FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000429979> ?p ?o ?g. }

• W2000429979 endingPage "13189" @default.
• W2000429979 startingPage "13180" @default.
• W2000429979 abstract "Members of the superfamily of transient receptor potential (TRP) channels are proposed to play important roles in sensory physiology. As an excitatory ion channel TRPA1 is robustly activated by pungent irritants in mustard and garlic and is suggested to mediate the inflammatory actions of environmental irritants and proalgesic agents. Here, we demonstrate that, in addition to pungent natural compounds, Ca2+ directly gates heterologously expressed TRPA1 in whole-cell and excised-patch recordings with an apparent EC50 of 905 nm. Pharmacological experiments and site-directed mutagenesis indicate that the N-terminal EF-hand calcium-binding domain of the channel is involved in Ca2+-dependent activation. Furthermore, we determine Ca2+ as prerequisite for icilin activity on TRPA1. Members of the superfamily of transient receptor potential (TRP) channels are proposed to play important roles in sensory physiology. As an excitatory ion channel TRPA1 is robustly activated by pungent irritants in mustard and garlic and is suggested to mediate the inflammatory actions of environmental irritants and proalgesic agents. Here, we demonstrate that, in addition to pungent natural compounds, Ca2+ directly gates heterologously expressed TRPA1 in whole-cell and excised-patch recordings with an apparent EC50 of 905 nm. Pharmacological experiments and site-directed mutagenesis indicate that the N-terminal EF-hand calcium-binding domain of the channel is involved in Ca2+-dependent activation. Furthermore, we determine Ca2+ as prerequisite for icilin activity on TRPA1. The transient receptor potential channel A1 (TRPA1) 2The abbreviations used are: TRPA1, transient receptor potential channel A1; AITC, allyl isothiocyanate; PLC, phospholipase C; EF-hand CBD, EF-hand calcium-binding domain; HEK293, human embryonic kidney 293 cells; BAPTA, 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid; RR, ruthenium red; CMZ, calmidazolium. is a member of the superfamily of TRP channels. In mammals, A1 forms its own subfamily and is distinguished from other TRP channels by the presence of ∼14 ankyrin repeats in its N terminus (1Clapham D.E. Nature. 2003; 426: 517-524Crossref PubMed Scopus (2164) Google Scholar). TRPA1 was initially described as a cold sensitive nonselective cation channel (2Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar), but it also functions as a ligand-gated channel in heterologous expression systems and sensory neurons (3Ramsey I.S. Delling M. Clapham D.E. Annu. Rev. Physiol. 2006; 68: 619-647Crossref PubMed Scopus (1240) Google Scholar). The pungent ingredients in mustard (allyl isothiocyanate, AITC) and garlic (allicin) robustly activate TRPA1 currents (4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar, 5Macpherson L.J. Geierstanger B.H. Viswanath V. Bandell M. Eid S.R. Hwang S. Patapoutian A. Curr. Biol. 2005; 15: 929-934Abstract Full Text Full Text PDF PubMed Scopus (486) Google Scholar, 6Bautista D.M. Movahed P. Hinman A. Axelsson H.E. Sterner O. Hogestatt E.D. Julius D. Jordt S.E. Zygmunt P.M. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 12248-12252Crossref PubMed Scopus (679) Google Scholar). In addition, TRPA1 appears to be regulated by phospholipase C (PLC)-coupled receptors, suggesting that channel opening can be mediated by second messengers (4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar, 7Bandell M. Story G.M. Hwang S.W. Viswanath V. Eid S.R. Petrus M.J. Earley T.J. Patapoutian A. Neuron. 2004; 41: 849-857Abstract Full Text Full Text PDF PubMed Scopus (1465) Google Scholar, 8Kwan K.Y. Allchorne A.J. Vollrath M.A. Christensen A.P. Zhang D.S. Woolf C.J. Corey D.P. Neuron. 2006; 50: 277-289Abstract Full Text Full Text PDF PubMed Scopus (1017) Google Scholar). TRPA1 expression was first described in a subset of sensory neurons of dorsal root and trigeminal ganglia that contribute to nociception and co-express calcitonin gene related peptide, substance P and TRPV1 (2Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar, 4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar). Recent studies on TRPA1 deficient mice support a role of the channel in inflammatory pain and sensation of noxious cold (8Kwan K.Y. Allchorne A.J. Vollrath M.A. Christensen A.P. Zhang D.S. Woolf C.J. Corey D.P. Neuron. 