FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000443365> ?p ?o ?g. }

• W2000443365 endingPage "20483" @default.
• W2000443365 startingPage "20475" @default.
• W2000443365 abstract "SCF ubiquitin ligases play a pivotal role in the regulation of cell division and various signal transduction pathways, which in turn are involved in cell growth, survival, and transformation. SCF(TrCP) recognizes the double phosphorylated DSGΦXS destruction motif in β-catenin and IκB. We show that the same ligase drives endocytosis and degradation of the growth hormone receptor (GHR) in a ligand-independent fashion. The F-box protein β-TrCP binds directly and specifically with its WD40 domain to a novel recognition motif, previously designated as the ubiquitin-dependent endocytosis motif. Receptor degradation requires an active neddylation system, implicating ubiquitin ligase activity. GHR-TrCP binding, but not GHR ubiquitination, is necessary for endocytosis. TrCP2 silencing is more effective on GHR degradation and endocytosis than TrCP1, although overexpression of either isoform restores TrCP function in silenced cells. Together, these findings provide direct evidence for a key role of the SCF(TrCP) in the endocytosis and degradation of an important factor in growth, immunity, and life span regulation. SCF ubiquitin ligases play a pivotal role in the regulation of cell division and various signal transduction pathways, which in turn are involved in cell growth, survival, and transformation. SCF(TrCP) recognizes the double phosphorylated DSGΦXS destruction motif in β-catenin and IκB. We show that the same ligase drives endocytosis and degradation of the growth hormone receptor (GHR) in a ligand-independent fashion. The F-box protein β-TrCP binds directly and specifically with its WD40 domain to a novel recognition motif, previously designated as the ubiquitin-dependent endocytosis motif. Receptor degradation requires an active neddylation system, implicating ubiquitin ligase activity. GHR-TrCP binding, but not GHR ubiquitination, is necessary for endocytosis. TrCP2 silencing is more effective on GHR degradation and endocytosis than TrCP1, although overexpression of either isoform restores TrCP function in silenced cells. Together, these findings provide direct evidence for a key role of the SCF(TrCP) in the endocytosis and degradation of an important factor in growth, immunity, and life span regulation. Understanding how metabolism of cells and organisms is regulated and how this connects to the regulation of longevity, cell cycle, apoptosis, and immunity are major challenges of modern biology (1Sinclair D.A. Mech. Ageing Dev. 2005; 126: 987-1002Crossref PubMed Scopus (474) Google Scholar). Growth hormone (GH) 2The abbreviations used are: GH, growth hormone; GHR, growth hormone receptor; UbE, ubiquitin-dependent endocytosis; GST, glutathione S-transferase; mAb, monoclonal antibody; siRNA, small interfering RNA; GFP, green fluorescent protein; E3, ubiquitin-protein isopeptide ligase; E2, ubiquitin carrier protein; ER, endoplasmic reticulum; βTrCP, β-transducing repeat-containing protein. and its receptor (GHR) act at these crossroads as becomes apparent in the current study in which we show that a regulator of cell cycle and immunity appears to regulate GH sensitivity of cells. All cells of the human body contain GHRs. Upon GH binding, these receptors initiate signal transduction that results in expression of genes involved in anabolic processes, including increased protein synthesis, lipid degradation, immune function, muscle mass, bone turnover, and tooth development (2Waters M. The Growth Hormone Receptor. Oxford University Press, New York1999: 445-480Google Scholar). The GHR was the first class one cytokine receptor to be cloned (3Leung D.W. Spencer S.A. Cachianes G. Hammonds R.G. Collins C. Henzel W.J. Barnard R. Waters M.J. Wood W.I. Nature. 