FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000438077> ?p ?o ?g. }

• W2000438077 endingPage "28352" @default.
• W2000438077 startingPage "28349" @default.
• W2000438077 abstract "Werner syndrome (WS) is an autosomal recessive disease characterized by premature aging. The gene responsible for the syndrome was recently cloned and shown to encode a protein with strong homology to DNA/RNA helicases. In addition, the Werner syndrome protein (WRN) possesses an exonuclease activity. Based on the homology to helicases it has been proposed that WRN functions in some aspects of DNA replication, recombination, or repair. However, there is currently no evidence of a role of WRN in any of these processes; therefore, its biological function remains unknown. Using a biochemical approach, we have identified two polypeptides that bind to the WRN protein. Peptide sequence analysis indicates that the two proteins are identical to Ku70 and Ku80, a heterodimer involved in double strand DNA break repair by non-homologous DNA end joining. Protein-protein interaction studies reveal that WRN binds directly to Ku80 and that this interaction is mediated by the amino terminus of WRN. In addition, we show that the binding of Ku alters the specificity of the WRN exonuclease. These results suggest a potential involvement of WRN in the repair of double strand DNA breaks. Werner syndrome (WS) is an autosomal recessive disease characterized by premature aging. The gene responsible for the syndrome was recently cloned and shown to encode a protein with strong homology to DNA/RNA helicases. In addition, the Werner syndrome protein (WRN) possesses an exonuclease activity. Based on the homology to helicases it has been proposed that WRN functions in some aspects of DNA replication, recombination, or repair. However, there is currently no evidence of a role of WRN in any of these processes; therefore, its biological function remains unknown. Using a biochemical approach, we have identified two polypeptides that bind to the WRN protein. Peptide sequence analysis indicates that the two proteins are identical to Ku70 and Ku80, a heterodimer involved in double strand DNA break repair by non-homologous DNA end joining. Protein-protein interaction studies reveal that WRN binds directly to Ku80 and that this interaction is mediated by the amino terminus of WRN. In addition, we show that the binding of Ku alters the specificity of the WRN exonuclease. These results suggest a potential involvement of WRN in the repair of double strand DNA breaks. Functional interaction between Ku and the Werner syndrome protein in DNA end processing.Journal of Biological ChemistryVol. 275Issue 50PreviewPage 28351: Fig. 2 Bwas inadvertently deleted. The complete figure and its legend are shown below. Full-Text PDF Open Access Werner syndrome Werner Syndrome protein homologous recombination non-homologous end joining double strand break dithiothreitol polyacrylamide gel electrophoresis hepatitis C virus Werner syndrome (WS)1 is a recessive autosomal disorder leading to premature aging (1Dyer C. Sinclair A. Age Ageing. 1998; 27: 73-80Crossref PubMed Scopus (38) Google Scholar). Individuals with WS develop accelerated atherosclerosis, osteoporosis, and a higher incidence of several types of tumors (2Goto M. Miller R.W. Ishikawa Y. Sugano H. Cancer Epidemiol. Biomark. Prev. 1996; 5: 239-246PubMed Google Scholar, 3Epstein C.J. Martin G.M. Schultz A.L. Motulsky A.G. Medicine. 1966; 45: 177-221Crossref PubMed Scopus (745) Google Scholar, 4Martin G.M. Birth Defects Orig. Artic Ser. 1978; 14: 5-39PubMed Google Scholar). Somatic cells of WS patients display a shortened replicative life span and elevated rates of chromosome translocation, rearrangements, and deletions (5Salk D. Au K. Hoehn H. Martin G.M. Adv. Exp. Med. Biol. 1985; 190: 541-550Crossref PubMed Scopus (53) Google Scholar,6Fukuchi K. Martin G.M. Monnat R.