FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000454848> ?p ?o ?g. }

• W2000454848 endingPage "14191" @default.
• W2000454848 startingPage "14184" @default.
• W2000454848 abstract "Insulin-like growth factor-binding protein (IGFBP)-5 is a secreted protein that binds to IGFs and modulates IGF actions. IGFBP-5 is also found in the nuclei of cultured cells and has transactivation activity. Here we report the nuclear localization of endogenous IGFBP-5 in mouse embryonic skeletal cells. Chromatin immunoprecipitation experiments indicated that IGFBP-5 interacts with the nuclear histone-DNA complex. Using a series of deletion mutants, the transactivation domain of IGFBP-5 was mapped to its N-terminal region. Intriguingly, the transactivation activity of IGFBP-5 is masked by negative regulatory elements located in the L- and C-domains. Among the other IGFBPs, the N-domains of IGFBP-2 and -3 also had strong transactivation activity, whereas those of IGFBP-1 and -6 had no activity. The IGFBP-4 N-domain had modest activity. Sequence analysis revealed several amino acids in the IGFBP-5 N-domain that are not present in IGFBP-1. The activities of mutants in which these residues were changed to the corresponding IGFBP-1 sequence were determined. Mutations that changed acidic residues to neutral residues (e.g. E8A, D11S, E12A, E30S/P31A, E43L, and E52A) or a polar to a basic residue (e.g. Q56R) significantly reduced transactivation activity. The E8A/D11S/E12A triple mutant and E52A/Q56R double mutants showed further reduced activity. The combinatory mutants had essentially no transactivation activity. Taken together, our results indicate that there are several conserved residues in the IGFBP-5 N-terminal region that are critical for transactivation and that IGFBP-2 and -3 also have strong transactivation activity in their N-domains. Insulin-like growth factor-binding protein (IGFBP)-5 is a secreted protein that binds to IGFs and modulates IGF actions. IGFBP-5 is also found in the nuclei of cultured cells and has transactivation activity. Here we report the nuclear localization of endogenous IGFBP-5 in mouse embryonic skeletal cells. Chromatin immunoprecipitation experiments indicated that IGFBP-5 interacts with the nuclear histone-DNA complex. Using a series of deletion mutants, the transactivation domain of IGFBP-5 was mapped to its N-terminal region. Intriguingly, the transactivation activity of IGFBP-5 is masked by negative regulatory elements located in the L- and C-domains. Among the other IGFBPs, the N-domains of IGFBP-2 and -3 also had strong transactivation activity, whereas those of IGFBP-1 and -6 had no activity. The IGFBP-4 N-domain had modest activity. Sequence analysis revealed several amino acids in the IGFBP-5 N-domain that are not present in IGFBP-1. The activities of mutants in which these residues were changed to the corresponding IGFBP-1 sequence were determined. Mutations that changed acidic residues to neutral residues (e.g. E8A, D11S, E12A, E30S/P31A, E43L, and E52A) or a polar to a basic residue (e.g. Q56R) significantly reduced transactivation activity. The E8A/D11S/E12A triple mutant and E52A/Q56R double mutants showed further reduced activity. The combinatory mutants had essentially no transactivation activity. Taken together, our results indicate that there are several conserved residues in the IGFBP-5 N-terminal region that are critical for transactivation and that IGFBP-2 and -3 also have strong transactivation activity in their N-domains. The insulin-like growth factor (IGF) 2The abbreviations used are: IGF, insulin-like growth factor; IGFBP, IGF-binding protein; FHL2, Four and a Half LIM protein 2; DBD, DNA binding domain; ChIP, chromosomal immunoprecipitation. system, consisting of two ligands (IGF-I and -II), two receptors (the IGF-I receptor and IGF-II receptor), and six high affinity IGF-binding proteins (IGFBPs), converges on a conserved signaling pathway that plays fundamental roles in vertebrate development and physiology and is implicated in several human diseases (1Firth