1987; 330: 537-543Crossref PubMed Scopus (1327) Google Scholar). Signal transduction of class-one cytokine receptors recruits members of the Janus kinase family tyrosine kinases that bind to a proline-rich motif in the intracellular membrane-proximal domain, the box 1 motif (4Argetsinger L.S. Campbell G.S. Yang X.N. Witthuhn B.A. Silvennoinen O. Ihle J.N. Carter Su C. Cell. 1993; 74: 237-244Abstract Full Text PDF PubMed Scopus (823) Google Scholar). For the GHR, Jak2 acts as initiator of several signaling cascades, including Stat activation. Box 1-related activities contribute little to GHR endocytosis (5Alves dos Santos C.M. ten Broeke T. Strous G.J. J. Biol. Chem. 2001; 276: 32635-32641Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). For receptor tyrosine kinases, both signal transduction and receptor abundance are regulated by their ligands: epidermal growth factor, c-kit, insulin and Notch binding initiate not only signal transduction, they also induce a swift degradation of their receptors. For cytokine receptors, these two parameters seem to have their own independent regulating mechanism. There is good evidence that the GH sensitivity of cells is mainly regulated via the ubiquitin-dependent endocytosis motif (UbE motif) in the cytokine receptor box 2 region (6Strous G.J. dos Santos C.A. Gent J. Govers R. Sachse M. Schantl J. van Kerkhof P. Curr. Top. Microbiol. Immunol. 2004; 286: 81-118PubMed Google Scholar). Mutation of the UbE motif (DDSWVEFIELD) leads to a dramatic drop in endocytosis and lysosomal degradation, rendering the cells more GH-sensitive. The ubiquitin-proteasome system provides the major pathway for nonlysosomal degradation (reviewed in Ref. 7Hershko A. Ciechanover A. Varshavsky A. Nat. Med. 2000; 6: 1073-1081Crossref PubMed Scopus (570) Google Scholar). The F-box protein β-transducing repeat-containing protein (βTrCP) serves as the substrate recognition subunit in the SCF(βTrCP) ligase (8Winston J.T. Strack P. Beer-Romero P. Chu C.Y. Elledge S.J. Harper J.W. Genes Dev. 1999; 13: 270-283Crossref PubMed Scopus (811) Google Scholar). Classical examples of substrates are β-catenin, NFκB, and IκB (inhibitor of NFκB). Two isoforms exist; βTrCP1 is mainly present in the nucleus, whereas βTrCP2 resides in the cytosol (9Suzuki H. Chiba T. Kobayashi M. Takeuchi M. Suzuki T. Ichiyama A. Ikenoue T. Omata M. Furuichi K. Tanaka K. Biochem. Biophys. Res. Commun. 1999; 256: 127-132Crossref PubMed Scopus (104) Google Scholar). These ligases play a pivotal role in cell division and various essential signal transduction pathways for tumorigenesis. Their substrate binding motifs consist of seven propeller-shaped WD40 domains that specifically bind short motifs in its central cavity. These motifs generally are 6 amino acid residues long with a common structure of DSGX2+nS. To be recognized by the SCF(βTrCP), both serine residues need to be phosphorylated. Recently, it became evident that, for a restricted number of plasma membrane proteins, ubiquitination triggers internalization and vacuolar/lysosomal rather than proteasomal degradation (reviewed in Ref. 10Traub L.M. Lukacs G.L. J. Cell Sci. 2007; 120: 543-553Crossref PubMed Scopus (80) Google Scholar). This pathway is best understood in yeast, where a number of plasma membrane proteins are endocytosed in an ubiquitin-dependent manner (11Galan J.M. Haguenauer-Tsapis R. EMBO J. 1997; 16: 5847-5854Crossref PubMed Scopus (322) Google Scholar, 12Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (960) Google Scholar). Several studies have shown that monoubiquitination of plasma membrane proteins is sufficient to stimulate their endocytosis (11Galan J.M. Haguenauer-Tsapis R. EMBO J. 1997; 16: 5847-5854Crossref PubMed Scopus (322) Google Scholar, 13Roth A.F. Davis N.G. J. Biol. Chem. 2000; 275: 8143-8153Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). In mammalian cells, the GHR, the β-adrenergic receptor, and the epithelial sodium channel, ENaC, are examples of membrane proteins that endocytose in an ubiquitin system-dependent manner (14Shenoy S.K. McDonald P.H. Kohout T.A. Lefkowitz R.J. Science. 2001; 294: 1307-1313Crossref PubMed Scopus (713) Google Scholar, 15Staub O. Gautschi I. Ishikawa T. Breitschopf K. Ciechanover A. Schild L. Rotin D. EMBO J. 1997; 16: 6325-6336Crossref PubMed Scopus (598) Google Scholar, 16Strous G. Gent J. FEBS Lett. 2002; 529: 102-109Crossref PubMed Scopus (36) Google Scholar). In some cytokine receptors, the conserved DSGX2+nS motif serves as a degradation signal via the SCF(βTrCP) ligases. Both for the interferon-γ and the PrL receptor, it was shown that this E3 is involved in their degradation. An important finding in these studies was that receptor degradation mainly depends on ligand binding; in addition, phosphorylation at both serine residues of the