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5893-5897Crossref PubMed Scopus (391) Google Scholar). The gene defective in WS has been identified and encodes a protein that possesses both exonuclease and helicase activities (7Gray M. Shen J.C. Kamath-Loeb A. Blank A. Sopher B. Martin G. Oshima J. Loeb L. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (523) Google Scholar, 8Huang S. Li B. Gray M. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (376) Google Scholar, 9Kamath-Loeb A. Shen J.C. Loeb L. Fry M. J. Biol. Chem. 1998; 273: 34145-34150Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar, 10Shen J.C. Gray M. Oshima J. Loeb L. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (182) Google Scholar, 11Shen J.C. Gray M. Oshima J. Kamath-Loeb A. Fry M. Loeb L. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 12Suzuki N. Shimamoto A. Imamura O. Kuromitsu J. Kitao S. Goto M. Furuichi Y. Nucleic Acids Res. 1997; 25: 2973-2978Crossref PubMed Scopus (195) Google Scholar, 13Yu C.E. Oshima J. Fu Y.H. Wijsman E. Hisama F. Alisch R. Matthews S. Nakura J. Miki T. Ouais S. Martin G. Mulligan J. Schellenberg G. Science. 1996; 272: 258-262Crossref PubMed Scopus (1496) Google Scholar). A nuclear localization signal has also been identified at its carboxyl-terminal end. All the WS mutations that have been identified result in a nonsense mutation or frameshift, leading to a predicted truncated protein. Thus, it is thought that the truncated protein fails to enter the nucleus and is subsequently degraded. Immunocytochemical studies have localized the Werner syndrome protein (WRN) in the nucleoli of actively growing human cells, whereas serum deprivation causes a relocalization to the nucleus (14Marciniak R.A. Lombard D.B. Johnson F.B. Guarente L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6887-6892Crossref PubMed Scopus (180) Google Scholar, 15Gray M.D. Wang L. Youssoufian H. Martin G.M. Oshima J. Exp. Cell Res. 1998; 242: 487-494Crossref PubMed Scopus (124) Google Scholar). Despite all the available information, the cellular function of WRN remains unknown (16Fry M. Loeb L. Nat. Genet. 1998; 19: 308-309Crossref PubMed Scopus (18) Google Scholar). To understand the molecular basis of WS, we searched for nuclear factors that associate with the WRN protein. Here we report that WRN interacts with the Ku70/80 heterodimer (Ku), a factor involved in the repair of DNA double strand breaks (DSBs) (17Ramsden D.A. Gellert M. EMBO J. 1998; 17: 609-614Crossref PubMed Scopus (248) Google Scholar, 18Lieber M. Am. J. Pathol. 1998; 153: 1323-1332Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 19Kanaar R. Hoeijmakers J. Gent D. Cell Biol. 1998; 8: 483-491Scopus (458) Google Scholar, 20Critchlow S. Jackson S.P. Trends Biochem. Sci. 1998; 23: 394-398Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). More importantly, our results show that the exonuclease activity of WRN on 3′-recessed DNA ends is strongly stimulated by Ku. Moreover, in the presence of Ku, WRN can efficiently process both blunt-ended DNA and the 3′-protruding strand of a partial duplex DNA. These results suggest that WRN, through direct physical interaction with the Ku70/80 heterodimer, may be involved in processing of DSBs, providing a link between DNA repair and aging. SF9 cells were infected with recombinant baculoviruses encoding Flag-tagged WRN. The cells were harvested three days postinfection, and whole cell lysates were prepared in RIPA buffer (50 mm Tris (pH 7.9), 150 mm NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxycholate, 1 mm DTT, 1 mm phenylmethylsulfonyl fluoride). Flag-tagged WRN or Flag-tagged HCV polymerase were immobilized on anti-Flag beads and then incubated with nuclear extracts from HeLa cells at 4 °C for 1 h. Bound proteins were then eluted from the beads with BCO buffer (1 m KCl, 10 mm Tris-HCl (pH 7.5), 1 mm EDTA, 5% glycerol, 1 mm DTT, and a mixture of protease inhibitors). The eluted proteins were precipitated with trichloroacetic acid, washed with acetone, and then resolved by 