S.M. Baxter R.C. Endocr. Rev. 2002; 23: 824-854Crossref PubMed Scopus (1448) Google Scholar). The bioavailability and bioactivity of IGFs are regulated by their interactions with various members of the IGFBP family. IGFBPs all have a highly cysteine-rich N-terminal (N)-domain, a cysteine-rich C-terminal (C)-domain, and a middle linker (L)-domain with no cysteine residues except in IGFBP-4. The N- and C-domains are highly conserved within the IGFBP family, whereas the L-domain varies both within the family and across species. Besides binding to IGF and modulating its actions, IGFBP-5 has been reported to regulate cell proliferation (2Andress D.L. Birnbaum R.S. J. Biol. Chem. 1992; 267: 22467-22472Abstract Full Text PDF PubMed Google Scholar, 3Mohan S. Nakao Y. Honda Y. Landale E. Leser U. Dony C. Lang K. Baylink D.J. J. Biol. Chem. 1995; 270: 20424-20431Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar), migration (4Abrass C.K. Berfield A.K. Andress D.L. Am. J. Physiol. 1997; 273: F899-F906PubMed Google Scholar, 5Berfield A.K. Andress D.L. Abrass C.K. Kidney Int. 2000; 57: 1991-2003Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 6Hsieh T. Gordon R.E. Clemmons D.R. Busby Jr., W.H. Duan C. J. Biol. Chem. 2003; 278: 42886-42892Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar), and apoptosis/survival (7Tonner E. Barber M.C. Allan G.J. Beattie J. Webster J. Whitelaw C.B. Flint D.J. Development. 2002; 129: 4547-4557Crossref PubMed Google Scholar, 8Perks C.M. McCaig C. Clarke J.B. Clemmons D.R. Holly J.M. Biochem. Biophys. Res. Commun. 2002; 294: 995-1000Crossref PubMed Scopus (22) Google Scholar, 9McCaig C. Perks C.M. Holly J.M. J. Cell Sci. 2002; 115: 4293-4303Crossref PubMed Scopus (89) Google Scholar, 10Cobb L.J. Salih D.A. Gonzalez I. Tripathi G. Carter E.J. Lovett F. Holding C. Pell J.M. J. Cell Sci. 2004; 117: 1737-1746Crossref PubMed Scopus (62) Google Scholar, 11Yin P. Xu Q. Duan C. J. Biol. Chem. 2004; 279: 32660-32666Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar) independent of IGF. Although the ligand-dependent actions of IGFBP-5 are attributed to its interactions with the IGF ligand and other proteins (1Firth S.M. Baxter R.C. Endocr. Rev. 2002; 23: 824-854Crossref PubMed Scopus (1448) Google Scholar), the mechanistic basis of the ligand-independent actions of IGFBP-5 is not yet understood. Andress et al. (12Andress D.L. Am. J. Physiol. 1998; 274: E744-E750PubMed Google Scholar) used IGFBP-5 affinity chromatography to purify a 420-kDa membrane protein from human osteoblast cells and proposed that it was an IGFBP-5 receptor. The same study reported that IGFBP-5 stimulated serine/threonine phosphorylation of this putative receptor in vitro, which in turn phosphorylated casein, a known serine/threonine kinase substrate. However, the molecular nature of this putative IGFBP-5 receptor remains elusive, and whether this protein is present in other cell types is unknown. An additional mechanism underlying the actions of IGFBP-5 is suggested by its localization in the nucleus. When added to cultured human bone tumor and breast cancer cells, exogenous IGFBP-5 has been shown to be capable of cellular and nuclear entry (13Schedlich L.J. Young T.F. Firth S.M. Baxter R.C. J. Biol. Chem. 1998; 273: 18347-18352Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Likewise, a peptide corresponding to the nuclear localization sequence of IGFBP-5 (residues 201–218) fused to enhanced green fluorescent protein and transfected into Chinese hamster ovary cells targeted enhanced green fluorescent protein to the nucleus (14Schedlich L.J. Le Page S.L. Firth S.M. Briggs L.J. Jans D.A. Baxter R.C. J. Biol. Chem. 2000; 275: 23462-23470Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar). These experimental observations are consistent with the presence of a consensus nuclear localization sequence in IGFBP-5 and IGFBP-3 (15Radulescu R.T. Trends Biochem. Sci. 1994; 19: 278Abstract Full Text PDF PubMed Scopus (78) Google Scholar). It has also been reported that IGFBP-5 may interact with Four and a Half LIM protein 2 (FHL2) and retinoid X receptor, nuclear proteins known to be involved in transcriptional regulation (16Amaar Y.G. Thompson G.R. Linkhart T.A. Chen S.T. Baylink D.J. Mohan S. J. Biol. Chem. 2002; 277: 12053-12060Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 17Schedlich L.J. O'Han M.K. Leong G.M. Baxter R.C. Biochem. Biophys. Res. Commun. 