degron was required (17Kumar K.G. Tang W. Ravindranath A.K. Clark W.A. Croze E. Fuchs S.Y. EMBO J. 2003; 22: 5480-5490Crossref PubMed Scopus (160) Google Scholar, 18Kumar K.G.S. Krolewski J.J. Fuchs S.Y. J. Biol. Chem. 2004; 279: 46614-46620Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 19Li Y. Suresh Kumar K.G. Tang W. Spiegelman V.S. Fuchs S.Y. Mol. Cell. Biol. 2004; 24: 4038-4048Crossref PubMed Scopus (76) Google Scholar). In the present study, we show that the UbE motif, deviant from the canonical βTrCP recognition motif, is specifically recognized by a functional SCF(βTrCP) complex and that this interaction is instrumental in the endocytosis and degradation of the GHR. Ubiquitination of the GHR is not required, since βTrCP silencing slows degradation of the GHR without lysine residues in the cytosolic tail as efficiently as wild type GHR. Materials—βTrCP1 and βTrCP2 cDNA in pcDNA3 expressing the FLAG-tagged proteins were generous gifts of Tomoki Chiba (Tokyo Metropolitan Institute of Medical Science). Full-length rabbit GHR cDNA in pcDNA3 was described (20Strous G.J. van Kerkhof P. Govers R. Ciechanover A. Schwartz A.L. EMBO J. 1996; 15: 3806-3812Crossref PubMed Scopus (265) Google Scholar). GST fusion proteins expressing GST-GHR-(271-334), and GST-GHR-(271-318) were produced as described (21Schantl J.A. Roza M. de Jong A.P. Strous G.J. Biochem. J. 2003; 373: 855-863Crossref PubMed Scopus (31) Google Scholar). pcDNA-GHR constructs used for alanine scanning of the UbE motif and GHR-(1-399), K271-362R, designated as GHR399-KallR, were constructed as described before (22Govers R. ten Broeke T. van Kerkhof P. Schwartz A.L. Strous G.J. EMBO J. 1999; 18: 28-36Crossref PubMed Scopus (170) Google Scholar). The following siRNA sense sequences were used to silence the following: both βTrCP1 and -2, GUGGAAUUUGUGGAACAUCtt (called “combi probe”); βTrCP1 only, GAUAAUACCAGAGAAGAAUtt; βTrCP2 only, GAGGCCAUCAGAAGGAAACtt; clathrin heavy chain, GCAAUGAGCUGUUUGAAGAUU; GFP and HPV E6/E7 (used as controls), GGCUACGUCCAGGAGCGCACC and CUAACUAACACUGGGUUAUtt, respectively. Dharmacon siGENOME SMARTpool's BTRC NM-003939 was used to silence βTrCP1, and FBXW11 (NM-012300) was used to silence βTrCP2. QuikChange mutagenesis primers to introduce three silent mutations in the target sequence of βTrCP1 for combi TrCP, 5′-TGGTCAGAGTCAGATCAAGTGGAGTTCGTCGAACATCTTATATCCCAAATGTG-3′, and to introduce three silent mutations in the target sequence of TrCP2 for combi βTrCP, 5′-TGGTCTGAATCAGATCAAGTGGAGTTCGTCGAACATCTTATTTCACGAATGTG-3′. Chemically synthesized siRNA duplexes were purchased from Ambion (Austin, TX). Antibody, recognizing the cytoplasmic domain of the GHR, was raised against amino acids 271-318 of the cytosolic tail of the GHR (23van Kerkhof P. Govers R. Alves dosSantos C.M.A. Strous G.J. J. Biol. Chem. 2000; 275: 1575-1580Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar). Antibody (mAb 5) against the extracellular domain of the GHR was from Agen (Acacia Ridge, Australia), goat anti-mouse IgG Alexa680 was from Molecular Probes, Inc., and goat anti-rabbit IgG IRDye800 was from Rockland Immunochemicals Inc. (Gilbertsville, PA). Mouse monoclonal anti-FLAG (M2) was from Sigma. The polyclonal anti-βTrCP1 serum was raised in rabbits against a βTrCP1 peptide consisting of amino acids 1-93 fused to glutathione S-transferase. The fusion protein was produced by cloning the DNA encoding amino acids 1-93 of TrCP1 into vector pGEX1λt, after which the construct was expressed in Escherichia coli. Immobilized streptavidin was from Pierce, glutathione-Sepharose was from Amersham Biosciences, and Ni2+-nitrilotriacetic acid-agarose was from Qiagen. Culture media, fetal calf serum, l-glutamine, and antibiotics for tissue culture were purchased from Invitrogen. Cell Culture—Hek293 and ts41 cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 0.1 mg/ml streptomycin. Hek293 cells stably expressing the wild type GHR (Hek-wtGHR) were grown in the same medium supplemented with 0.6 mg/ml Geneticin (G418; Invitrogen). All cells used were grown at 37 °C with 5.0% CO2. Twice a week, cells were washed with phosphate-buffered saline (PBS), detached from the flask with trypsin-EDTA (Invitrogen), diluted in fresh growth medium, and split into new culture flasks. Transfections—Cells were transfected using Lipofectamine 2000 (Invitrogen). Seventy