8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Bound proteins were visualized by silver staining. For protein sequencing, the preparation of the associated proteins was accomplished starting from approximately 10 mg of HeLa nuclear extracts. The proteins were separated by SDS-PAGE and stained with Coomassie Blue. After extensive destaining, the protein bands were excised from the gel and sent to the Biopolymers Facilities (Dr. John Rush, Howard Hughes Medical Institute, Harvard Medical School) for peptide sequencing. Sixteen peptides derived from the 65-kDa polypeptide (DSLIFLVDASK, DLLAVVFYGTEK, NIYVLQELDNPGAK, ILELDQFK, IMLFTNEDNPHGNDSAK, DTGIFLDLMHLK, KPGGFDISLFYR, DIISIAEDEDLR, VHFEESSK, LEDLLR, TFNTSTGGLLLPSDTK, SQIYGSR, SDSFENPVLQQHFR, ELVYPPDYNPEGK, VEYSEEELK, KQELLEALTK) and ten peptides derived from the 90-kDa polypeptide (HIEIFTDLSSR, SQLDIIIHSLK, LGGHGPSFPLK, LTIGSNLSIR, YGSDIVPFSK, FFMGNQVLK, ANPQVGVAFPHIK, TDTLEDLFPTTK, TLFPLIEAK, AFREEAIK) were sequenced. Recombinant Flag-WRN proteins were expressed with a baculovirus system. Whole cell lysates were prepared with lysis buffer (0.5% Nonidet P-40, 1.5 mmMgCl2, 10 mm Hepes (pH 7.5), 100 mmNaCl). Flag-WRN protein was purified through the DEAE-cellulose column and further purified by affinity chromatography on anti-Flag resin. Recombinant Ku70 bearing an amino-terminal polyhistidine (His) epitope tag and Ku80 baculoviruses were used to co-infect SF9 cells, and 48 h after infection, cell lysates were prepared using lysis buffer. Ku70/80 complex was purified by metal affinity (Talon,CLONTECH) and DNA cellulose chromatography. For the purification of Ku80, lysates from insect cells expressing recombinant Ku80 were incubated with immobilized Flag-WRN beads. After extensive washes, bound Ku80 was eluted with BCO buffer. Purified proteins were dialyzed in dialysis buffer (10 mm Tris (pH 7.9), 80 mm NaCl, 4 mm KCl, 1.5 mmMgCl2, 1 mm EDTA, 10% glycerol). Nuclear extracts from HeLa cells were prepared as described in Ref. 21Comai L. Tanese N. Tjian R. Cell. 1992; 68: 965-976Abstract Full Text PDF PubMed Scopus (309) Google Scholar. Immunoprecipitation was carried out with anti-WRN antibodies (Santa Cruz Biotechnology Inc.). Immunoprecipitation products were resolved by SDS-PAGE and transferred to nitrocellulose. Western blot analysis was performed using anti-WRN and anti-Ku80 antibodies (Santa Cruz Biotechnology Inc.). DNA exonuclease activity was measured with the following DNA substrates: 20-oligomer A1 (CGCTAGCAATATTCTGCAGC), 20-oligomer A2 (GCTGCAGAATATTGCTAGCG) complementary to A1, and 46-oligomer A3 (GCGCGGAAGCTTGGCTGCAGAATATTGCTAGCGGGAAATCGGCGCG) partially complementary to A1. Oligonucleotides were labeled at the 5′ end with [32P]ATP. The appropriate oligonucleotides were annealed by boiling and slow cooling to room temperature. Reaction mixtures contained 40 mm Tris-HCl (pH 7.5), 4 mmMgCl2, 5 mm DTT, 1 mm ATP, 0.1 mg/ml bovine serum albumin, DNA substrates (∼30 fmol, 100,000 cpm), and 5 ng of WRN protein, 5 ng of Ku70, 5 ng of Ku80, or 5 ng of Ku70/80 in a final volume of 10 μl. The reaction mixtures were incubated at room temperature for 10 min, and then the reactions were terminated by the addition of 2 μl of a formamide-dye solution (95% formamide, 50 mm EDTA, 0.5% bromphenol blue, 0.5% xylene cyanol). After incubation at 95 °C for 3 min, DNA products were resolved by either 12 or 16% polyacrylamide-urea gel electrophoresis and visualized by autoradiography. To identify nuclear proteins that interact with WRN, HeLa nuclear extracts were incubated with Flag-tagged WRN protein immobilized on anti-Flag resin. In parallel, HeLa nuclear extracts were also incubated with Flag-tagged HCV polymerase and anti-Flag resin only. Analysis by SDS-PAGE and silver staining revealed that two polypeptides of approximately 65 and 90 kDa (Fig.1 A, lane 2) respectively, were eluted specifically from the Flag-WRN resin. Neither the 65- nor the 90-kDa protein was present in the eluates from the control resins (Fig. 