2006; 50: 277-289Abstract Full Text Full Text PDF PubMed Scopus (1017) Google Scholar, 9Bautista D.M. Jordt S.E. Nikai T. Tsuruda P.R. Read A.J. Poblete J. Yamoah E.N. Basbaum A.I. Julius D. Cell. 2006; 124: 1269-1282Abstract Full Text Full Text PDF PubMed Scopus (1498) Google Scholar). A model suggests TRPA1 activation by bradykinin, a potent algogenic substance released due to tissue injury and inflammation, in two possible ways: through PLC-mediated increases in intracellular Ca2+ or other metabolites (e.g. diacylglycerol) and via Ca2+ influx through TRPV1 (9Bautista D.M. Jordt S.E. Nikai T. Tsuruda P.R. Read A.J. Poblete J. Yamoah E.N. Basbaum A.I. Julius D. Cell. 2006; 124: 1269-1282Abstract Full Text Full Text PDF PubMed Scopus (1498) Google Scholar). Whether an increase in intracellular Ca2+ is sufficient to activate TRPA1 is still debated (4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar, 7Bandell M. Story G.M. Hwang S.W. Viswanath V. Eid S.R. Petrus M.J. Earley T.J. Patapoutian A. Neuron. 2004; 41: 849-857Abstract Full Text Full Text PDF PubMed Scopus (1465) Google Scholar), but several findings indicate a role of Ca2+ on TRPA1 function. It was shown that extracellular Ca2+ enhances the current rate and magnitude of AITC-induced currents (4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar, 10Nagata K. Duggan A. Kumar G. Garcia-Anoveros J. J. Neurosci. 2005; 25: 4052-4061Crossref PubMed Scopus (516) Google Scholar). Furthermore, Ca2+ is thought to be responsible for fast channel closure (10Nagata K. Duggan A. Kumar G. Garcia-Anoveros J. J. Neurosci. 2005; 25: 4052-4061Crossref PubMed Scopus (516) Google Scholar). In addition, single channel recordings of heterologously expressed TRPA1 revealed an AITC-induced conductance, which is reduced in the presence of Ca2+ (10Nagata K. Duggan A. Kumar G. Garcia-Anoveros J. J. Neurosci. 2005; 25: 4052-4061Crossref PubMed Scopus (516) Google Scholar). Together these reports emphasize the importance of Ca2+ for TRPA1 function. Very recently the existence of a putative EF-hand calcium-binding domain (EF-hand CBD) at the N terminus of TRPA1 was reported (11Hinman A. Chuang H.H. Bautista D.M. Julius D. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 19564-19568Crossref PubMed Scopus (732) Google Scholar). The EF-hand CBD is the most common motif among Ca2+-binding sites of a large number of Ca2+-interacting proteins (12Lewit-Bentley A. Rety S. Curr. Opin. Struct. Biol. 2000; 10: 637-643Crossref PubMed Scopus (424) Google Scholar). The classical EF-hand is a helix-loop-helix motif that coordinates the Ca2+ ion in a pentagonal pyramidal configuration. The domain consists usually of 12 residues, whereas six residues in positions 1, 3, 5, 7, 9, and 12 are postulated to be involved in Ca2+-binding (12Lewit-Bentley A. Rety S. Curr. Opin. Struct. Biol. 2000; 10: 637-643Crossref PubMed Scopus (424) Google Scholar). In this study we set out to clarify the role of Ca2+ on TRPA1 channel activation by studying human TRPA1 transiently expressed in HEK293 cells. Consistent with previous studies on AITC, our results show that Ca2+ potentiates the cinnamaldehyde- and carvacrol-induced responses. In addition, we determine Ca2+ as essential co-agonist for icilin activity on TRPA1. Interestingly, Ca2+ also directly activates TRPA1 (EC50 of 905 nm) in whole-cell and excised inside-out patch recordings. The mechanism underlying Ca2+-dependent activation is analyzed using pharmacological approaches and mutagenesis studies, thereby identifying the EF-hand CBD as potential Ca2+-binding site. Cells Culture—Human embryonic kidney 293 and 293T cells (HEK293) were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 2 mm l-glutamine, 100 μg/ml penicillin/streptomycin (Invitrogen, Karlsruhe, Germany) at 37 °C in a humidity controlled incubator with 5% CO2. Transient Expression of Human TRPA1 and Mutagenesis—For transient expression of human TRPA1 (hTRPA1) we used a recombinant expression plasmid (pcDNA5-FRT) carrying the entire protein coding region for hTRPA1. The plasmid was kindly provided by H.