percent confluent cultures were transfected with 0.2-0.9 μg of DNA in 12-well plates according to the manufacturer's protocol. Transfected cells were used for Western blot experiments and 125I-GH binding experiments 1-2 days after transfection. For fluorescence microscopy cells were transfected with Fugene-6 (Roche Applied Science). To silence the expression of both βTrCPs, Hek-wtGHR cells were transfected with small interfering RNA (siRNA) using Lipofectamine 2000 according to the description of the manufacturer; 3 days after transfection, cells were used for Western blot and 125I-GH binding experiments. Control cells were transfected with siRNA-GFP. To control the effect of the gene expression silencing, Hek293 cells were transiently transfected with a pcDNA3-FLAG-βTrCP. Western blots were analyzed using an Odyssey infrared imaging system (Li-Cor Biosciences, Lincoln, NE). 125I-GH Binding and Internalization—125I-Human GH was prepared using chloramine T (20Strous G.J. van Kerkhof P. Govers R. Ciechanover A. Schwartz A.L. EMBO J. 1996; 15: 3806-3812Crossref PubMed Scopus (265) Google Scholar). For internalization experiments, cells, grown in poly-d-lysine-coated 12-well plates, were washed with 1 ml of minimal essential medium supplemented with 20 mm Hepes, pH 7.4, and 0.1% bovine serum albumin, and incubated at 37 °C in a water bath for 1 h. After washing the cells three times with ice-cold PBS-complete (PBS-c: PBS with 0.135 g/liter CaCl2 and 0.1 g/liter MgCl2), 0.75 ml 125I-GH (180 ng/ml in Mem/Hepes/0.1% bovine serum albumin) was added to the cells. 125I-GH was bound for 2 h on ice. Unbound 125I-GH was aspirated and the cells were washed three times with PBS-c. Cells were incubated 10 min at 37 °C in minimal essential medium, Hepes, 0.1% bovine serum albumin to allow receptor internalization and washed three times with ice-cold PBS-c. Membrane associated 125I-GH was removed by treating the cells twice with 750 μl acid wash (0.15 m NaCl, 50 mm glycine, 0.1% bovine serum albumin, pH 2.5) for 5 min on ice. Acid wash was collected in counting tubes, and radioactivity was measured using a LKB γ counter. Cells were solubilized overnight in 1 n NaOH. Internalized 125I-GH was determined by measuring the radioactivity in the collected NaOH. Unspecific counts were determined by incubating the cells with 125I-GH together with excess unlabeled GH (9 μg/ml). Internalization is expressed as a percentage of the total specific radioactivity after 10 min at 37 °C. In Vitro Binding Assay—Wild-type and mutant GHR proteins were expressed in Hek293, and the cells were lysed in 50 mm Tris-HCl (pH 7.5), 0.15 or 1.0 m NaCl, 50 mm NaF, and 0.5% Nonidet P-40. The receptors were purified with biotinylated GH and streptavidin beads and stringently washed with lysis buffer. The beads were incubated with in vitro translated and 35S-labeled βTrCP2 for 60 min at 4 °C and extensively washed with lysis buffer, and associated proteins were analyzed by SDS-PAGE and autoradiography. cDNA of βTrCP2 constructs in pcDNA3.1/FLAG was used in an in vitro transcription translation system supplemented with [35S]methionine and TNT®-T7 coupled reticulocyte lysate ready reaction mix according to the instructions of the manufacturer (Promega). Binding to GHR-(1-286) was taken as background. To analyze GHR-containing protein complexes at the cell surface, the cells were incubated with biotinylated GH on ice. To recover all GHR-protein complexes from cells, the cells were first lysed and then incubated with biotinylated GH. Equal amounts of cell lysates were incubated for 1 h at 4 °C with equal amounts of GST-GHR-(271-334) or GST-GHR-(271-286) bound to GSH beads. Beads were pelleted in an Eppendorf centrifuge and washed three times with 1 ml of lysis buffer and twice with PBS containing protease inhibitors. The beads were boiled in 2× sample buffer. Samples were subjected to SDS-PAGE. Proteins associated with the GST fusion proteins were visualized by autoradiography. To analyze equal loading of the fusion proteins, the gels were stained with Coomassie Brillant Blue and analyzed using an Odyssey imaging system. Production of GST-GHR Fusion Proteins—pGEX-GHR plasmids were used to express GST-GHR fusion proteins in E. coli (strain BL21) (21Schantl J.A. Roza M. de Jong A.P. Strous G.J. Biochem. J. 2003; 373: 855-863Crossref PubMed