2004; 314: 83-88Crossref PubMed Scopus (58) Google Scholar). Recently, we have shown that 1) endogenous IGFBP-5 is localized in the nucleus of cultured porcine vascular smooth muscle cells; 2) several basic residues in the IGFBP-5 C-domain are necessary and sufficient for nuclear localization of the intact protein; and 3) the IGFBP-5 N-domain activates transcription independent of IGF (18Xu Q. Li S. Zhao Y. Maures T.J. Yin P. Duan C. Circ. Res. 2004; 94: E46-E54Crossref PubMed Google Scholar). These findings suggest that IGFBP-5 is present in the nucleus and may affect gene expression independent of the IGF ligand. The objectives of this study are to 1) determine whether IGFBP-5 interacts with the histone-DNA complex; 2) define the IGFBP-5 transactivation domain and determine the specific amino acids critical for its transactivation activity; and 3) to investigate whether other IGFBPs have similar transactivation activity. Our results indicate a physical association of IGFBP-5 with the histone-DNA complex in the nucleus. We have identified several key residues in the IGFBP-5 N-terminal region that are critical for its transactivation activity. In addition to IGFBP-5, the N-domains of IGFBP-3 and IGFBP-2 also possess strong transactivation activity. Materials—All chemicals and reagents were purchased from Fisher Scientific (Pittsburgh, PA) unless noted otherwise. Fetal bovine serum, Dulbecco's modified Eagle's medium, penicillin, streptomycin, and trypsin were purchased from Invitrogen. The IGFBP-5 polyclonal antibody raised in guinea pig was a generous gift from Dr. David R. Clemmons, University of North Carolina at Chapel Hill. The M2 anti-FLAG antibody was purchased from Sigma, and Cy3-conjugated second antibodies were from Jackson ImmunoResearch (West Grove, PA). Plasmid Constructs—To generate Gal4DNA binding domain (DBD) and IGFBP fusion protein constructs, DNA fragments encoding various portions of human IGFBP-1, -2, -4, -5, and -6 and bovine IGFBP-3 were generated by PCR and subcloned into the BamHI/NotI sites of the pBind vector (Promega, Madison, WI) to fuse the IGFBP in-frame to the C terminus of Gal4DBD. C-terminal deletion or point mutants were generated by PCR using Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA). For this, pBind-IGFBP-5 or pBind-IGFBP-5N was used as template. 0.2 mm of each PCR primer, 0.2 mm of dNTP, 2.5 units of Pfu Turbo DNA polymerase, and Pfu DNA polymerase reaction buffer were used to mutagenize the template DNA by PCR (95 °C for 1 min; 95 °C for 50 s, 60 °C for 50 s, and 68 °C for 7 min, for 18 cycles; and then 68 °C for 7 min) in a total volume of 50 μl. Each reaction was incubated with 10 units of DpnI at 37 °C for 1 h. The names and sequences of the primers used are shown in Supplemental Table 1S. To generate the IGFBP-5:FLAG expression construct, DNA encoding mature human IGFBP-5 was amplified by PCR (forward primer: ATGCGGCCGCCACCATGGCACTGGGCTCCTTCGTGCAC; reverse primer: TAGGATCCCTTATCGTCGTCATCCTTGTAATCCTCAACGTTGCTGCTGTC), and subcloned into pCMV-tag1 (Stratagene) using the NotI and BamHI sites. Similarly, a FLAG:IGFBP-5 expression construct was engineered by subcloning. The IGFBP-5 L+C:FLAG DNA (containing residues 81–252 of human IGFBP-5) was amplified by PCR using ATGGATCCACCATGCTCAACGAAAAGAGC (forward primer) and TAGGATCCCTTATCGTCGTCATCCTTGTAATCCTCAACGTTGCTGCTGTC (reverse primer), and subcloned into pCMV-tag1 using the BamHI site to generate the IGFBP-5LC:FLAG plasmid. All purified plasmids were sequenced at the University of Michigan DNA Sequencing Core Facility. Cell Culture and One-hybrid Transcription Activation Assay—Human embryonic kidney (HEK) 293 cells and U2 osteosarcoma (OS) cells were purchased from American Type Culture Collection (Manassas, VA) and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin in a humidified-air atmosphere containing 5% CO2. For transfection, 0.5 × 106 HEK293 cells were seeded into each well of 6-well plates (Falcon, Corning, NY). 