1 A, lanes 1 and3). Therefore, they are likely to represent specific cellular partners of the WRN protein. To ensure that DNA did not mediate the interaction between WRN and the two polypeptides, the experiment was also carried out with nuclear extracts treated with DNase I, yielding identical results. To identify the two polypeptides, bands were excised from the gel and digested with protease, and the resulting peptides were subjected to electrospray ionization/ion trap mass spectrometry. The results of the peptide sequencing indicated that the 65- and the 90-kDa proteins were identical to human Ku70 and Ku80, respectively (Fig. 1 B). Ku70/80 is a heterodimer with high affinity for DNA ends, and it has been shown to be involved in DNA double strand break repair by non-homologous DNA end joining (NHEJ) and V(D)J recombination (17Ramsden D.A. Gellert M. EMBO J. 1998; 17: 609-614Crossref PubMed Scopus (248) Google Scholar, 18Lieber M. Am. J. Pathol. 1998; 153: 1323-1332Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 19Kanaar R. Hoeijmakers J. Gent D. Cell Biol. 1998; 8: 483-491Scopus (458) Google Scholar). To determine which subunit of the Ku heterodimer interacts with the WRN protein, we performed co-infection in SF9 cells using recombinant baculoviruses expressing Flag-tagged WRN and either Ku70, Ku80, Ku70/Ku80, or a wild-type baculovirus. After 48 h, cells were lysed and lysates were incubated with anti-Flag resin. After extensive washing, the bound proteins were eluted with BCO buffer and analyzed by SDS-PAGE and silver staining. Ku70/80 heterodimer interacted with the WRN protein, as determined by the presence of the 70- and 80-kDa polypeptides in the eluate from the anti-Flag immunoprecipitation (Fig.2, lane 2). Moreover, Ku80 alone also co-immunoprecipitated with WRN (Fig. 2, lane 3). In contrast, Ku70 did not associate with WRN because it was absent in the immunoprecipitation with anti-Flag resin (Fig. 2, lane 4). Thus, Ku80 mediates the molecular interaction between WRN and the Ku heterodimer. To provide further evidence that the WRN protein interacts with Kuin vivo, we immunoprecipitated endogenous WRN from HeLa nuclear extracts using antibodies against the WRN protein. As a control, β-actin antibodies were also used in parallel experiments. Western blot analysis indicated that Ku80 is present in the immunoprecipitation reaction with anti-WRN antibodies but absent from the control immunoprecipitation with β-actin antibodies. This result indicates that Ku80 is associated with the WRN protein in vivo. To define the domain of the WRN protein that interacted with Ku80, recombinant Ku80 was incubated with a series of Flag-tagged WRN deletion mutants. After extensive washing, bound proteins were resolved by SDS-PAGE and analyzed by Western blotting with antibodies against Ku80. The results of this experiment indicated that a specific region of WRN encompassing the amino-terminal amino acid sequence (amino acid residues 1 to 388) was sufficient for binding to Ku80 (Fig.3). In addition, this region of WRN can efficiently interact with Ku heterodimer (data not shown). In a recent study the carboxyl-terminal region of WRN (amino acids 940 to 1432) was used to isolate Ku from HeLa nuclear extracts, leading to the interpretation that this region of WRN interacts directly with Ku (22Cooper M.P. Machwe A. Orren D.K. Brosh R.M. Ramsden D. Bohr V.A. Genes Dev. 2000; 14: 907-912PubMed Google Scholar). Because WRN can form dimers or higher order multimers (19Kanaar R. Hoeijmakers J. Gent D. Cell Biol. 1998; 8: 483-491Scopus (458) Google Scholar), it is possible that the reported interaction between the carboxyl-terminal region of WRN and Ku may be mediated by full-length WRN or other uncharacterized cellular proteins. The WRN protein possesses 3′ to 5′ exonuclease activity, and this activity has been shown to specifically hydrolyze 3′-recessed strands in a partial DNA duplex (8Huang S. Li B. Gray M. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (376) Google Scholar, 9Kamath-Loeb A. Shen J.C. Loeb L. Fry M. J. Biol. Chem. 1998; 273: 34145-34150Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). The finding that the WRN protein interacts with Ku70/80 prompted us to ask whether Ku70/80 affects WRN exonuclease activity. To test this hypothesis, we performed DNA exonuclease assays with recombinant WRN protein in the presence of Ku70, Ku80, or Ku70/80 heterodimer. As previously shown, WRN can weakly hydrolyze 3′-recessed DNA ends (Fig.4 A, lane 4). However, as also shown in a recent report (22Cooper M.P. Machwe A. Orren D.K. Brosh R.M. Ramsden D. Bohr V.A. Genes Dev. 2000; 14: 907-912PubMed Google Scholar), in the presence of Ku70/80 heterodimer, the WRN exonuclease activity was strongly stimulated (Fig. 4 A, lane 7). This dramatic activation was strictly dependent on a functional Ku heterodimer, because in the presence of either Ku70 or Ku80 alone, the stimulation was abolished (Fig. 4 A, lanes 5 and6). We then examined whether the Ku70/80 heterodimer could also activate the WRN exonuclease activity on blunt-end and 3′-protruding DNA substrates. As reported by others, the WRN protein does not digest either 3′-protruding (Fig. 4 B, lane 4) or blunt-end DNA substrates (Fig. 4 C, lane 4). However, in the presence of a Ku70/80 heterodimer, WRN exonuclease activity was active on both 3′-protruding ends (Fig.4 B, lane 7) and blunt-end DNA molecules (Fig.4 C, lane 7). Therefore, these results indicate that direct interaction between the WRN protein and Ku70/80 strongly stimulates the 3′-exonuclease activity on 3′-recessed DNA substrates. In addition, the presence of Ku70/80 induces rapid processing of blunt end and 3′-protruding end DNA by the WRN exonuclease. The functional interaction between Ku70/80 and WRN protein provides a biochemical basis for the phenotypes of WRN−/− fibroblasts. WRN−/− cells exhibit large DNA deletions and chromosome rearrangements and are characterized by a shortened lifespan. Mouse cells deficient for Ku80 show elevated frequencies of chromosomal aberrations such as breakage, translocation, and aneuploidy (23DiFilippantonio M.J. Zhu J. Chen H.T. Meffre E. Nussenzweig M.C. Max E.E. Ried T. Nussenzweig A. Nature. 2000; 404: 510-514Crossref PubMed Scopus (473) Google Scholar, 24Karanjawala Z. Grawunder U. Hsieh C.L. Lieber M. Curr. Biol. 1999; 9: 1501-1504Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). In addition, Ku80 knock out mice display an early onset of age-specific changes that are reminiscent of Werner syndrome patients (25Vogel H. Lim D.S. Karsenty G. Finegold M. Hasty P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 10770-10775Crossref PubMed Scopus (312) Google Scholar). Taken together, these genetic analyses and our biochemical studies strongly support the idea that there is a functional interaction between Ku70/80 and the WRN protein. The finding that WRN binds to Ku70/80 suggests potential cellular functions for this protein. One possible scenario is that WRN is involved in some aspects of DNA DSB repair. In eukaryotic cells, DSBs can be caused by a variety of exogenous and endogenous agents. DSBs pose a major threat to the integrity of the genome, and if left unrepaired, they can cause cell death or neoplasia. DSBs are repaired either by using an intact copy of the broken region as a template (homologous recombination (HR)) or by direct rejoining of the broken ends (NHEJ). Both mechanisms operate in eukaryotic cells; however, it is thought that NHEJ is the prevalent pathway in higher eukaryotes. Many of the proteins involved in HR have been identified. These include Rad50, an ATP-dependent DNA-binding protein, Mre11, a double-stranded DNA 3′-exonuclease and single-stranded endonuclease, and NBS1, a protein that is specifically mutated in patients with Nijmegen breakage syndrome (19Kanaar R. Hoeijmakers J. Gent D. Cell Biol. 1998; 8: 483-491Scopus (458) Google Scholar, 20Critchlow S. Jackson S.P. Trends Biochem. Sci. 1998; 23: 394-398Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). Mre11 is thought to function in the resection of DSB ends in HR, and the Rad50-Mre11-NBS1 complex has been proposed to serve a crucial function in the recognition of double strand DNA breaks (26Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar). In contrast to HR, NHEJ does not require homology with a second DNA duplex. Biochemical analyses have established that Ku binds to the ends of broken DNA and plays a direct role in NHEJ (18Lieber M. Am. J. Pathol. 