Scopus (31) Google Scholar). The synthesis of recombinant proteins was induced by isopropyl-1-thio-β-d-galactopyranoside. GST fusion proteins were purified with GSH-beads (Amersham Biosciences) by the procedure recommended by the manufacturer. Immune Fluorescence Microscopy—Cy3-GH was prepared using a Fluorolink-Cy3 label kit according to the supplier's instructions (Amersham Biosciences). Transfected cells, grown on coverslips, were incubated for 15 min with Cy3-GH (1 μg/ml) and/or Alexa488-labeled transferrin (5 μg/ml). Cells were washed with PBS to remove unbound label and fixed for 2 h in 3% paraformaldehyde in phosphate-buffered saline. After fixation, the cells were embedded in Mowiol, and confocal laser-scanning microscopy was performed using a Leica TCS 4D system. Expression of βTrCP Is Required for GHR Endocytosis—Endocytosis of the GHR depends on the ubiquitination machinery, implicating the involvement of an ubiquitin ligase. Since recent studies show that βTrCP is involved in the degradation of certain cytokine receptors, we used small interfering RNA to silence both βTrCP isoforms and study the effects on GHR turnover. Fig. 1A shows that siRNA for βTrCP inhibits GH uptake to the same extent as silencing of clathrin heavy chain: ∼50% as compared with nonrelevant siRNA(GFP). In this experiment, the clathrin heavy chain Western blot signal was reduced to 4% compared with siRNA(GFP)-treated cells. Expression of co-transfected FLAG-tagged βTrCP2 was reduced to 10% using the “combi” silencing oligonucleotides that silence both TrCP1 and TrCP2 (Fig. 1B). We conclude that βTrCP is involved in endocytosis of the GHR. At steady state, almost all (mature, 130-kDa) GHRs are present at the cell surface. To visualize the effect of βTrCP silencing on endocytosis, we incubated the cells with both Cy3-labeled GH and Alexa-488-labeled transferrin. Fig. 1C shows that silencing both βTrCP isoforms resulted in a strong increase of Cy3-GH at the plasma membrane, whereas transferrin recycling remained intact, excluding a general effect on clathrin-mediated endocytosis. These results demonstrate that βTrCP is an obligatory part of the GHR endocytosis machinery. Since both GH and transferrin are endocytosed via clathrin-coated vesicles (24van Kerkhof P. Sachse M. Klumperman J. Strous G.J. J. Biol. Chem. 2000; 276: 3778-3784Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), it suggests that βTrCP is part of the cargo selection complex for the GHR. An obvious consequence of endocytosis inhibition is an accumulation of GHRs at the cell surface. In Fig. 1D, lanes 1 and 2, we used Hek293 cells transfected with GHR DNA and silenced for both βTrCP isoforms. To measure the amount of GHRs at the cell surface, the cells were incubated with biotin-GH, and the GH-GHR complexes were isolated and quantitated. siRNA(βTrCP) treatment caused a 2-3-fold increase in GHR at the cell surface. To ascertain that the increase was not due to a silencing effect on the amount GHRs synthesized, metabolic labeling with [35S]methionine was performed and showed that the GHR synthesis was not changed (not shown). The cellular concentration of βTrCP1 was measured on Western blots (Fig. 1D). By this method, using an optimized protocol for βTrCP, we obtained ∼90% silencing. Using this silencing oligonucleotide, βTrCP2 was silenced to the same extent (Fig. 1B). Previous studies have shown that by inhibiting GHR endocytosis through (mutation of) the UbE motif, maximally 60% inhibition of GHR endocytosis was achieved compared with removal of the GHR tail, including the complete UbE motif. Apparently, both βTrCP and clathrin silencing were insufficient to overcome this half-maximal effect on GHR turnover. Combining the two siRNAs did not result in more endocytosis inhibition. In agreement with our previous experience, these effects are too limited to measure half-life differences in dynamic experiments successfully (e.g. using pulse-chase protocols) (21Schantl J.A. Roza M. de Jong A.P. Strous G.J. Biochem. J. 2003; 373: 855-863Crossref PubMed Scopus (31) Google Scholar). As an important control, based on our previous observations that the GHR itself is not an obligatory ubiquitination target, we used a GHR truncated at amino acid residue 399, in which all 10 lysines are replaced by arginine residues (GHR-(1-399) K271-362R) (22Govers