500 ng of pBind or pBind-IGFBP DNA and 500 ng of Gal4 reporter (pG5-luc) DNA were transfected into cells as described previously (18Xu Q. Li S. Zhao Y. Maures T.J. Yin P. Duan C. Circ. Res. 2004; 94: E46-E54Crossref PubMed Google Scholar). For co-transfection experiments, a mixture of pBind or Gal-IGFBP-5N (500 ng) and pCMV-tag1, IGFBP-5:FLAG, or IGFBP-5L+C: FLAG DNA (100, 200, or 500 ng) was used. 24 h after transfection, cells were washed with phosphate-buffered saline and lysed with 500 μlof lysis buffer (Promega). Transcription activation was quantified using the Dual-Luciferase Reporter assay system (Promega). Protein concentration was determined using a BCA protein assay kit (Pierce). Firefly luciferase activity was divided by Renilla luciferase activity to normalize for transfection efficiency. Transcriptional activity was expressed as -fold increase over the pBind (Gal4DBD alone) control group. Western Immunoblotting and Immunocytochemistry Analysis—For Western immunoblotting, equal amounts of protein were separated by 12.5% SDS-PAGE and transferred to Immobilon polyvinylidene difluoride membranes (0.45-μm pore size, Millipore Corp., Bedford, MA). Immunoblotting was performed following a published method (19Duan C. Liimatta M.B. Bottum O.L. J. Biol. Chem. 1999; 274: 37147-37153Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). To determine the possible nuclear localization of endogenous IGFBP-5, normal mouse embryo costal cartilage sections, obtained from the University of Michigan Transgenic Core facility, were subjected to immunocytochemical analysis using an IGFBP-5 polyclonal antibody (1:250 dilution) and Cy3-conjugated anti-guinea pig IgG (Jackson Immuno-Research). The sections were counterstained by SYTO13, a nuclear dye. To verify the nuclear presence of IGFBP-5:FLAG and IGFBP-5LC: FLAG, immunostaining was carried out in cells transfected with pCMV-tag1, IGFBP5:FLAG, or IGFBP5LC:FLAG. One day after the transfection, cells were washed three times with phosphate-buffered saline, fixed in 4% paraformaldehyde in phosphate-buffered saline for 30 min, and blocked with 0.5% bovine serum albumin plus 0.1% Triton X-100 for 1 h at room temperature. They were then incubated with a mouse anti-FLAG antibody (Sigma) in blocking buffer at 4 °C overnight. After washing, the cells were incubated with Cy3-conjugated antimouse IgG (Jackson ImmunoResearch) in blocking buffer for 2 h at room temperature. The cells were washed, counterstained with 0.5 μg/ml 4′,6-diamidino-2-phenylindole, and examined under a fluorescence microscope. Chromatin Immunoprecipitation Assays—To determine the possible association of IGFBP-5 with the histone-DNA complex, wild-type or U2OS cells stably transfected with the FLAG:IGFBP-5 construct were fixed in fresh 5 mm dimethyl-3,3′-dithiobispropionimidate-2HCl for 30 min at room temperature. After rinsing with 100 mm Tris-HCl and 150 mm NaCl, the cells were further fixed in 1% formaldehyde/phosphate-buffered saline for 10 min at 37 °C and lysed using nuclear lysis buffer (50 mm Tris-Cl, pH 8.1, 10 mm EDTA, 1% SDS, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 10 μg/ml pepstatin). After breaking the chromatin into average length of 2 kb using a sonicator (Fisher Scientific model 60), the cell lysates were centrifuged at 14,000 rpm for 10 min at 4 °C. The supernatant was diluted 10-fold using ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-Cl, pH 8.1, and 167 mm NaCl) and precleared using 20 μl of protein G-agarose (Upstate, Lake Placid, NY). Subsequently, 2 μg of anti-FLAG antibody (Sigma), anti-histone H3 antibody (Abcam, Cambridge, MA), mouse IgG, or rabbit IgG (Jackson ImmunoResearch) was added. After incubation overnight at 4 °C, 20 μlof protein G beads was added, and the mixture was incubated for