and MDC-Ls. The signal sequence (black), prodomain (white), metalloprotease (hatched), disintegrin domain (diagonal stripes), cysteine-rich domain (dots), EGF domain (horizontal stripes), transmembrane domain (diamonds), and cytoplasmic domain (vertical stripes) are depicted. Also shown are the putative zinc binding site (Zn) and integrin recognition site (AKDE).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Examination of the deduced MDC-L amino acid sequences revealed that the metalloprotease domain has the sequenceH339EMGHNFGMFHD350and C361VMDK365, which fits the consensus sequences for zinc binding, catalytic activity, and the structurally important Met turn motif (3Stocker W. Grams F. Baumann U. Reinemer P. Gomis-Ruth F.-X. McKay D.B. Bode W. Protein Sci. 1995; 4: 823-840Crossref PubMed Scopus (638) Google Scholar). Molecular modeling demonstrated that the histidines required for zinc ion coordination, catalytic glutamic acid, and Met turn could all be placed correctly within the tertiary structure (data not shown). The prodomain also possessed a “cysteine switch” pattern,S167TCGM171, typically found in MMPs (40Massova I. Kotra L.P. Fridman R. Mobashery S. FASEB J. 1998; 12: 1075-1095Crossref PubMed Scopus (704) Google Scholar). The sequence K195DRK198exists at the predicted boundary between the prodomain and the metalloprotease domain. This sequence does not fit with the furin-like enzyme cleavage site identified in some MDC and MMP family members (40Massova I. Kotra L.P. Fridman R. Mobashery S. FASEB J. 1998; 12: 1075-1095Crossref PubMed Scopus (704) Google Scholar). The disintegrin domain has the sequence K469DEC472 within the putative integrin recognition loop (2Wolfsberg T.G. White J.M. Dev. Biol. 1996; 180: 389-401Crossref PubMed Scopus (217) Google Scholar) (Fig. 2). Additionally, the deduced MDC-Lm protein has six potential N-linked glycosylation sites, while the MDC-Ls form has three potential N-linked glycosylation sites" @default.
• W2000417926 created "2016-06-24" @default.
• W2000417926 creator A5004941896 @default.
• W2000417926 creator A5014660411 @default.
• W2000417926 creator A5014761031 @default.
• W2000417926 creator A5029617371 @default.
• W2000417926 creator A5066917698 @default.
• W2000417926 date "1999-10-01" @default.
• W2000417926 modified "2023-10-03" @default.
• W2000417926 title "MDC-L, a Novel Metalloprotease Disintegrin Cysteine-rich Protein Family Member Expressed by Human Lymphocytes" @default.
• W2000417926 cites W117181554 @default.
• W2000417926 cites W1480018284 @default.
• W2000417926 cites W1489600631 @default.
• W2000417926 cites W1494182669 @default.
• W2000417926 cites W1560567906 @default.
• W2000417926 cites W1669956823 @default.
• W2000417926 cites W1775873926 @default.
• W2000417926 cites W1782613870 @default.
• W2000417926 cites W1935587632 @default.
• W2000417926 cites W1964849541 @default.
• W2000417926 cites W1968429206 @default.
• W2000417926 cites W1968574939 @default.
• W2000417926 cites W1983995459 @default.
• W2000417926 cites W1988848379 @default.
• W2000417926 cites W1989228411 @default.
• W2000417926 cites W1991063206 @default.
• W2000417926 cites W1996980134 @default.
• W2000417926 cites W2000639720 @default.
• W2000417926 cites W2001986036 @default.
• W2000417926 cites W2009105413 @default.
• W2000417926 cites W2015642465 @default.
• W2000417926 cites W2015764953 @default.
• W2000417926 cites W2023100000 @default.
• W2000417926 cites W2036842448 @default.
• W2000417926 cites W2050877576 @default.
• W2000417926 cites W2057365364 @default.
• W2000417926 cites W2067152527 @default.
• W2000417926 cites W2073943104 @default.
• W2000417926 cites W2074584250 @default.
• W2000417926 cites W2074881372 @default.
• W2000417926 cites W2080062007 @default.
• W2000417926 cites W2084825995 @default.
• W2000417926 cites W2087094729 @default.
• W2000417926 cites W2096589296 @default.
• W2000417926 cites W2100837269 @default.
• W2000417926 cites W2109425462 @default.
• W2000417926 cites W2119445810 @default.
• W2000417926 cites W2126514623 @default.
• W2000417926 cites W2133901597 @default.
• W2000417926 cites W2137583334 @default.
• W2000417926 cites W2143419254 @default.
• W2000417926 cites W2159347951 @default.
• W2000417926 cites W4313341423 @default.
• W2000417926 doi "https://doi.org/10.1074/jbc.274.41.29251" @default.
• W2000417926 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10506182" @default.
• W2000417926 hasPublicationYear "1999" @default.
• W2000417926 type Work @default.
• W2000417926 sameAs 2000417926 @default.
• W2000417926 citedByCount "66" @default.
• W2000417926 countsByYear W20004179262012 @default.
• W2000417926 countsByYear W20004179262013 @default.
• W2000417926 countsByYear W20004179262014 @default.
• W2000417926 countsByYear W20004179262015 @default.
• W2000417926 countsByYear W20004179262016 @default.
• W2000417926 countsByYear W20004179262017 @default.
• W2000417926 countsByYear W20004179262018 @default.
• W2000417926 countsByYear W20004179262019 @default.
• W2000417926 countsByYear W20004179262020 @default.
• W2000417926 countsByYear W20004179262021 @default.
• W2000417926 countsByYear W20004179262022 @default.
• W2000417926 countsByYear W20004179262023 @default.
• W2000417926 crossrefType "journal-article" @default.
• W2000417926 hasAuthorship W2000417926A5004941896 @default.
• W2000417926 hasAuthorship W2000417926A5014660411 @default.
• W2000417926 hasAuthorship W2000417926A5014761031 @default.
• W2000417926 hasAuthorship W2000417926A5029617371 @default.
• W2000417926 hasAuthorship W2000417926A5066917698 @default.
• W2000417926 hasBestOaLocation W20004179261 @default.
• W2000417926 hasConcept C109523444 @default.
• W2000417926 hasConcept C181199279 @default.
• W2000417926 hasConcept C185592680 @default.
• W2000417926 hasConcept C2778259572 @default.
• W2000417926 hasConcept C2779201268 @default.
• W2000417926 hasConcept C55493867 @default.
• W2000417926 hasConcept C55728118 @default.
• W2000417926 hasConcept C86803240 @default.
• W2000417926 hasConcept C95444343 @default.
• W2000417926 hasConceptScore W2000417926C109523444 @default.
• W2000417926 hasConceptScore W2000417926C181199279 @default.
• W2000417926 hasConceptScore W2000417926C185592680 @default.
• W2000417926 hasConceptScore W2000417926C2778259572 @default.
• W2000417926 hasConceptScore W2000417926C2779201268 @default.
• W2000417926 hasConceptScore W2000417926C55493867 @default.
• W2000417926 hasConceptScore W2000417926C55728118 @default.
• W2000417926 hasConceptScore W2000417926C86803240 @default.
• W2000417926 hasConceptScore W2000417926C95444343 @default.
• W2000417926 hasIssue "41" @default.
• W2000417926 hasLocation W20004179261 @default.

• next