FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000418034> ?p ?o ?g. }

• W2000418034 endingPage "16236" @default.
• W2000418034 startingPage "16230" @default.
• W2000418034 abstract "The cytoplasmic domain of cadherins and the associated catenins link the cytoskeleton with signal transduction pathways. To study the signaling function of non-junctional VE-cadherin, which can form during the loss VE-cadherin homotypic adhesion, wild type VE-cadherin or VE-cadherin cytoplasmic domain (ΔEXD) was expressed in sub-confluent endothelial cells. We observed that Cdc42 was activated in transfected cells and that these cells also developed Cdc42-dependent >70-μm-long plasma membrane protrusions. The formation of these structures required actin polymerization, and they developed specifically in endothelial cells as compared with epithelial cells. Expression of the VE-cadherin cytoplasmic domain lacking the β-catenin binding site also induced Cdc42 activation; thus, its activation cannot be ascribed to β-catenin binding. However, these cells were not able to form the protrusions. These results suggest that the cytoplasmic domain of non-junctional VE-cadherin can serve as a scaffold involved in Cdc42 activation at the endothelial plasma membrane. β-Catenin and the associated α-catenin may serve as support sites for actin polymerization, leading to formation of long plasma membrane protrusions. Thus, non-junctional VE-cadherin actively participates in inside-out signaling at the plasma membrane, leading to the development of endothelial membrane protrusions. The cytoplasmic domain of cadherins and the associated catenins link the cytoskeleton with signal transduction pathways. To study the signaling function of non-junctional VE-cadherin, which can form during the loss VE-cadherin homotypic adhesion, wild type VE-cadherin or VE-cadherin cytoplasmic domain (ΔEXD) was expressed in sub-confluent endothelial cells. We observed that Cdc42 was activated in transfected cells and that these cells also developed Cdc42-dependent >70-μm-long plasma membrane protrusions. The formation of these structures required actin polymerization, and they developed specifically in endothelial cells as compared with epithelial cells. Expression of the VE-cadherin cytoplasmic domain lacking the β-catenin binding site also induced Cdc42 activation; thus, its activation cannot be ascribed to β-catenin binding. However, these cells were not able to form the protrusions. These results suggest that the cytoplasmic domain of non-junctional VE-cadherin can serve as a scaffold involved in Cdc42 activation at the endothelial plasma membrane. β-Catenin and the associated α-catenin may serve as support sites for actin polymerization, leading to formation of long plasma membrane protrusions. Thus, non-junctional VE-cadherin actively participates in inside-out signaling at the plasma membrane, leading to the development of endothelial membrane protrusions. human microvascular endothelial cell wild type glutathioneS-transferase Cadherin molecules are membrane receptors involved in cell-cell adhesion (1Tepass U. Truong K. Godt D. Ikura M. Peifer M. Nat. Rev. Mol. Cell Biol. 2000; 1: 91-100Crossref PubMed Scopus (398) Google Scholar, 2Takeichi M. Curr. Opin. Cell Biol. 1995; 7: 619-627Crossref PubMed Scopus (1262) Google Scholar). They form a large family of proteins with tissue specificity that associates in a homophilic manner. They are indispensable in tissue formation during development, and in addition to adhesion, they serve morphogenetic functions (3Riethmacher D. Brinkmann V. Birchmeier C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 855-859Crossref PubMed Scopus (407) Google Scholar, 4Radice G.L. Rayburn H. Matsunami H. Knudsen K.A. Takeichi M. Hynes R.O. Dev. Biol. 1997; 181: 64-78Crossref PubMed Scopus (617) Google Scholar, 5Radice G.L. Ferreira-Cornwell M.C. Robinson S.D. Rayburn H. Chodosh L.A. Takeichi M. Hynes R.O. J. Cell Biol. 1997; 139: 1025-1032Crossref PubMed Scopus (212) Google Scholar, 6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar). Classical cadherins are anchored to actin cytoskeleton by α-catenin, which binds to β-catenin (7Gumbiner B.M. J. Cell Biol. 2000; 148: 399-404Crossref PubMed Scopus (690) Google Scholar). Catenins have multiple functions in signal transduction and transcription regulation (8Ben-Ze'ev A. Ann. N. Y. Acad. Sci. 1999; 886: 37-47Crossref PubMed Scopus (30) Google Scholar) and, thus, they are directly involved in the transduction of proliferation signals (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar, 9Hoschuetzky H. Aberle H. Kemler R. J. Cell Biol. 1994; 127: 1375-1380Crossref PubMed Scopus (673) Google Scholar,10Pece S. Chiariello M. Murga C. Gutkind J.S. J. Biol. Chem. 1999; 274: 19347-19351Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). tk;2Endothelium forms a semi-permeable barrier that regulates the flux of liquid and solutes (11Dudek S.M. Garcia J.G. J. Appl. Physiol. 