another 2 h. The beads were spun down and rinsed twice. The immunoprecipitated complexes were eluted by boiling in Laemmli buffer and analyzed by Western immunoblot using the anti-FLAG or anti-Histone H3 antibody. Statistical Analysis—Values are presented as mean ± S.E. Differences between groups were analyzed by one-way analysis of variance followed by Fisher's protected least significance difference test using Statview (Abacus Concept, Inc.). Statistical significance was defined as p < 0.05. IGFBP-5 Is Physically Associated with the Histone-DNA Complex in the Nucleus—To determine whether endogenous IGFBP-5 is present in the nucleus in an in vivo setting, immunocytochemical analysis was performed in mouse embryo costal cartilage sections using a specific IGFBP-5 polyclonal antibody. The sections were counterstained by SYTO13, a nuclear dye. As shown in Fig. 1A, IGFBP-5 immunoreactivity was clearly detected in the nuclei, indicating that endogenous IGFBP-5 is localized in the nuclei of cartilage cells in mouse embryos. To investigate whether IGFBP-5 interacts with DNA in the nucleus, ChIP assays were carried out in U2OS cells stably transfected with FLAG:IGFBP-5. When introduced into U2OS cells, FLAG:IGFBP5 signal was detected exclusively in the nucleus, co-localized with the histone H3 signal (Fig. 1B). As shown in the upper panel in Fig. 1C, the anti-histone H3 antibody was able to immunoprecipitate FLAG:IGFBP-5 (lane 4) in the FLAG:IGFBP-5 transfected but not the wild-type control cells (lane 8). This interaction was specific, because neither rabbit IgG nor mouse IgG was able to immunoprecipitate FLAG:IGFBP-5 (lanes 5 and 6) and the anti-FLAG antibody was able to pull down IGFBP-5 only in the transfected cells (lane 3). Likewise, the anti-FLAG antibody specifically pulled down histone 3 (Fig. 1C, lower panel) in the transfected cells (lane 4) but not in the control cells (lane 8). These results suggest that IGFBP-5 is localized in the nucleus and that the nuclear IGFBP-5 is physically associated with the histone-DNA complex. IGFBP-5 Transactivation Domain Is Located in the N-terminal Region and Is Masked by Negative Regulatory Elements in the L- and C-domains—To map the location of the transactivation domain in human IGFBP-5, a series of truncated IGFBP-5 fragments were generated and fused to Gal4DBD. The transactivation activities of these fusion proteins were measured after transfection into HEK293 cells together with a Gal4 reporter construct. As shown in Fig. 2, the human IGFBP-5 N-domain (IGFBP-5-(1–80)) fusion protein caused a Gal4-dependent transactivation 21.72 ± 1.07-fold greater than the pBind control group (n = 5, p < 0.01). pBind-IGFBP-5-(1–60) caused a similar increase (26.27 ± 1.49, n = 5, p < 0.01). This activity is evolutionarily conserved because zebrafish IGFBP-5 N-domain, but not human or zebrafish IGFBP-1 N-domain, had significant transactivation activity (18Xu Q. Li S. Zhao Y. Maures T.J. Yin P. Duan C. Circ. Res. 2004; 94: E46-E54Crossref PubMed Google Scholar). Intriguingly, the longer fragments of IGFBP-5-(1–100) and IGFBP-5-(1–120) only had modest transactivation activity (5- to 6-fold), whereas IGFBP-5-(1–169) had no transactivation activity. Western immunoblot analysis confirmed the expression of these fusion proteins (Fig. 2B). When the activity of full-length human IGFBP-5-(1–252) was tested, it had no transactivation activity. In fact, it significantly reduced the reporter activity to 0.17 ± 0.02-fold, equating to a 5.9-fold repression (p < 0.01, Fig. 3A). These data suggest that the IGFBP-5 transactivation domain is located within the N-terminal 60 amino acids and that transactivation activity is suppressed or masked by negative regulatory element(s) located in the L- and C-domains. To test this idea further, IGFBP-5 L-(amino acid 81–169) and C-domains (amino acid 170–252) were fused to Gal4DBD, and their activities were determined in the same assay. As shown in Fig. 3A, IGFBP-5 L-domain and C-domain both had significant repressing activity (3.04 ± 0.30-fold, and 3.22 ± 