-J. Behrendt. Semiconfluent HEK293 cells were transiently transfected (2 μg of hTRPA1 cDNA per dish) in 35-mm dishes (Flacon, BD Bioscience, Heidelberg, Germany) using the CaP-precipitation method as described previously (13Zufall F. Hatt H. Firestein S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9335-9339Crossref PubMed Scopus (44) Google Scholar). Co-transfected pIRES-EGFP (0.2 μg per dish) served as transfection marker. All recordings were performed at room temperature ∼24–48 h after transfection. Untransfected cells were used for control recordings. For point mutations to the putative TRPA1 EF-hand CBD we followed established protocols. Briefly, overlap extension PCR (14Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6851) Google Scholar) was used to perform site-directed mutagenesis of the EF-hand domain. The six residues reported to be involved in binding of the Ca2+ ion are in positions 1, 3, 5, 7, 9, and 12 (12Lewit-Bentley A. Rety S. Curr. Opin. Struct. Biol. 2000; 10: 637-643Crossref PubMed Scopus (424) Google Scholar). We exchanged the amino acids in these positions to alanine to induce the loss of Ca2+-binding capability (D468A, S470A, T472A, L474A, N476A, D479A). The primer pairs used for mutations were as follows: external primers, CTGATGATATCGTCCTATTCTGGTAGCG (forward) and GCATCATGCTGAAGGTCTGGATTATAGA (reverse); pos 1 (D468A), GAGGCTCCTACAAGCCATAAGTGA (forward) and CTCGTATCACTTATGGCTTGTAGGAGC (reverse); pos 3 (S470A), CTACAAGACATAGCTGATACGAGG (forward) and AAGCCTCGTATCAGCTATGTCTTGTAG (reverse); pos 5 (T472A), ATAAGTGATGCGAGGCTTCTGAATG (forward) and CTTCATTCAGAAGCCTCGCATCACTTATG (reverse); pos 7 (L474A), GATACGAGGGCTCTGAATGAAGGTGAC (forward) and AGGTCACCTTCATTCAGAGCCCTCGTATC (reverse); pos 9 (N476A), AGGCTTCTGGCTGAAGGTGACCTTCA (forward) and CATGAAGGTCACCTTCAGCCAGAAGCCTCG (reverse); pos 12 (D479A), GAATGAAGGTGCACTTCATGGAATG (forward) and GTCATTCCATGAAGTGCACCTTCATTC (reverse). The different PCR products carrying the corresponding mutation were cloned into the HpaI/BamHI sites of hTRPA1. The nucleotide sequence of the mutants was verified by sequencing the corresponding cDNA. Solutions—For electrophysiological measurements all solutions were adjusted to pH 7.3. The experimental solutions contained the following (in mm) for whole-cell experiments: standard extracellular solution, 140 NaCl, 5 KCl, 10 HEPES, 2 CaCl2, 1 MgCl2; Ca2+-free solution, 140 NaCl, 5 KCl, 10 HEPES, 1 MgCl2, 5 EGTA; standard intracellular solution, 140 KCl, 1 MgCl2, 0.1 CaCl2, 5 EGTA, 10 HEPES. For ramp protocols KCl was replaced by CsCl. For whole-cell recordings of Ca2+-activated currents, CaCl2 was added either to the standard extracellular solution resulting in a concentration of 10 mm CaCl2 or to the standard intracellular solution resulting in a concentration of 5 mm CaCl2. The intracellular solution for the Ca2+ dose-response curve contained 140 KCl, 10 HEPES, 1 MgCl2, 10 EGTA. Ca2+ was added as follows: 4.918 mm CaCl2 for 100 nm free Ca2+, 7.421 mm CaCl2 for 300 nm free Ca2+, 9.05 mm CaCl2 for 1 μm free Ca2+, 9.663 mm CaCl2 for 3 μm free Ca2+, 9.906 mm CaCl2 for 10 μm free Ca2+, 9.995 mm CaCl2 for 30 μm free Ca2+. The free Ca2+ concentration was calculated by the software WCabuf (G. Droogmans, Leuven, Belgium). The influence of Ca2+ on icilin-induced currents was studied by adding 5 mm BAPTA to the standard intracellular solution or increasing the extracellular Ca2+ concentration to 5 mm CaCl2. For excised-patch recordings pipette and bath solutions were symmetric (in mm): 140 NaCl, 10 HEPES, 2 EGTA. Solutions with nano- or micromolar concentrations of free Ca2+ were obtained by adding CaCl2 to this EGTA-based buffer as follows: 1.012 mm CaCl2 for 100 nm free Ca2+, 1.509 mm CaCl2 for 300 nm free Ca2+, 1.823 mm CaCl2 for 1 μm free Ca2+ and 1.940 mm CaCl2 for 3 μm free Ca2+. Chemicals were prepared as concentrated stock solutions in either distilled water or Me2SO and diluted to the final concentration using standard extracellular solution or standard pipette solution as indicated in the text. AITC, carvacrol, icilin, and BAPTA were obtained from Sigma; ruthenium red (RR), U73122, and calmidazolium (CMZ) were purchased from Calbiochem; CALP2 was obtained