2001; 91: 1487-1500Crossref PubMed Scopus (843) Google Scholar, 12Dejana E. Lampugnani M.G. Martinez-Estrada O. Bazzoni G. Int. J. Dev. Biol. 2000; 44: 743-748PubMed Google Scholar) as well as leukocyte transmigration from the microvasculature to sites of injury and infection (13Allport J.R. Muller W.A. Luscinskas F.W. J. Cell Biol. 2000; 148: 203-216Crossref PubMed Scopus (165) Google Scholar, 14Del Maschio A. Zanetti A. Corada M. Rival Y. Ruco L. Lampugnani M.G. Dejana E. J. Cell Biol. 1996; 135: 497-510Crossref PubMed Scopus (280) Google Scholar, 15Gotsch U. Borges E. Bosse R. Boggemeyer E. Simon M. Mossmann H. Vestweber D. J. Cell Sci. 1997; 110: 583-588Crossref PubMed Google Scholar). Adherens junctions formed between endothelial cells contain VE-cadherin, which is specifically expressed in the endothelium (16Navarro P. Ruco L. Dejana E. J. Cell Biol. 1998; 140: 1475-1484Crossref PubMed Scopus (246) Google Scholar). Direct involvement of VE-cadherin to endothelial barrier function was demonstrated by VE-cadherin blocking antibodies in cell-culture and mouse models (17Corada M. Liao F. Lindgren M. Lampugnani M.G. Breviario F. Frank R. Muller W.A. Hicklin D.J. Bohlen P. Dejana E. Blood. 2001; 97: 1679-1684Crossref PubMed Scopus (261) Google Scholar). In a different situation, VE-cadherin/catenins reorganize during polymorphonuclear or monocyte transmigration through the endothelial monolayer (18Luscinskas F.W. Ma S. Nusrat A. Parkos C.A. Shaw S.K. Immunol. Rev. 2002; 186: 57-67Crossref PubMed Scopus (63) Google Scholar). VE-cadherin targeting revealed that in addition to its role in cell-cell adhesion, it is required for transduction of the vascular endothelial growth factor proliferation pathway through β-catenin association to phosphatidylinositol 3-kinase, which is downstream of vascular endothelial growth factor receptor 2. Ablation of VE-cadherin interferes with endothelial proliferation and causes apoptosis (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar). However, it is remarkable that the VE-cadherin function was not compensated despite the presence of N-cadherin, which also associates with β-catenin and is expressed in endothelial cells. Thus, it is possible that the cytoplasmic domain of VE-cadherin serves functions that are not completely understood. Although VE-cadherin is classified as a “classical” cadherin in respect to its primary structure, the cytoplasmic tail is unique among the members of this subgroup (19Nollet F. Kools P. van Roy F. J. Mol. Biol. 2000; 299: 551-572Crossref PubMed Scopus (591) Google Scholar). To study the role of VE-cadherin in signaling mechanisms in endothelial cells, wild type VE-cadherin or the cytoplasmic domain of VE-cadherin mutant was expressed in sub-confluent endothelial cells. The cytoplasmic domain of cadherins has been characterized in a variety of studies as the “dominant negative mutant” for cell-cell adhesion, since its expression blocked cell adhesion in cells of epithelial, neuronal, muscle, and endothelial origin (20Kintner C. Cell. 1992; 69: 225-236Abstract Full Text PDF PubMed Scopus (332) Google Scholar, 21Dufour S. Saint-Jeannet J.P. Broders F. Wedlich D. Thiery J.P. J. Cell Biol. 1994; 127: 521-535Crossref PubMed Scopus (61) Google Scholar, 22Fujimori T. Takeichi M. Mol. Biol. Cell. 1993; 4: 37-47Crossref PubMed Scopus (181) Google Scholar, 23Zhu A.J. Watt F.M. J. Cell Sci. 1996; 109: 3013-3023Crossref PubMed Google Scholar, 24Nieman M.T. Kim J.B. Johnson K.R. Wheelock M.J. J. Cell Sci. 1999; 112: 1621-1632Crossref PubMed Google Scholar). 1P. Kouklis and A. B. Malik, unpublished data. In endothelial cells a chimera between interleukin 2 receptor extracellular domain and VE-cadherin cytoplasmic domain interfered with proliferation by titrating-out β-catenin from its downstream effectors, and its stable expression in tissue culture cells led to down-regulation of endogenous VE-cadherin and defects in proliferation (25Venkiteswaran K. Xiao K. Summers S. Calkins C.C. Vincent P.A. Pumiglia K. Kowalczyk A.P. Am. J. Physiol. Cell Physiol. 2002; 283: 811-821Crossref PubMed Scopus (105) Google Scholar). In the present study, we observed that non-junctional VE-cadherin induced through its cytoplasmic domain the activation of Cdc42 and the formation of >70-μm-long plasma membrane protrusions. Cdc42 activation was shown to be necessary for the formation of these protrusions. We further demonstrated that Cdc42 activation was not dependent upon β-catenin association to VE-cadherin. Two critical factors were required for the formation of the protrusions, (a) membrane localization of VE-cadherin and (b) association of β-catenin with its cytoplasmic domain. Furthermore, the formation of membrane protrusions was endothelial-specific since it did not occur in epithelial cells. These results suggest a novel role of VE-cadherin cytoplasmic domain in the formation of membrane protrusions, which may be involved in the restoration of endothelial junctional barrier function after the loss of homotypic VE-cadherin adhesion. Human microvascular endothelial cells (HMECs)2 were gifts from Dr. E. W. Ades (26Ades E.W. Candal F.J. Swerlick R.A. George V.G. Summers S. Bosse D.C. Lawley T.J. J. Invest. Dermatol. 1992; 99: 683-690Abstract Full Text PDF PubMed Google Scholar) (NIAID, National Institutes of Health, Atlanta, GA). HMECs were cultured in MCDB 131 (Invitrogen) supplemented with 5% fetal bovine serum (Hyclone Laboratories, Logan, UT). Primary human pulmonary arterial endothelial cells were cultured in EBM 2 (endothelial basal medium) complete medium (BioWhittaker, Walkerville, MD). Bovine lung microvascular endothelial cells, purchased were from VEC Technologies (Renssalaer, NY), were grown in MCDB 131 medium supplemented with 5% fetal bovine serum and endothelial cell growth supplement (Sigma-Aldrich). Alveolar epithelial cells A549 were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum. A monoclonal antibody against VE-cadherin was from Chemicon (Temecula, CA), and a goat polyclonal antibody was from Research Diagnostics (Flanders, NJ). Rabbit polyclonal anti-FLAG and anti-Myc-tag monoclonal were from Zymed Laboratories Inc. (San Franscisco, CA). Mouse monoclonal anti-FLAG (M2) was from Sigma-Aldrich. Monoclonal antibodies for β-catenin, p120, and Rac were from Transduction Laboratories (Lexington, KY). Rabbit anti-Cdc42 was from Santa Cruz (Santa Cruz, CA). Horseradish peroxidase-conjugated secondary antibodies were from Jackson Laboratories (West Grove, PA). For immunofluorescence experiments, we used either fluorescein isothiocyanate and Texas Red (Jackson Laboratories) or Alexa 488 and Alexa 568 (Molecular Probes, Eugene, OR)-conjugated antibodies. Actin was visualized with Alexa 488-conjugated phalloidin (Molecular Probes). Latrunculin A was purchased from Molecular Probes. VE-cadherin-ΔEXD mutants with and without FLAG tag (DYKDDDDK) were constructed by PCR (plasmid pcDNA3-VEC-ΔEXD). The octapeptide sequence encoding for the FLAG-tag sequence replaced the VE-cadherin extracellular domain by PCR. The human wt VE-cadherin cDNA inserted in the EcoRI site of the pcDNA3 vector was used (plasmid pcDNA3-VEC) as the template. We used either primer d-FL containing the FLAG encoding sequence as sense primers (GAGTCGCAAGAATGCCGACTACAAGGACGACGATGACAAGACCTTCTGCGAGGATATGG) or primer D that lacks the FLAG encoding sequence (GTGAGTCGCAAGAATGCCACCTTCTGCGAGGATATGG). Antisense primer 2002 (ACCTTCTGCGAGGATATGG) was used in both cases. PCR products were digested with BsmI/BstEII, and these fragments were inserted in the BsmI (partial)/BstEII site of pcDNA3-VEC. The mutant version with FLAG (termed ΔEXD) was used generally except where indicated ΔEXD without FLAG. To construct VE-cadherin-ΔEXD-Δβcat mutant, the plasmid pcDNA3- VEC-ΔEXD was digested withHindIII and Bpu10I (partial digestion and Klenow-blunt). This fragment was inserted in theHindIII/ EcoRV site of pcDNA3 (plasmid pcDNA3-VEC-ΔEXD-Δβcat). To make the VE-cadherin-ΔEXD-Δp120 construct, residues 645–654 were deleted by PCR. We used as the sense primer TGGTCACCATGGACACCACCAGCTACGATG. To make the VE-cadherin-ΔEXD-G/A construct we substituted residues GGG (649–651) with AAA by PCR using as sense primer TGGTCACCTACGACGAGGAGGCAGCAGCAGAGATG. For both PCR reactions, we used as the antisense primer TACAGCTCAGCCAGCATCTTAAAC. PCR products containing the deletion or substitution were cloned in the TA cloning vector (Invitrogen) and digested with BstEII/BlpI fragments to replace the wild type BstEII/BlpI sequence from the VE-cadherin-ΔEXD construct. All PCR products were verified by sequencing. Endothelial cells were transfected by electroporation or liposome-mediated DNA transfer (Qiagen, Valencia, CA). For electroporation, 106 cells were seeded in a 100-mm2 dish the day before transfection. After 20–24 h, cells were trypsinized and re-suspended in 300 μl of medium. Plasmid DNA (10 μg) mixed with 14 μg of salmon sperm DNA was added, and cells were electroporated in 0.4-cm cuvettes (Gene Pulser II, Bio-Rad). The conditions were set at 180-mV voltage and 950-millifarad capacitance. To obtain confluent monolayers, 50 μl of transfected cells were applied directly on a gelatinized coverslip and left for 1 h to adhere. Medium was added, and cells were fixed after 48 h. We typically observed 30% transfection efficiency with liposomes and 40% efficiency with electroporation. Cells were grown on 1% gelatin (Sigma-Aldrich)-coated coverslips. They were fixed and stained as described previously (Kouklis et al. (29Kouklis P.D. Hutton E. Fuchs E. J. Cell Biol. 1994; 127: 1049-1060Crossref PubMed Scopus (243) Google Scholar)). The stained cells were visualized either with Nikon Diaphot 200 or Zeiss Pascal confocal microscopes. Protein concentrations of cell extracts were quantified using the BCA protein assay from Pierce. Endothelial cells were washed, scraped with phosphate-buffered saline, and pelleted in 3 × 103 rpm. Total cell extracts were made using immunoprecipitation buffer containing 20 mm Tris-Cl, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 mmEGTA, 1% Triton X-100, and 0.5% Nonidet P-40 supplemented with Complete protease inhibitor mixture (Roche Molecular Biochemicals). Cells were incubated for 10 min in 4 °C in a shaker and centrifuged in 14 × 103 rpm for 5 min to remove insoluble material. The supernatant was used for immunoprecipitation and Western-blotting experiments (thereafter called “extract”). Extracts were pre-cleared with 2 μg of mouse IgG (Jackson Laboratories) and incubated with 2–3 μg of the first antibody for 2 h in 4 °C before the addition of 20 μl of protein A/G-agarose (incubation for 1 h in 4 °C). Immunoprecipitates were subjected to SDS-PAGE and Western blot analysis. Nitrocellulose membranes were blocked with TBST buffer (20 mm Tris, pH 7.4, 150 mm NaCl, 0.1% Tween 20) containing 1% gelatin (from cold water skin fish, Sigma-Aldrich), incubated for 1 h with primary antibodies, washed with TBST, and incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies. For anti-Cdc42 antibodies, membranes were blocked with TBST containing 5% nonfat milk and incubated at room temperature for 3 h. The horseradish peroxidase signal was developed using Super Signal (Pierce). BL21 bacterial cultures (20 ml) transformed with GST-PBD expression construct (a gift from Dr. G. Bokoch, Scripps) were induced with 2 mmisopropyl-1-thio-β-d-galactopyranoside for 3 h, lysed with 0.2 mg/ml lysozyme, and extracted in 1% Triton X-100, phosphate-buffered saline with protease inhibitors (Complete, Roche Molecular Biochemicals). The