1998; 153: 1323-1332Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 19Kanaar R. Hoeijmakers J. Gent D. Cell Biol. 1998; 8: 483-491Scopus (458) Google Scholar, 20Critchlow S. Jackson S.P. Trends Biochem. Sci. 1998; 23: 394-398Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). Upon binding of Ku to the DNA end, the DNA-dependent protein kinase is recruited to the DNA-Ku complex. DNA-dependent protein kinase can phosphorylate itself and Ku; however the functional significance of these modifications remains to be determined. Most double strand DNA breaks are not blunt ends but have single-stranded overhangs; therefore the DNA ends must be trimmed by exonucleases and/or endonucleases before they can be rejoined (20Critchlow S. Jackson S.P. Trends Biochem. Sci. 1998; 23: 394-398Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). Mre11 has been proposed to play a role in NHEJ in yeast; however it remains to be demonstrated whether it also functions in NHEJ in higher eukaryotes. The WRN protein contains a 3′ to 5′ exonuclease activity and interacts with Ku in vivo and in vitro; therefore, WRN may be involved in nucleolytic processing of double strand DNA ends. An alternative hypothesis is derived from the observation that the yeast Ku 70/80 heterodimer (yKu) is found associated with the chromosome ends, and it has been proposed that yKu helps cap the telomeres and/or regulating 3′ end processing enzymes (27Tham W.-H. Zakian V.A. Nature. 2000; 403: 34-35Crossref PubMed Scopus (8) Google Scholar). More recently, the Ku70/80 complex has also been proposed to be required for capping the ends of mammalian chromosome (28Hsu H., L. Gilley D. Blackburn E. Chen D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12454-12458Crossref PubMed Scopus (275) Google Scholar, 29Bailey S.M. Meyne J. Chen D., J. Kurimasa A. Li G.C. Lehnert B.E. Goodwin E.H. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14899-14904Crossref PubMed Scopus (349) Google Scholar). Therefore, it is possible that the association between WRN and Ku70/80 may be involved in some aspects of telomere maintenance. We thank Dr. Y. Oshima, University of Washington, Seattle, for providing the WRN cDNA clone and Drs. J. D. Capra and M. Ono, Oklahoma Medical Research Foundation, Oklahoma City, for providing Ku70 and Ku80 recombinant baculoviruses. We would like to thank Dr. M. Lieber and members of the Comai laboratory for helpful discussions and critical reading of the manuscript." @default.
• W2000438077 created "2016-06-24" @default.
• W2000438077 creator A5025548879 @default.
• W2000438077 creator A5048816559 @default.
• W2000438077 date "2000-09-01" @default.
• W2000438077 modified "2023-09-27" @default.
• W2000438077 title "Functional Interaction between Ku and the Werner Syndrome Protein in DNA End Processing" @default.
• W2000438077 cites W119749093 @default.
• W2000438077 cites W1538603370 @default.
• W2000438077 cites W1540819637 @default.
• W2000438077 cites W1542472052 @default.
• W2000438077 cites W1940074648 @default.
• W2000438077 cites W1966347623 @default.
• W2000438077 cites W1971708555 @default.
• W2000438077 cites W1975817860 @default.
• W2000438077 cites W1995702418 @default.
• W2000438077 cites W2000912535 @default.
• W2000438077 cites W2005573768 @default.
• W2000438077 cites W2011320725 @default.
• W2000438077 cites W2045106090 @default.
• W2000438077 cites W2054689390 @default.
• W2000438077 cites W2058094663 @default.