from Tocris bioscience; and cinnamaldehyde was from Henkel. Electrophysiological Recordings—All recordings were performed with an EPC7 amplifier (List-Medical Electronic, Darmstadt, Germany). Data were acquired using Pulse software (HEKA, Lambrecht, Germany). Excised patches were sampled at 2 kHz and filtered at 1 kHz. Patch pipettes were pulled from borosilicate glass (GC150TF-10, Harvard Apparatus Ltd.) and fire polished to 3–5 mΩ tip resistance using a horizontal pipette puller (Zeitz Instruments, Munich, Germany). Solution exchange was achieved by placing cells in front of a theta-capillary and moving manually from one side of the outlet to the other. Excised patches were placed in front of a microperfusion pipette and solution exchange was achieved by switching from one solution to another under computer control. Data Analysis—Electrophysiological data were analyzed using the software Pulse (HEKA), IgorPro (Wavemetrics), SigmaPlot (SPSS Science), OriginPro (Origin Lab Corp.), TAC (Bruxton), and Microsoft Excel. Significance was tested using Student’s independent t test (p < 0.05 is marked by an asterisk). The dose-response curve was fitted with a Hill equation of the form y = base + (max-base)/[1 + (xhalf/x)n]. Data are presented as mean ± S.E. Western Blotting—HEK293 cells were transfected with equal amounts of cDNA for wild-type TRPA1 and EF-hand mutants. Whole cell lysates were prepared 24 h after transfection, mixed with Laemmli buffer (30% glycerol, 3% SDS, 125 mm Tris-HCl, pH 6.8) and heated at 95 °C for 5 min. Equal amounts of protein were loaded and resolved by 8% SDS-PAGE and transferred to nitrocellulose membrane (Protran; Schleicher & Schuell). The nitrocellulose membranes were stained with Ponceau S (Sigma) and blocked with TBST (150 mm NaCl, 50 mm Tris-HCl, Tween 20, pH 7.4) containing 2% ECL Advance Blocking Agent (Amersham Biosciences). TRPA1 was detected using two reported antibodies directed either against the C terminus of mouse TRPA1 (1:500) or the N terminus of mouse TRPA1 (1:1000) (10Nagata K. Duggan A. Kumar G. Garcia-Anoveros J. J. Neurosci. 2005; 25: 4052-4061Crossref PubMed Scopus (516) Google Scholar, 15Corey D.P. Garcia-Anoveros J. Holt J.R. Kwan K.Y. Lin S.Y. Vollrath M.A. Amalfitano A. Cheung E.L. Derfler B.H. Duggan A. Geleoc G.S. Gray P.A. Hoffman M.P. Rehm H.L. Tamasauskas D. Zhang D.S. Nature. 2004; 432: 723-730Crossref PubMed Scopus (560) Google Scholar). The primary antibodies were diluted in 2% ECL Advance Blocking Agent in TBST. After washing and incubation with horseradish peroxidase-coupled secondary antibody, detection was performed with ECL Advance (Amersham Biosciences) on Hyperfilm ECL (Amersham Biosciences). Icilin Requires Ca2+ for Its Agonist Efficacy—Ca2+ is known to modulate agonist-induced responses of various TRP channels (16Chuang H.H. Neuhausser W.M. Julius D. Neuron. 2004; 43: 859-869Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 17Strotmann R. Schultz G. Plant T.D. J. Biol. Chem. 2003; 278: 26541-26549Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 18Watanabe H. Vriens J. Janssens A. Wondergem R. Droogmans G. Nilius B. Cell Calcium. 2003; 33: 489-495Crossref PubMed Scopus (106) Google Scholar). Voltage-clamp recordings from TRPA1-expressing Xenopus oocytes or HEK293 cells have shown that AITC-induced responses are potentiated by external Ca2+ ions (4Jordt S.E. Bautista D.M. Chuang H.H. McKemy D.D. Zygmunt P.M. Hogestatt E.D. Meng I.D. Julius D. Nature. 2004; 427: 260-265Crossref PubMed Scopus (1561) Google Scholar, 10Nagata K. Duggan A. Kumar G. Garcia-Anoveros J. J. Neurosci. 2005; 25: 4052-4061Crossref PubMed Scopus (516) Google Scholar). We were interested to examine the effect of external Ca2+ ions on agonist efficacy of various TRPA1 agonists. Therefore, we performed whole-cell patch clamp recordings from HEK293 cells transiently transfected with cDNA of hTRPA1 and applied AITC, cinnamaldehyde, carvacrol, and icilin in the presence and absence of external Ca2+ ions at a holding potential of Vh =–60 mV (Fig. 1). As expected, AITC (25 μm) induced a slowly developing current in the absence of external Ca2+ ions. Addition of 2 mm CaCl2 to the bath solution evoked a strong potentiation of the inward current (Fig. 1A). The