R. ten Broeke T. van Kerkhof P. Schwartz A.L. Strous G.J. EMBO J. 1999; 18: 28-36Crossref PubMed Scopus (170) Google Scholar). Fig. 1D, lanes 3-6, shows that TrCP silencing induces a 2-3-fold increase in cell surface GHRs whether or not lysine residues are present in the receptor tail. To control the experiments of Fig. 1D for equal transfection efficiencies, we co-transfected GFP DNA in all situations and analyzed the cell lysates for GFP; under all (silencing) conditions and various DNA constructs, the transfection efficiency was identical within measurement limits (Fig. 1D, bottom). Since we previously concluded that GHR internalization requires the recruitment of the ubiquitin conjugation system to the GHR UbE motif rather than the conjugation of ubiquitin to the GHR itself, we now conclude that βTrCP is a prime candidate to act as E3. Other Factors of the βTrCP-GHR Complex—Once we established that βTrCP is involved in GHR endocytosis and degradation, we asked whether βTrCP is in a protein complex with the GHR. Pull-down experiments with biotin-GH, depicted in Fig. 2A, show that both co-expressed full-length (lane 4) and mutant TrCP without the F-box domain (lane 5) were present in the isolated complexes. If His6-TrCP1 was used to isolate the protein complex (Fig. 2B), both ER and cell surface GHR were pulled down (lane 4). The interaction occurs intracellularly, as shown in an experiment in which GHR and His6-TrCP1 were expressed in different plates (lanes 1 and 5) and mixed after cell lysis (lane 3). Under these conditions (low cellular concentrations, low temperature, and short time periods) βTrCP does not interact with GHR. Thus, TrCP is in a protein complex with GHR, probably already in the ER. βTrCP generally acts as subunit of a SCF ubiquitin ligase. To examine the functional complex in GHR endocytosis, we co-transfected βTrCP2 and Skp1 together with the GHR. Pull-down experiments with biotinylated GH and Western blot analysis of the isolated complex revealed that Skp1 interacted with GHR only in the presence of βTrCP (Fig. 2A, lane 4). In the absence of βTrCP (lane 6) or in the presence of βTrCP lacking the F-box (lane 5), no Skp1 was isolated. In lanes 10 and 11, we repeated the experiment and asked whether Skp1 might have associated with the GHR protein complex after lysis. As for βTrCP, the interaction does not occur if cell lysates from cells, expressing the components separately, were mixed (M). Together, this implies that GH, GHR, TrCP2, and Skp1 are in the same protein complex. To analyze the involvement of an active SCF complex, we took a genetic approach and expressed GHR in hamster ts41 cells. These cells contain a temperature-sensitive mutation in the NEDD8 activation enzyme, APP-BP1, and fail to degrade substrates via E3s with Cullin family members (e.g. p27 via the SCF(skp2) (25Ohh M. Kim W.Y. Moslehi J.J. Chen Y. Chau V. Read M.A. Kaelin Jr., W.G. EMBO Rep. 2002; 3: 177-182Crossref PubMed Scopus (156) Google Scholar), due to defective neddylation. Thus, the E3-SCF(TrCP) is itself regulated via covalent modification of the ubiquitin-like protein Nedd8 by UBC12, whereas deneddylation is performed by the signalosome complex. This modification stabilizes the E2-Cullin/Rbx1 interaction and in turn stimulates ubiquitination of the target substrates. Fig. 2C shows that Cy3-GH is endocytosed at the permissive temperature but largely remains at the cell surface at the nonpermissive temperature (39 °C). In the same experiment, Alexa488-labeled transferrin entered the cells undisturbed, although there seemed to be a different distribution intracellularly. This shows that an intact neddylation system is specifically required for uptake of the GHR. Together with the results on βTrCP and Skp1, these data strongly suggest that GHR endocytosis requires a fully functional SCF(βTrCP) complex. βTrCP Interacts with the GHR Tail via the UbE Motif—To further examine the role of βTrCP in GHR endocytosis, we analyzed βTrCP2, since it is dominantly active in the cytosol (26Sadot E. Simcha I. Iwai K. Ciechanover A. Geiger B. Ben-Ze'ev A. Oncogene. 