supernatant was incubated for 45 min at room temperature with 120 μl of glutathione-Sepharose beads (Amersham Biosciences). The beads were washed 3× with phosphate-buffered saline and 2× with MLB buffer (25 mm HEPES, pH 7.5, 250 mm NaCl, 5% IGEPAL CA-630, 10 mmMgCl2, 1 mm EDTA, 2% glycerol, and protease inhibitors). GST-bound beads (20 μl) were incubated with HMEC extracts (200–300 μg of total protein) in 400 μl of MLB buffer O/N at 4 °C. The beads were washed thoroughly with MLB buffer and boiled in 50 μl of SDS-PAGE loading buffer for subsequent Western blot analysis. Human VE-cadherin cDNA (a gift of Dr. E. Dejana, Mario Negri Institute, Milan, Italy) was used to generate the VE-cadherin extracellular domain deletion mutant (ΔEXD) (Fig. 1 A). Sequences encoding the signal peptide (SP), pre-peptide (PP), and the transmembrane domain (TM) were not deleted so that the mutant could be inserted in membrane. We also constructed mutants identical to ΔEXD with the exception that the residues involved in the binding of β-catenin (ΔEXD-Δβcat) or p120 (ΔEXD-G/A and ΔEXD-Δp120) were deleted (Fig. 1 A). In ΔEXD-Δβcat, residues 743–784 were deleted including SLSS, a highly conserved motif in all cadherin molecules involved in association of β-catenin with cadherins (27Lickert H. Bauer A. Kemler R. Stappert J. J. Biol. Chem. 2000; 275: 5090-5095Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar) (Fig. 1 A). Substitution of GGG residues to AAA (AA 649–651) in ΔEXD-G/A and deletion of residues 645–654 in ΔEXD-Δp120 at the juxtamembrane domain removed the p120 binding site (28Thoreson M.A. Anastasiadis P.Z. Daniel J.M. Ireton R.C. Wheelock M.J. Johnson K.R. Hummingbird D.K. Reynolds A.B. J. Cell Biol. 2000; 148: 189-202Crossref PubMed Scopus (389) Google Scholar) (Fig. 1 A). To determine expression and correct size of the mutants, HMEC were transfected with ΔEXD, ΔEXD-G/A, ΔEXD-Δp120, or ΔEXD-Δβcat, and Triton X-100 extracts from transfected cells were analyzed by Western blotting with anti-FLAG monoclonal antibody. This antibody reacted specifically with 34–36-kDa bands in the ΔEXD-, ΔEXD-Δp120-, and ΔEXD-G/A-transfected cells and a 29-kDa band in ΔEXD-Δβcat-transfected cells (Fig.1 B). No reaction was detected in mock-transfected control cells (Fig. 1 B). HMEC were transiently transfected with wt VE-cadherin, ΔEXD, or ΔEXD-Δβcat mutants. Cells were harvested 24 h after transfection, and extracts were tested for Cdc42 activation using the GST-PBD pull-down assay. HMEC cell extracts were incubated with GST-PBD coupled to glutathione-Sepharose beads. Beads were washed and analyzed by Western blotting for Cdc42 binding. We observed that active Cdc42 was bound to PBD in extracts from HMECs transfected with wt VE-cadherin, -ΔEXD, or -ΔEXD-Δβcat (Fig.2). Cdc42 activation remained at the basal level in mock-transfected cells (Fig. 2, GST-PBD). In control experiments, GST beads did not associate with Cdc42 under the same conditions (Fig. 2, GST). At 18–24 h post-transfection of HMECs, the expressed proteins localized at the plasma membrane and the cytoplasm in vesicular structures. We observed that an unusually high percentage of transfected endothelial cells developed very long extensions with a striking cell shape change (Fig. 3 A). These extensions typically showed branching patterns. All cells from randomly selected fields (a total of 50–100 cells/experiment) were photographed to measure protrusion lengths. Cells with extensions greater than 70 μm were scored as positive. Long extensions were evident in ∼60% of cells transfected with ΔEXD and ∼30% of cells transfected with wild type VE-cadherin (Fig. 3 B). As controls, we transfected HMEC with the cytoplasmic domain of another endothelial adherens junction protein, desmoplakin, known to associate with intermediate filaments (29Kouklis P.D. Hutton E. Fuchs E. J. Cell Biol. 1994; 127: 1049-1060Crossref PubMed Scopus (243) Google Scholar); only 9% of these cells showed protrusions. Moreover, only 4% of mock-transfected HMEC showed such protrusions (data not shown). To rule out the possibility that cell shape changes were the result of a transfection artifact, we determined the earliest point that the protrusions were seen in relation to ΔEXD expression. Protrusions were observed as early as 3 h post-transfection at a time when expression of transfected ΔEXD was barely detectable (Fig.3 A). Mutant molecules localized at the plasma membrane, and protrusions reached maximum length within 6 h (as in Fig.7 C). We also expressed ΔEXD in HMEC using retrovirus infection with identical results (data not shown), indicating the development of the protrusion was not secondary to the method used.Figure 7Plasma membrane localization of cadherin cytoplasmic domain but not p120 association is required for membrane protrusion formation. A, HMEC were transfected with ΔEXD-Δβcat, ΔEXD, ΔEXD-G/A, or ΔEXD-Δp120 (lanes Δβcat, ΔEXD,G/A, and Δp120). Cells were lysed, and the mutants were immunoprecipitated (ip) with M2 monoclonal antibody. Immunoprecipitates were subjected to Western blot analysis using anti-p120 antibody. Note that ΔEXD-G/A and ΔEXD-Δp120 did not associate with p120. B, HMEC were transfected with ΔEXD, fixed 24 h post-transfection, and double-stained with anti-FLAG and anti-p120 antibodies. C, HMECs transfected with ΔEXD-G/A, fixed 6 h post-transfection, and double-stained with anti-FLAG and anti-p120 antibodies. ΔEXD-G/A induced protrusions similar to ΔEXD. Arrowheads indicate ΔEXD-G/A, and thearrow shows p120 localization at the membrane. D, HMECs transfected with ΔEXD-Δp120 fixed after 24 h and double-stained with anti-FLAG and anti-p120 antibodies. ΔEXD-Δp120 localized exclusively in the cytoplasm with no apparent cell shape changes in the transfected cells. All of the above experiments were repeated at least three times.