same was true for cinnamaldehyde (500 μm) and carvacrol (500 μm). The currents developed slowly in the absence of external Ca2+ ions and were boosted when Ca2+ was replenished in the extracellular recording solution (Fig. 1, B and C). In contrast, icilin (100 μm) displayed very little or no agonist activity in the absence of external Ca2+ ions (40.3 ± 15.5 pA, Fig. 1, D and F). This low icilin efficacy under Ca2+-free conditions does not seem to reflect a decrease of agonist potency, since increasing icilin concentration from 100 to 500 μm did not produce larger inward currents under Ca2+-free conditions (Fig. 1E). A recovery of icilin agonist efficacy was observed when Ca2+ was added to the extracellular recording solution (Fig. 1, D and E). These data let us suggest that Ca2+ serves as co-agonist with icilin by interacting directly with TRPA1, in a manner resembling the effect of Ca2+ on icilin efficacy at TRPM8 (16Chuang H.H. Neuhausser W.M. Julius D. Neuron. 2004; 43: 859-869Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Raising the extracellular Ca2+ concentration from 2 to 5 mm did not significantly increase icilin-induced currents (1815 ± 302 pA, Fig. 1F). To test for the hypothesis that intracellular Ca2+ is required for icilin efficacy, we added BAPTA (5 mm) to the pipette solution while recording in standard extracellular solution containing 2 mm CaCl2. Interestingly, icilin-evoked currents were significantly reduced (863 ± 235 pA, p = 0.048) compared to control conditions with standard intracellular solution (1586 ± 222 pA), indicating a role of intracellular Ca2+ for icilin agonist efficacy (Fig. 1F). Taken together, our results argue for a distinct mechanism of activation by icilin as compared with other TRPA1 agonists. Ca2+ Influx Is Sufficient to Activate TRPA1—In light of the clear dependence of agonist activity on Ca2+, we asked whether Ca2+ itself is sufficient to activate TRPA1. Whole-cell voltage-clamp recordings in standard extracellular solution for extended periods of time revealed the activation of an inward current that developed after on average 331 ± 58 s in the absence of any agonist in 12 out of 15 recorded cells (Fig. 2A). The current first showed a slow activation kinetic, which was boosted when the initial current reached on average 26.3 ± 3.3% of the total current. Both the initial current and the sudden sharp increase in current were blocked by 1 μm RR, indicating that both components of the biphasic response are mediated through TRPA1 activation (Fig. 2B). Ca2+ may enter through spontaneously active TRPA1 channels, thereby triggering further channel opening until the intracellular Ca2+ concentration reaches a certain threshold level responsible for the sudden sharp increase in current. To clarify whether the leak influx of extracellular Ca2+ activates TRPA1, we recorded under the same conditions at a positive holding potential of Vh =+60 mV. The driving force for Ca2+ is reduced at depolarized membrane potentials resulting in less Ca2+ entry. Therefore, we expected the biphasic response to be abolished or delayed at Vh =+60 mV. Indeed, no sudden sharp increase in current developed within the given time frame of 8 min in which currents developed at –60 mV (Fig. 2C). Application of AITC (10 s, 25 μm) elicited currents, confirming the expression of TRPA1 in the recorded cells. The hypothesis that Ca2+ leak influx activates TRPA1 is further supported by the finding that the biphasic current activation is induced faster when extracellular Ca2+ is increased to 10 mm (59 ± 6 s, Fig. 2D). Again, this current was completely blocked by 1 μm RR (data not shown) and was absent in untransfected HEK293 cells (Fig. 2E). Taken together, these results indicate that influx of extracellular Ca2+ into the cell is sufficient to activate TRPA1. Increase in Intracellular Ca2+ Elicits TRPA1 Currents—To investigate the impact of intracellular Ca2+ on activation of TRPA1, we directly increased the intracellular Ca2+ concentration to 5 mm resulting in a free Ca2+ concentration of 23 μm. A prominent inward current developed almost instantaneously after establishing the whole-cell configuration in cells recorded either in standard extracellular solution (219 ± 38 pA) or Ca2+-free