• W2000438077 cites W2064310741 @default.
• W2000438077 cites W2080152855 @default.
• W2000438077 cites W2084712319 @default.
• W2000438077 cites W2089041372 @default.
• W2000438077 cites W2116217779 @default.
• W2000438077 cites W2123909581 @default.
• W2000438077 cites W2132000312 @default.
• W2000438077 cites W2153043528 @default.
• W2000438077 cites W2158820560 @default.
• W2000438077 cites W2170970288 @default.
• W2000438077 cites W2245671961 @default.
• W2000438077 doi "https://doi.org/10.1074/jbc.c000289200" @default.
• W2000438077 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10880505" @default.
• W2000438077 hasPublicationYear "2000" @default.
• W2000438077 type Work @default.
• W2000438077 sameAs 2000438077 @default.
• W2000438077 citedByCount "192" @default.
• W2000438077 countsByYear W20004380772012 @default.
• W2000438077 countsByYear W20004380772013 @default.
• W2000438077 countsByYear W20004380772014 @default.
• W2000438077 countsByYear W20004380772015 @default.
• W2000438077 countsByYear W20004380772016 @default.
• W2000438077 countsByYear W20004380772017 @default.
• W2000438077 countsByYear W20004380772018 @default.
• W2000438077 countsByYear W20004380772019 @default.
• W2000438077 countsByYear W20004380772020 @default.
• W2000438077 countsByYear W20004380772021 @default.
• W2000438077 countsByYear W20004380772022 @default.
• W2000438077 countsByYear W20004380772023 @default.
• W2000438077 crossrefType "journal-article" @default.
• W2000438077 hasAuthorship W2000438077A5025548879 @default.
• W2000438077 hasAuthorship W2000438077A5048816559 @default.
• W2000438077 hasBestOaLocation W20004380771 @default.
• W2000438077 hasConcept C104317684 @default.
• W2000438077 hasConcept C161223559 @default.
• W2000438077 hasConcept C185592680 @default.
• W2000438077 hasConcept C2778090637 @default.
• W2000438077 hasConcept C54355233 @default.
• W2000438077 hasConcept C552990157 @default.
• W2000438077 hasConcept C67705224 @default.
• W2000438077 hasConcept C70721500 @default.
• W2000438077 hasConcept C86803240 @default.
• W2000438077 hasConcept C95444343 @default.
• W2000438077 hasConceptScore W2000438077C104317684 @default.
• W2000438077 hasConceptScore W2000438077C161223559 @default.
• W2000438077 hasConceptScore W2000438077C185592680 @default.
• W2000438077 hasConceptScore W2000438077C2778090637 @default.
• W2000438077 hasConceptScore W2000438077C54355233 @default.
• W2000438077 hasConceptScore W2000438077C552990157 @default.
• W2000438077 hasConceptScore W2000438077C67705224 @default.
• W2000438077 hasConceptScore W2000438077C70721500 @default.
• W2000438077 hasConceptScore W2000438077C86803240 @default.
• W2000438077 hasConceptScore W2000438077C95444343 @default.
• W2000438077 hasIssue "37" @default.
• W2000438077 hasLocation W20004380771 @default.
• W2000438077 hasOpenAccess W2000438077 @default.
• W2000438077 hasPrimaryLocation W20004380771 @default.
• W2000438077 hasRelatedWork W1991523530 @default.
• W2000438077 hasRelatedWork W2002128513 @default.
• W2000438077 hasRelatedWork W2016731570 @default.
• W2000438077 hasRelatedWork W2020824267 @default.
• W2000438077 hasRelatedWork W2031436818 @default.
• W2000438077 hasRelatedWork W2057739827 @default.
• W2000438077 hasRelatedWork W2075354549 @default.
• W2000438077 hasRelatedWork W2095919671 @default.
• W2000438077 hasRelatedWork W2147710629 @default.
• W2000438077 hasRelatedWork W2092874662 @default.
• W2000438077 hasVolume "275" @default.
• W2000438077 isParatext "false" @default.
• W2000438077 isRetracted "false" @default.
• W2000438077 magId "2000438077" @default.
• W2000438077 workType "article" @default.