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To extend these observations to other endothelial cells, we repeated the same transfection experiments in primary endothelial cells, human pulmonary arterial endothelial cells, and BMVEC (Fig. 3 A); in both cases, membrane extensions formed 24 h after transfection of wt VE-cadherin and -ΔEXD. Endothelial cells transfected with ΔEXD mutant were treated with the actin polymerization inhibitor, latrunculin A (30Spector I. Shochet N.R. Kashman Y. Groweiss A. Science. 1983; 219: 493-495Crossref PubMed Scopus (615) Google Scholar), and cells were fixed 24 h post-transfection. Latrunculin A in all cases prevented the formation of membrane protrusions (Fig. 3 A), indicating the requirement of actin polymerization in the response. We also transfected alveolar epithelial cells (A531, a type II alveolar epithelial cell line) with ΔEXD to study protrusion formation in non-endothelial cells. No cell shape change or membrane extensions were observed in these cells (Fig. 3 A), demonstrating the importance of cellular background in the mechanism of the response. In HMEC co-transfected with dominant-negative mutant N17Cdc42 and ΔEXD mutant we observed that co-expression of N17Cdc42 inhibited the formation of protrusions (Fig.4). We also co-transfected HMECs with dominant-negative mutants of Rac1 (N17Rac) or RhoA (N14RhoA) and the ΔEXD mutant. N17Rac co-expression resulted in shorter and thinner protrusions in contrast to the inhibition seen with Cdc42 dominant negative mutant (Fig. 4). N14RhoA co-expression had no effect on the ΔEXD-induced protrusion formation (Fig. 4). To quantify the degree of inhibition caused by co-expression of dominant negative mutants of Rho, Rac, and Cdc42 along with ΔEXD we measured protrusion lengths in a large number (90–120) of double-transfected cells (Fig. 5). Expression of N17Cdc42 blocked protrusion formation in 100% of double-transfected cells, whereas ∼56% of N19Rho-expressing cells developed protrusions, a percentage very similar to ΔEXD-alone transfected cells. N17Rac blocked protrusion formation to a certain degree but not entirely, i.e. ∼20% of N17Rac-expressing cells formed protrusions of >70 μm. In addition, a significant percentage of double-transfected cells (∼15%) formed slightly shorter protrusions (60–70 μm) in these cells. Expression of wt VE-cadherin and VE-cadherin cytoplasmic domain had profound effects on endothelial cell shape as shown above. Because the cadherin cytoplasmic domain associates with β- and p120-catenins, we investigated the possible roles of these interactions in cell shape change. We generated VE-cadherin cytoplasmic domain mutants ΔEXD-Δβcat lacking the binding site for β-catenin and ΔEXD-G/A and ΔEXD-Δp120 lacking the binding site for p120. wt VE-cadherin, ΔEXD, or ΔEXD-Δβcat were transfected in HMEC, and their association with β-catenin was determined by immunoprecipitation and Western blotting. We showed that β-catenin associated with VE-cadherin and -ΔEXD and did not associate with the ΔEXD-Δβcat mutant (Fig.6 A). Also, extracts from HMEC transfected with ΔEXD, ΔEXD-Δβcat, ΔEXD-G/A, or ΔEXD-Δp120 were immunoprecipitated with anti-FLAG monoclonal antibody, and p120 association with VE-cadherin mutants was determined by Western blot analysis. p120 associated specifically with ΔEXD and ΔEXD-Δβcat but not with either ΔEXD-G/A or ΔEXD-Δp120 mutants (Fig. 7 A). Double immunofluorescence showed that ΔEXD co-localized with endogenous β-catenin at the plasma membrane and cytoplasmic vesicular structures in transfected cells (Fig. 6 B). ΔEXD-transfected cells also appeared morphologically different from the ΔEXD-Δβcat-transfected cells. The latter formed random, spike-like projections over the entire cell membrane surface (similar to filopodia) that were clearly thinner than the membrane protrusions induced by the ΔEXD mutant (Fig. 6 C). Interestingly, the ΔEXD-Δβcat mutant did not block adherens junction formation (Fig.6 C, βcat; arrow). Because Cdc42 was activated in ΔEXD-Δβcat-transfected endothelial cells (Fig. 2), we compared cell shape changes induced by expression of ΔEXD-Δβcat and the activated mutant of Cdc42. Transfection of HMEC with the constitutively active Cdc42 mutant (V12Cdc42) induced a large number of filopodia (Fig. 6 D). Expression of ΔEXD-Δβcat and V12Cdc42 induced similar filopodia structures secondary to the activation of Cdc42. No striking cell shape changes were observed when ΔEXD-Δβcat was co-transfected with N17Cdc42 (Fig. 6 E), indicating that Cdc42 is involved in filopodia formation induced by ΔEXD-Δβcat. N17Cdc42 was also shown to co-localize with ΔEXD-Δβcat at distinct plasma membrane sites as shown by confocal microscopy (Fig. 6 E). Mutant ΔEXD-G/A did not associate with p120 (Fig. 7 A). To study the localization of ΔEXD-G/A with endogenous p120, cells were fixed at 6 h post-transfection when mutant expression level was low and examined by confocal microscopy. The mutant localized at membrane patches distinct from p120 and cytoplasmic vesicular structures similar to ΔEXD (Fig. 7, B and C). Importantly, at this time point, ΔEXD-G/A-transfected cells also developed long protrusions similar to those