solution (214 ± 68 pA) (Fig. 3A and B, Vh =–60 mV). This current was blocked by 1–5 μm RR (Fig. 3A) and was absent or only exiguous in untransfected HEK293 cells (35 ± 10 pA, Fig. 3C), supporting the finding that intracellular Ca2+ triggers TRPA1 activation. Next, we quantified the sensitivity of TRPA1 channels to intracellular Ca2+ concentrations ranging from 100 nm to 30 μm. We chose a holding potential of Vh = –80 mV to increase the driving force for Na+ ions, which should elicit larger inward currents. Ca2+ was added to an EGTA-buffered pipette solution to define various Ca2+ concentrations. The dose-response relationship was fitted with a Hill equation determining an EC50 of 905 ± 249 nm and a Hill-Coefficient of 0.9 ± 0.2 (Fig. 3D). Ca2+ Activates TRPA1 in Excised Inside-out Patches—In whole-cell recordings many receptors or ion channel proteins might be modulated by intracellular processes or factors like enzymatic activity or cytosolic signaling molecules. To reduce a possible influence of cytosolic factors that might control the behavior of channels, we examined the effect of Ca2+ on excised patches from transfected HEK293 cells in the insideout configuration. Interestingly, application of Ca2+ in nanomolar concentrations to the intracellular side of the membrane was sufficient to elicit TRPA1 single-channel currents with amplitudes of on average –9.5 pA at a membrane potential (Vm) of –80 mV resulting in a single-channel conductance of 119 ± 6.3 pS (Fig. 4, A and B). Application of higher Ca2+ concentrations (1–3 μm) led to activation of more channels or even induced macroscopic currents in some patches (Fig. 4A). Furthermore, we observed desensitization of Ca2+-induced currents (see Fig. 4A). Consistent with the Ca2+ dose-response curve for TRPA1 in whole-cell recordings (see Fig. 3D), we also found dose dependence in inside-out patches (Fig. 4C). In untransfected control cells we observed an endogenous Ca2+-sensitive ion channel with a single-channel conductance of 40 pS at Vm =–80 mV, which interferes with the overexpressed TRPA1 in transfected cells (Fig. 4D). Further analysis of single-channel currents in transfected cells during voltage ramp-protocols showed that currents evoked by Ca2+ (3 μm) or AITC (25 μm) have identical reversal potentials and rectification properties arguing that Ca2+-activated currents are due to TRPA1 activation (Fig. 4E). Ca2+ Activates TRPA1 in a PLC-independent Fashion—In light of the clear activation of TRPA1 by intracellular Ca2+ we asked whether Ca2+ directly gates TRPA1 or via a PLC-dependent signaling pathway. Since endogenous PLC activity remains preserved in inside-out patches (19Nilius B. Mahieu F. Prenen J. Janssens A. Owsianik G. Vennekens R. Voets T. EMBO J. 2006; 25: 467-478Crossref PubMed Scopus (252) Google Scholar) we stimulated inside-out patches with 3 μm Ca2+ after 30 s preincubation with the PLC-inhibitor U73122 (10 μm). Ca2+ was still able to induce TRPA1-mediated currents (Fig. 4F), indicating that Ca2+ may directly gate TRPA1 probably by binding to a high affinity Ca2+-binding site at the channels cytosolic side. TRPA1 Exhibits a Putative EF-hand CBD—While screening for Ca2+-binding domains, we identified a putative EF-hand motif at the N terminus of TRPA1 (Asp-468-Leu-480). To test for the hypothesis that Ca2+ activates TRPA1 by binding through the EF-hand CBD, we used a 12-mer Ca2+ like peptide, CALP2, known to function as antagonist at the EF-hands of calmodulin and troponin C (20Villain M. Jackson P.L. Manion M.K. Dong W.J. Su Z. Fassina G. Johnson T.M. Sakai T.T. Krishna N.R. Blalock J.E. J. Biol. Chem. 2000; 275: 2676-2685Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 21Houtman R. Ten B.R. Blalock J.E. Villain M. Koster A.S. Nijkamp F.P. J. Immunol. 