2000; 19: 1992-2001Crossref PubMed Scopus (63) Google Scholar). Hek293 cells were co-transfected with FLAG-tagged βTrCP2 together with GHR or the truncation GHR-(1-286) (Fig. 3A). GHR-(1-286) still contains box 1, the attachment site for Jak2, but lacks the UbE motif. This receptor is unable to endocytose and, therefore, accumulates at the cell surface, resulting in a high amount of mature receptor (55 kDa) compared with its 40-kDa ER form (Fig. 3B, left, lane 2). The wild-type GHR migrates at 130 kDa, whereas its precursor ER form appears as a doublet at 110 kDa (lane 1). Cell lysates were incubated with biotinylated GH, and GHR protein complexes were isolated with streptavidin beads. Comparing the full-length GHR with GHR truncated at 286 shows that co-transfected FLAG-labeled βTrCP2 was only isolated if full-length GHR was present (Fig. 3B, left, lanes 3 and 4). In Fig. 3B, right, we used various GHR truncations and mutations to pinpoint the tail segment involved in βTrCP binding. The receptors were purified from transiently transfected Hek293 cells, via biotinylated GH and streptavidin beads, and then incubated on ice with equal amounts of in vitro synthesized 35S-labeled βTrCP. Wild-type GHR and GHR truncated at 434, 369, or 334 bound ∼16% of the input 35S-labeled TrCP. GHRs truncated at 330, 326, and 286 as well as the UbE mutants GHR-D331A and GHR-F327A showed little binding. Mutation of the serine residues in the DSGRTS motif of the full-length GHR (GHR-S366,370A) did not affect the GHR-SCF(TrCP) interaction (Fig. 3B, right, lane 8). Similar UbE Motif Specificity for GHR-βTrCP2 Interaction and GHR Endocytosis—Previously, we have shown that endocytosis of the GHR depends both on a functional ubiquitination system and on an intact UbE motif (20Strous G.J. van Kerkhof P. Govers R. Ciechanover A. Schwartz A.L. EMBO J. 1996; 15: 3806-3812Crossref PubMed Scopus (265) Google Scholar, 27Govers R. van Kerkhof P. Schwartz A.L. Strous G.J. EMBO J. 1997; 16: 4851-4858Crossref PubMed Scopus (91) Google Scholar, 28van Kerkhof P. Smeets M. Strous G.J. Endocrinology. 2002; 143: 1243-1252Crossref PubMed Scopus (37) Google Scholar). Using mutational analysis of the UbE motif by changing every single amino acid residue into alanine, the contribution of each amino acid was determined. The experiment identified the key residues in the UbE motif (DDSWVEFIELD) for endocytosis. As shown in Fig. 1, βTrCP is an obvious factor to act as a regulator of GHR endocytosis. Therefore, we used the pull-down assay of Fig. 3B (right) to ask whether βTrCP binds to the GHR in a specific fashion. Each of the amino acids 320-334 were changed in alanine residues, and the 15 GHR constructs were tested in Hek293 cells. The cells were transfected with equal amounts of the different constructs and showed comparable GHR expression judged by the amounts of high mannose (ER-localized) GHR (not shown). Western blot analysis of the cell extracts shows that the mutations E326A, F327A, I328A, and D331A caused a significant increase in mature (130-kDa) GHR (Fig. 4A), indicative of impaired degradation. Biotin-GH was used to isolate the GH-GHR complexes from the cell surface, and the GHRs were incubated with equal amounts of 35S-labeled βTrCP. Most mutations resulted in inhibition of βTrCP binding as compared with wild-type GHR. However, mutation of the same 4 amino acids inhibited the βTrCP binding more than 60% (Fig. 4B). Compared with the mutational analysis previously performed for endocytosis (see Fig. 4C and Fig. 4 in Ref. 22Govers R. ten Broeke T. van Kerkhof P. Schwartz A.L. Strous G.J. EMBO J. 1999; 18: 28-36Crossref PubMed Scopus (170) Google Scholar), we note a striking similarity in patterns; the same 4 amino acid are important for endocytosis of the GHR (27Govers R. van Kerkhof P. Schwartz A.L. Strous G.J. EMBO J. 1997; 16: 4851-4858Crossref PubMed Scopus (91) Google Scholar). GHR Binds to the WD-40 Domain of βTrCP—βTrCP canonically binds to the DSGΦXS motif in IκB, β-cat" @default.
• W2000443365 created "2016-06-24" @default.
• W2000443365 creator A5000253652 @default.
• W2000443365 creator A5013487852 @default.
• W2000443365 creator A5028307793 @default.
• W2000443365 date "2007-07-01" @default.
• W2000443365 modified "2023-09-27" @default.
• W2000443365 title "The Ubiquitin Ligase SCF(βTrCP) Regulates the Degradation of the Growth Hormone Receptor" @default.
• W2000443365 cites W1523140607 @default.
• W2000443365 cites W1570595295 @default.
• W2000443365 cites W1851733051 @default.
• W2000443365 cites W1958512987 @default.
• W2000443365 cites W1963502593 @default.