after expression of ΔEXD; thus, formation of these protrusions is independent of p120 binding to the VE-cadherin cytoplasmic domain. Quantification of the effect of ΔEXD-G/A expression in protrusion formation showed that ∼55% of ΔEXD-G/A-transfected cells developed protrusions (data not shown). We generated an additional deletion mutant (ΔEXD-Δp120) of VE-cadherin cytoplasmic domain lacking the entire domain for p120 binding (residues 645–654) (28Thoreson M.A. Anastasiadis P.Z. Daniel J.M. Ireton R.C. Wheelock M.J. Johnson K.R. Hummingbird D.K. Reynolds A.B. J. Cell Biol. 2000; 148: 189-202Crossref PubMed Scopus (389) Google Scholar). We observed that ΔEXD-Δp120 localized exclusively in the cytoplasm and that membrane protrusions did not develop in these cells (Fig. 7 D). This finding suggests the importance of membrane localization in the mechanism of protrusion formation. We expressed wt VE-cadherin or VE-cadherin cytoplasmic domain mutant in subconfluent endothelial cells. We showed that expression of either of these constructs induced Cdc42 activation and that the expressed cadherins localized at the plasma membrane. These findings suggest that the non-junctional VE-cadherin and especially its cytoplasmic domain was involved in Cdc42 activation. Rho GTPases have been implicated in formation of actin-driven membrane rearrangements (31Nobes C.D. Hall A. Cell. 1995; 81: 53-62Abstract Full Text PDF PubMed Scopus (3747) Google Scholar). Cdc42 in particular is considered as an important GTPase, signaling the formation of filopodia (32Kim S.H. Li Z. Sacks D.B. J. Biol. Chem. 2000; 275: 36999-37005Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 33Noren N.K. Niessen C.M. Gumbiner B.M. Burridge K. J. Biol. Chem. 2001; 276: 33305-33308Abstract Full Text Full Text PDF PubMed Scopus (356) Google Scholar). We showed that expression of wt VE-cadherin and VE-cadherin cytoplasmic domain induced the formation of membrane protrusions. Co-expression experiments using dominant negative mutants of Rho, Rac, or Cdc42 along with ΔEXD mutant demonstrated that formation of these protrusions was predominantly the result of Cdc42 activation. It is not clear how the cytoplasmic domain of VE-cadherin activates Cdc42. The guanine exchange factor Tiam1 is localized at the cell-cell junctions of epithelial cells and promotes invasiveness of T lymphoma cells across the epithelial barrier (34Hordijk P.L. ten Klooster J.P. van der Kammen R.A. Michiels F. Oomen L.C. Collard J.G. Science. 1997; 278: 1464-14666Crossref PubMed Scopus (393) Google Scholar). It is possible that a similar guanine exchange factor may be localized at the VE-cadherin cytoplasmic domain that enables activation of Cdc42 in close proximity to the plasma membrane. To rule out the possibility that formation of membrane protrusions induced by the VE-cadherin cytoplasmic domain is not restricted to a transformed endothelial cell line, we also studied two primary endothelial cells with similar results. Development of long membrane protrusions was clearly evident within 3 h after transfection of the ΔEXD mutant; that is, at a time when mutant expression was barely detected. Thus, it is unlikely that the protrusions were the result of massive overexpression of the transfected mutant. In a control experiment, the expression of desmoplakin, a vimentin binding protein (35Stappenbeck T.S. Bornslaeger E.A. Corcoran C.M. Luu H.H. Virata M.L. Green K.J. J. Cell Biol. 1993; 123: 691-705Crossref PubMed Scopus (150) Google Scholar), did not affect endothelial cell morphology. In another control experiment expression of VE-cadherin cytoplasmic domain in type II alveolar epithelial cells (A531 cells) also failed to induce membrane protrusions, implying that the effect is endothelial cell-specific. The latter finding is consistent with observations in cultured epithelial cells that expression of E- or N-cadherin ΔEXD mutant failed to induce a cell shape change (23Zhu A.J. Watt F.M. J. Cell Sci. 1996; 109: 3013-3023Crossref PubMed Google Scholar, 36Hertig C.M. Eppenberger-Eberhardt M. Koch S. Eppenberger H.M. J. Cell Sci. 1996; 109: 1-10Crossref PubMed Google Scholar). It is well established that cadherin and associated catenins mediate outside-in signaling (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar, 9Hoschuetzky H. Aberle H. Kemler R. J. Cell Biol. 1994; 127: 1375-1380Crossref PubMed Scopus (673) Google Scholar,10Pece S. Chiariello M. Murga C. Gutkind J.S. J. Biol. Chem. 1999; 274: 19347-19351Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). In the present study, we show that non-junctional VE-cadherin induces signaling initiated inside endothelial cells, which in turn induces a cell shape change involving formation of membrane protrusion that may restore junctional integrity after the loss of homotypic VE-cadherin adhesion. β- and p120-catenins associate directly with cadherins at well conserved cytoplasmic domains (37Lampugnani M.G. Corada M. Caveda L. Breviario F. Ayalon O. Geiger B. Dejana E. J. Cell Biol. 1995; 129: 203-217Crossref PubMed Scopus (497) Google Scholar, 38Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1152) Google Scholar). Because their association with VE-cadherin may be important in the formation of membrane protrusions, we studied their role by expressing the two VE-cadherin cytoplasmic domain mutants lacking either β-catenin or p120 binding sites. An extended domain of 100 residues in cadherin cytoplasmic domain was identified in mediating association with β-catenin (39Huber A.H. Weis W.I. Cell. 2001; 105: 391-402Abstract Full Text Full Text PDF PubMed Scopus (616) Google Scholar), but a short conserved motif, SLSS, is required for this association (27Lickert H. Bauer A. Kemler R. Stappert J. J. Biol. Chem. 2000; 275: 5090-5095Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 39Huber A.H. Weis W.I. Cell. 2001; 105: 391-402Abstract Full Text Full Text PDF PubMed Scopus (616) Google Scholar). Expression of a construct (ΔEXD-Δβcat) in which this motif was deleted abolished the binding of this mutant to β-catenin without affecting the p120 association; thus, it is likely that ΔEXD-Δβcat mutant was inserted in the membrane in its proper conformation. We showed that the expression of ΔEXD-Δβcat induced the activation of Cdc42 in endothelial cells, but interestingly, this mutant resulted in the formation of thin, needle-like structures resembling filopodia, similar to those induced by expression of the constitutively active Cdc42 mutant. Therefore, VE-cadherin lacking the β-catenin binding site is unable to induce formation of the characteristic membrane protrusions seen with the expression of cytoplasmic domain of VE-cadherin. It is known that β-catenin mediates the association of actin cytoskeleton with cadherin through the actin binding proteins α-catenin (38Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1152) Google Scholar), α-actinin, and vinculin (40Weiss E.E. Kroemker M. Rudiger A.H. Jockusch B.M. Rudiger M. J. Cell Biol. 1998; 141: 755-764Crossref PubMed Scopus (216) Google Scholar); thus, β-catenin plays a crucial role as a linker regulating interaction of cadherin with actin. The differences in cell shape change induced by ΔEXD versusΔEXD-Δβcat can be explained by the absence of β-catenin/α-catenin association in the latter case. Thus actin may fail to bind to VE-cadherin-catenin complex in an appropriate manner to form the characteristic long membrane protrusions. Because it is possible that p120 may also contribute to the formation of membrane protrusions, we expressed a VE-cadherin mutant that was unable to associate with p120. Substitution of GGG to AAA (residues 649–651) abolished p120 binding to VE-cadherin (mutant ΔEXD-G/A), consistent with studies using E-cadherin (28Thoreson M.A. Anastasiadis P.Z. Daniel J.M. Ireton R.C. Wheelock M.J. Johnson K.R. Hummingbird D.K. Reynolds A.B. J. Cell Biol. 2000; 148: 189-202Crossref PubMed Scopus (389) Google Scholar). Interestingly, the expression of ΔEXD-G/A mutant resulted in a similar phenotype as ΔEXD, indicating that the p120-VE-cadherin association is not essential for protrusion formation. In other studies we compared the results of the ΔEXD-G/A mutant with another mutant, ΔEXD-Δp120, lacking 10 residues at the p120 binding domain. This deletion mutant did not localize at the membrane, and it also failed to induce the cell shape change. Thus, these results suggest that sorting of VE-cadherin at the membrane is required for the formation of membrane protrusions. In previous studies, expression of p120 was shown to induce membrane protrusions in fibroblasts and epithelial cells (a “dendritic” or “branching” phenotype) (41Anastasiadis P.Z. Moon S.Y. Thoreson M.A. Mariner D.J. Crawford H.C. Zheng Y. Reynolds A.B. Nat. Cell Biol. 2000; 2: 637-644Crossref PubMed Scopus (380) Google Scholar, 42Noren N.K. Liu B.P. Burridge K. Kreft B. J. Cell Biol. 2000; 150: 567-580Crossref PubMed Scopus (470) Google Scholar). The expression of cytosolic p120 inhibited RhoA activity in both studies. Noren et al. (42Noren N.K. Liu B.P. Burridge K. Kreft B. J. Cell Biol. 2000; 150: 567-580Crossref PubMed Scopus (470) Google Scholar) show that p120 expression resulted in Rac1 and Cdc42 activation and that p120 co-precipitated with the guanine exchange factor vav2, suggesting a direct role of cytosolic p120 in Rac1 and Cdc42 activation. Anastasiadis et al. (41Anastasiadis P.Z. Moon S.Y. Thoreson M.A. Mariner D.J. Crawford H.C. Zheng Y. Reynolds A.B. Nat. Cell Biol. 2000; 2: 637-644Crossref PubMed Scopus (380) Google Scholar) propose that the branching phenotype could be the result of RhoA inhibition and the resultant loss of stress fibers and re-organization of ERM family proteins in the cortical cytoskeleton. Both studies suggest that p120-activated signaling was initiated in the cytoplasm. Our results in endothelial cells show that VE-cadherin is involved in Cdc42 activation at the plasma membrane, but they do not rule out a parallel regulation of GTPases in the cytoplasm induced by p120. In the present study, we provide evidence for the an important role of VE-cadherin in the formation of long protrusions in endothelial cells. Our data show that membrane protrusions form as a result of actin polymerization through Cdc42 activation and the anchorage of the newly synthesized actin filaments to the VE-cadherin cytoplasmic domain. Actin-binding proteins associated with VE-cadherin-β-catenin complex are necessary for the extension of actin cytoskeleton after Cdc42 activation. The dual role of VE-cadherin cytoplasmic domain in Cdc42 activation and formation of actin cytoskeleton extensions may be important in the reassembly of adherens junctions and restoration of endothelial barrier function upon the loss of adherens junctional integrity. We would like to thank X. P. Du for helpful discussions, E. Dejana for providing the human VE-cadherin cDNA, T. Kozasa and T. Voyno-Yasenetskaya for Rho, Rac, and Cdc42 dominant negative mutants, and G. Bokoch for GST-PBD." @default.