2001; 166: 861-867Crossref PubMed Scopus (10) Google Scholar). We examined the effect of CALP2 on Ca2+-induced TRPA1 single-channel currents in excised inside-out patches at Vm =–80 mV. Interestingly, Ca2+-induced (1 μm) activity was strongly reduced in the presence of CALP2 (50 μm). The open probability decreased by ∼90%, whereas the single-channel amplitude was unaffected (8.3 ± 0.5 pA before CALP2; 7.7 ± 1.7 pA during CALP2) (Fig. 5A). The inhibitory effect of CALP2 was reversed by removal of the peptide and channel activity reverted back to the prior level (Fig. 5A). To exclude that CALP2 blocks the channel pore, we evaluated the effect of CALP2 on AITC-induced currents (Fig. 5B). Co-application of CALP2 (50 μm) had no influence on AITC-induced (25 μm) open probability nor on single-channel currents (13.1 ± 4.3 pA before CALP2; 14.5 ± 2.8 pA during CALP2). It should be noted that AITC-induced current amplitudes varied extremely (Fig. 5B) and reached on average larger amplitudes as compared with Ca2+-induced currents (Fig. 5A). Up to now a role of calmodulin in TRPA1 function has not been reported. However, CALP2 might interact with calmodulin bound to TRPA1. To exclude a role of calmodulin in Ca2+-dependent activation, we preincubated the excised patches with CMZ, a known calmodulin inhibitor. We used a concentration known to be active in other calmodulin-dependent processes (10 μm) (22Zhang Z. Tang J. Tikunova S. Johnson J.D. Chen Z. Qin N. Dietrich A. Stefani E. Birnbaumer L. Zhu M.X. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3168-3173Crossref PubMed Scopus (208) Google Scholar, 23Lupinsky D.A. Magoski N.S. J. Physiol. (Lond.). 2006; 575: 491-506Crossref Scopus (23) Google Scholar). After 20 s preincubation we exposed the patches to 1 μm Ca2+ in the presence of CMZ. Ca2+ still elicited TRPA1 single-channel currents (8.9 ± 3 pA), arguing that calmodulin is not involved in Ca2+-dependent activation of TRPA1 (Fig. 5C). A Single Mutation within the EF-hand CBD Impairs Ca2+ Sensitivity—Based on the effect of CALP2 on Ca2+-induced single-channel currents, we were interested to see whether sensitivity of TRPA1 to Ca2+ could be limited to a single residue within the EF-hand CBD. The EF-hand motif of TRPA1 appears to be highly conserved within different species (Fig. 6A). To identify the site(s) responsible for Ca2+ binding, we performed alanine scanning mutagenesis for the residues proposed to be involved in Ca2+ binding (Fig. 6B) (12Lewit-Bentley A. Rety S. Curr. Opin. Struct. Biol. 2000; 10: 637-643Crossref PubMed Scopus (424) Google Scholar). The resulting mutants (D468A, S470A, T472A, L474A, N476A, and D479A) were expressed in HEK293 cells and expression was first confirmed by Western blot analysis (Fig. 6C). Mouse TRPA1 antibodies recognized an expected band of ∼128 kDa for wild-type TRPA1 and EF-hand mutants, indicating effective expression of all mutants. It should be noted that although the antibodies only recognized one band for the mutant T472A, this was of lower molecular weight than predicted. No band was detected in the whole cell extract from untransfected cells (Fig. 6C). To analyze for functionality of the mutant receptors, we verified the sensitivity to AITC (25 μm) before examining changes in Ca2+ sensitivity of the mutants. Mutations at positions Asp-468, Ser-470, and Leu-474 were found to retain AITC sensitivity (Fig. 6D). Although slight differences were observed in mean current amplitudes elicited after 10 s application of AITC (Fig. 6E), currents showed identical reversal potentials and rectification properties for mutants as compared with the wild-type channel, arguing for plenary functionality of the mutants D468A, S470A, and L474A (Fig. 6, D and E). No currents could be observed for cells expressing the T472A, N476A, and D479A mutants (Fig. 6D). Even prolonged exposure to AITC (25 μm, 60s) did not induce any inward or outward currents (Fig. 6D)." @default.
• W2000429979 created "2016-06-24" @default.
• W2000429979 creator A5013069792 @default.
• W2000429979 creator A5050065025 @default.
• W2000429979 creator A5061265968 @default.
• W2000429979 creator A5063861188 @default.
• W2000429979 date "2007-05-01" @default.
• W2000429979 modified "2023-10-03" @default.
• W2000429979 title "Transient Receptor Potential Channel A1 Is Directly Gated by Calcium Ions" @default.
• W2000429979 cites W1544507534 @default.
• W2000429979 cites W1592600709 @default.
• W2000429979 cites W1966329284 @default.
• W2000429979 cites W1980798939 @default.
• W2000429979 cites W1988759455 @default.
• W2000429979 cites W2002613167 @default.
• W2000429979 cites W2009967312 @default.
• W2000429979 cites W2029727178 @default.
• W2000429979 cites W2035257142 @default.