• W2000443365 cites W1965077784 @default.
• W2000443365 cites W1974656027 @default.
• W2000443365 cites W1988780457 @default.
• W2000443365 cites W1990183651 @default.
• W2000443365 cites W1990259051 @default.
• W2000443365 cites W2024812887 @default.
• W2000443365 cites W2025483613 @default.
• W2000443365 cites W2027728353 @default.
• W2000443365 cites W2039193100 @default.
• W2000443365 cites W2039221760 @default.
• W2000443365 cites W2046691565 @default.
• W2000443365 cites W2051509673 @default.
• W2000443365 cites W2052551760 @default.
• W2000443365 cites W2054165881 @default.
• W2000443365 cites W2064367394 @default.
• W2000443365 cites W2068945536 @default.
• W2000443365 cites W2072508525 @default.
• W2000443365 cites W2081500927 @default.
• W2000443365 cites W2083359453 @default.
• W2000443365 cites W2089728262 @default.
• W2000443365 cites W2091366475 @default.
• W2000443365 cites W2094029455 @default.
• W2000443365 cites W2097447956 @default.
• W2000443365 cites W2108438806 @default.
• W2000443365 cites W2110323618 @default.
• W2000443365 cites W2120166425 @default.
• W2000443365 cites W2121609721 @default.
• W2000443365 cites W2124197067 @default.
• W2000443365 cites W2126582177 @default.
• W2000443365 cites W2133987610 @default.
• W2000443365 cites W2135702315 @default.
• W2000443365 cites W2147291971 @default.
• W2000443365 cites W2148810559 @default.
• W2000443365 cites W2155820530 @default.
• W2000443365 cites W2168687405 @default.
• W2000443365 cites W2169344296 @default.
• W2000443365 cites W93114066 @default.
• W2000443365 doi "https://doi.org/10.1074/jbc.m702610200" @default.
• W2000443365 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17500058" @default.
• W2000443365 hasPublicationYear "2007" @default.
• W2000443365 type Work @default.
• W2000443365 sameAs 2000443365 @default.
• W2000443365 citedByCount "63" @default.
• W2000443365 countsByYear W20004433652012 @default.
• W2000443365 countsByYear W20004433652013 @default.
• W2000443365 countsByYear W20004433652014 @default.
• W2000443365 countsByYear W20004433652015 @default.
• W2000443365 countsByYear W20004433652016 @default.
• W2000443365 countsByYear W20004433652017 @default.
• W2000443365 countsByYear W20004433652018 @default.
• W2000443365 countsByYear W20004433652020 @default.
• W2000443365 countsByYear W20004433652021 @default.
• W2000443365 countsByYear W20004433652022 @default.
• W2000443365 countsByYear W20004433652023 @default.
• W2000443365 crossrefType "journal-article" @default.
• W2000443365 hasAuthorship W2000443365A5000253652 @default.
• W2000443365 hasAuthorship W2000443365A5013487852 @default.
• W2000443365 hasAuthorship W2000443365A5028307793 @default.
• W2000443365 hasBestOaLocation W20004433651 @default.
• W2000443365 hasConcept C104317684 @default.
• W2000443365 hasConcept C113675107 @default.
• W2000443365 hasConcept C134459356 @default.
• W2000443365 hasConcept C170493617 @default.
• W2000443365 hasConcept C175114707 @default.
• W2000443365 hasConcept C185592680 @default.
• W2000443365 hasConcept C25602115 @default.
• W2000443365 hasConcept C2779679103 @default.
• W2000443365 hasConcept C2908868211 @default.
• W2000443365 hasConcept C2984496839 @default.
• W2000443365 hasConcept C41008148 @default.
• W2000443365 hasConcept C552990157 @default.
• W2000443365 hasConcept C55493867 @default.
• W2000443365 hasConcept C71315377 @default.
• W2000443365 hasConcept C76155785 @default.
• W2000443365 hasConcept C86803240 @default.
• W2000443365 hasConcept C95444343 @default.
• W2000443365 hasConceptScore W2000443365C104317684 @default.
• W2000443365 hasConceptScore W2000443365C113675107 @default.
• W2000443365 hasConceptScore W2000443365C134459356 @default.
• W2000443365 hasConceptScore W2000443365C170493617 @default.
• W2000443365 hasConceptScore W2000443365C175114707 @default.
• W2000443365 hasConceptScore W2000443365C185592680 @default.
• W2000443365 hasConceptScore W2000443365C25602115 @default.
• W2000443365 hasConceptScore W2000443365C2779679103 @default.
• W2000443365 hasConceptScore W2000443365C2908868211 @default.

• next