• W2000418034 created "2016-06-24" @default.
• W2000418034 creator A5011756238 @default.
• W2000418034 creator A5047201329 @default.
• W2000418034 creator A5070824605 @default.
• W2000418034 date "2003-05-01" @default.
• W2000418034 modified "2023-09-26" @default.
• W2000418034 title "VE-cadherin-induced Cdc42 Signaling Regulates Formation of Membrane Protrusions in Endothelial Cells" @default.
• W2000418034 cites W153332747 @default.
• W2000418034 cites W1575878259 @default.
• W2000418034 cites W1583843945 @default.
• W2000418034 cites W1915521129 @default.
• W2000418034 cites W1916344241 @default.
• W2000418034 cites W1973466009 @default.
• W2000418034 cites W1984653721 @default.
• W2000418034 cites W1986402843 @default.
• W2000418034 cites W1987558313 @default.
• W2000418034 cites W1987888289 @default.
• W2000418034 cites W1990557148 @default.
• W2000418034 cites W1999758837 @default.
• W2000418034 cites W2001413882 @default.
• W2000418034 cites W2006810952 @default.
• W2000418034 cites W2014843193 @default.
• W2000418034 cites W2027810531 @default.
• W2000418034 cites W2027826658 @default.
• W2000418034 cites W2032345748 @default.
• W2000418034 cites W2034825883 @default.
• W2000418034 cites W2036094375 @default.
• W2000418034 cites W2040916665 @default.
• W2000418034 cites W2055087999 @default.
• W2000418034 cites W2056318837 @default.
• W2000418034 cites W2061128706 @default.
• W2000418034 cites W2073885973 @default.
• W2000418034 cites W2074018262 @default.
• W2000418034 cites W2084457841 @default.
• W2000418034 cites W2103618365 @default.
• W2000418034 cites W2104635208 @default.
• W2000418034 cites W2109016302 @default.
• W2000418034 cites W2118613169 @default.
• W2000418034 cites W2122829982 @default.
• W2000418034 cites W2124499018 @default.
• W2000418034 cites W2145617194 @default.
• W2000418034 cites W2147176626 @default.
• W2000418034 cites W2152731523 @default.
• W2000418034 cites W2154865522 @default.
• W2000418034 cites W2163740123 @default.
• W2000418034 cites W2172210768 @default.
• W2000418034 cites W2189426703 @default.
• W2000418034 cites W2313177109 @default.
• W2000418034 doi "https://doi.org/10.1074/jbc.m212591200" @default.
• W2000418034 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12595527" @default.
• W2000418034 hasPublicationYear "2003" @default.
• W2000418034 type Work @default.
• W2000418034 sameAs 2000418034 @default.
• W2000418034 citedByCount "59" @default.
• W2000418034 countsByYear W20004180342012 @default.
• W2000418034 countsByYear W20004180342013 @default.
• W2000418034 countsByYear W20004180342014 @default.
• W2000418034 countsByYear W20004180342015 @default.
• W2000418034 countsByYear W20004180342016 @default.
• W2000418034 countsByYear W20004180342017 @default.
• W2000418034 countsByYear W20004180342018 @default.
• W2000418034 countsByYear W20004180342019 @default.
• W2000418034 countsByYear W20004180342020 @default.
• W2000418034 countsByYear W20004180342021 @default.
• W2000418034 countsByYear W20004180342023 @default.
• W2000418034 crossrefType "journal-article" @default.
• W2000418034 hasAuthorship W2000418034A5011756238 @default.
• W2000418034 hasAuthorship W2000418034A5047201329 @default.
• W2000418034 hasAuthorship W2000418034A5070824605 @default.
• W2000418034 hasBestOaLocation W20004180341 @default.
• W2000418034 hasConcept C1491633281 @default.
• W2000418034 hasConcept C149402561 @default.
• W2000418034 hasConcept C185592680 @default.
• W2000418034 hasConcept C2780040266 @default.
• W2000418034 hasConcept C2781380885 @default.
• W2000418034 hasConcept C41625074 @default.
• W2000418034 hasConcept C55493867 @default.
• W2000418034 hasConcept C62478195 @default.
• W2000418034 hasConcept C86803240 @default.
• W2000418034 hasConcept C95444343 @default.
• W2000418034 hasConceptScore W2000418034C1491633281 @default.
• W2000418034 hasConceptScore W2000418034C149402561 @default.
• W2000418034 hasConceptScore W2000418034C185592680 @default.
• W2000418034 hasConceptScore W2000418034C2780040266 @default.
• W2000418034 hasConceptScore W2000418034C2781380885 @default.
• W2000418034 hasConceptScore W2000418034C41625074 @default.
• W2000418034 hasConceptScore W2000418034C55493867 @default.
• W2000418034 hasConceptScore W2000418034C62478195 @default.
• W2000418034 hasConceptScore W2000418034C86803240 @default.
• W2000418034 hasConceptScore W2000418034C95444343 @default.
• W2000418034 hasIssue "18" @default.
• W2000418034 hasLocation W20004180341 @default.
• W2000418034 hasOpenAccess W2000418034 @default.
• W2000418034 hasPrimaryLocation W20004180341 @default.
• W2000418034 hasRelatedWork W160981812 @default.
• W2000418034 hasRelatedWork W1993421248 @default.
• W2000418034 hasRelatedWork W2010818707 @default.

• next