• W2000429979 cites W2040664792 @default.
• W2000429979 cites W2041322673 @default.
• W2000429979 cites W2052021933 @default.
• W2000429979 cites W2053357507 @default.
• W2000429979 cites W2060913542 @default.
• W2000429979 cites W2062978707 @default.
• W2000429979 cites W2073367571 @default.
• W2000429979 cites W2095955574 @default.
• W2000429979 cites W2106097986 @default.
• W2000429979 cites W2109879418 @default.
• W2000429979 cites W2112767644 @default.
• W2000429979 cites W2117060674 @default.
• W2000429979 cites W2119589189 @default.
• W2000429979 cites W2120229762 @default.
• W2000429979 cites W2127012396 @default.
• W2000429979 cites W2129326126 @default.
• W2000429979 cites W2144801767 @default.
• W2000429979 cites W2150180767 @default.
• W2000429979 cites W2156733405 @default.
• W2000429979 cites W95394682 @default.
• W2000429979 doi "https://doi.org/10.1074/jbc.m607849200" @default.
• W2000429979 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17353192" @default.
• W2000429979 hasPublicationYear "2007" @default.
• W2000429979 type Work @default.
• W2000429979 sameAs 2000429979 @default.
• W2000429979 citedByCount "283" @default.
• W2000429979 countsByYear W20004299792012 @default.
• W2000429979 countsByYear W20004299792013 @default.
• W2000429979 countsByYear W20004299792014 @default.
• W2000429979 countsByYear W20004299792015 @default.
• W2000429979 countsByYear W20004299792016 @default.
• W2000429979 countsByYear W20004299792017 @default.
• W2000429979 countsByYear W20004299792018 @default.
• W2000429979 countsByYear W20004299792019 @default.
• W2000429979 countsByYear W20004299792020 @default.
• W2000429979 countsByYear W20004299792021 @default.
• W2000429979 countsByYear W20004299792022 @default.
• W2000429979 countsByYear W20004299792023 @default.
• W2000429979 crossrefType "journal-article" @default.
• W2000429979 hasAuthorship W2000429979A5013069792 @default.
• W2000429979 hasAuthorship W2000429979A5050065025 @default.
• W2000429979 hasAuthorship W2000429979A5061265968 @default.
• W2000429979 hasAuthorship W2000429979A5063861188 @default.
• W2000429979 hasBestOaLocation W20004299791 @default.
• W2000429979 hasConcept C111919701 @default.
• W2000429979 hasConcept C12554922 @default.
• W2000429979 hasConcept C127162648 @default.
• W2000429979 hasConcept C145148216 @default.
• W2000429979 hasConcept C155164980 @default.
• W2000429979 hasConcept C167007842 @default.
• W2000429979 hasConcept C170493617 @default.
• W2000429979 hasConcept C178790620 @default.
• W2000429979 hasConcept C185592680 @default.
• W2000429979 hasConcept C18699975 @default.
• W2000429979 hasConcept C2780799671 @default.
• W2000429979 hasConcept C41008148 @default.
• W2000429979 hasConcept C50254741 @default.
• W2000429979 hasConcept C519063684 @default.
• W2000429979 hasConcept C55493867 @default.
• W2000429979 hasConcept C76155785 @default.
• W2000429979 hasConcept C85520022 @default.
• W2000429979 hasConcept C86803240 @default.
• W2000429979 hasConceptScore W2000429979C111919701 @default.
• W2000429979 hasConceptScore W2000429979C12554922 @default.
• W2000429979 hasConceptScore W2000429979C127162648 @default.
• W2000429979 hasConceptScore W2000429979C145148216 @default.
• W2000429979 hasConceptScore W2000429979C155164980 @default.
• W2000429979 hasConceptScore W2000429979C167007842 @default.
• W2000429979 hasConceptScore W2000429979C170493617 @default.
• W2000429979 hasConceptScore W2000429979C178790620 @default.
• W2000429979 hasConceptScore W2000429979C185592680 @default.
• W2000429979 hasConceptScore W2000429979C18699975 @default.
• W2000429979 hasConceptScore W2000429979C2780799671 @default.
• W2000429979 hasConceptScore W2000429979C41008148 @default.
• W2000429979 hasConceptScore W2000429979C50254741 @default.
• W2000429979 hasConceptScore W2000429979C519063684 @default.
• W2000429979 hasConceptScore W2000429979C55493867 @default.
• W2000429979 hasConceptScore W2000429979C76155785 @default.
• W2000429979 hasConceptScore W2000429979C85520022 @default.
• W2000429979 hasConceptScore W2000429979C86803240 @default.

• next