0.28-fold, both n = 5, p < 0.01). The expression levels of these fusion proteins were similar (Fig. 3B).FIGURE 3IGFBP-5 L- and C-domains have transcriptional repression activity. A, full-length (hBP5), L-(hBP5L), and C-domain (hBP5C) of human IGFBP-5 were fused to the Gal4DBD and introduced into HEK293 cells together with a Gal4 reporter plasmid by transient transfection. Transcriptional activity was determined and the transcriptional repressor activity is expressed as -fold decrease over the pBind control group. Values are expressed as means ± S.E. (n = 5). *, p < 0.01 compared with the pBind control group. The expression levels of various IGFBP-5-Gal4DBD fusion proteins were analyzed by immunoblotting using an anti-Gal4 antibody and are shown in B.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To determine whether the L- or C-domains of IGFBP-5 negatively regulate transactivation activity of the N-domain of IGFBP-5 an intermolecular interactions, the C-terminally FLAG-tagged IGFBP-5 and IGFBP-5L+C constructs were generated. When introduced into HEK293 cells, IGFBP-5:FLAG and IGFBP-5L+C:FLAG were detected exclusively in the nucleus (Fig. 4A). As shown in Fig. 4 (B and C), nuclear expression of neither IGFBP-5:FLAG nor IGFBP-5L+C:FLAG significantly inhibited the activity of pBind-IGFBP-5N. Several Conserved Residues in the IGFBP-5 N-terminal Region Are Important for Its Transactivation Activity—Although the N-domains of IGFBP-5 and -1 share high sequence identity, only the N-domain of IGFBP-5 has transactivation activity, and this activity is evolutionarily conserved (Ref. 18Xu Q. Li S. Zhao Y. Maures T.J. Yin P. Duan C. Circ. Res. 2004; 94: E46-E54Crossref PubMed Google Scholar; see also Fig. 7). Taking advantage of this finding, we compared the amino acid sequences of these two highly homologous proteins to map the sequence determinants of the transactivation activity of the IGFBP-5 N-domain. Transactivation domains are often rich in acidic (20Abedi M. Caponigro G. Shen J. Hansen S. Sandrock T. Kamb A. BMC Mol. Biol. 2001; 2: 10Crossref PubMed Scopus (14) Google Scholar, 21Ma J. Ptashne M. Cell. 1987; 51: 113-119Abstract Full Text PDF PubMed Scopus (498) Google Scholar, 22Ruden D.M. Ma J. Li Y. Wood K. Ptashne M. Nature. 1991; 350: 250-252Crossref PubMed Scopus (130) Google Scholar) or proline residues (23Sprenger-Haussels M. Weisshaar B. Plant J. 2000; 22: 1-8Crossref PubMed Google Scholar, 24Wiesner C. Hoeth M. Binder B.R. de Martin R. Nucleic Acids Res. 2002; 30: e80Crossref PubMed Scopus (11) Google Scholar). Sequence analysis of the N-terminal region of IGFBP-1 and -5 revealed several conserved proline and acidic residues unique to IGFBP-5 (Fig. 5A). For instance, Pro22 and Pro31 are conserved between human and zebrafish IGFBP-5, but are not present in human IGFBP-1. Pro22 in particular is located in a cluster of three proline residues, Pro19-Pro20-Ser21-Pro22. Several acidic residues, including Glu8, Asp11, Glu30, and Glu43, are found in human and zebrafish IGFBP-5, whereas the corresponding residues in human IGFBP-1 are neutral (Fig. 5A). Likewise, Glu12 and Glu52 in human IGFBP-5 are neutral amino acids in IGFBP-1. A polar amino acid in IGFBP-5, Gln56, corresponds to the basic Arg in IGFBP-1 (Fig. 5A).FIGURE 5Several unique residues in human IGFBP-5 N-domain are important for its transactivation activity. A, sequence alignment of the N-terminal region of human IGFBP-5 (hBP5), zebrafish IGFBP-5 (zfBP5), and human IGFBP-1 (hBP1). The unique amino acids that were studied by mutagenic analysis are indicated. ↓, acidic amino acids that were changed; ▿, proline or glutamine residues that were altered. B, relative transactivation activities of various single or double mutants compared with that of the wild-type IGFBP-5 N-domain. Mutants E8A, D11S, E12A, P22S, E26S, E30S/P31A, E43L, E52A, and Q56R were generated by changing the human IGFBP-5 residues to the corresponding IGFBP-1 sequence. These mutant constructs were introduced into HEK293 cells together with a Gal4 reporter plasmid by transient transfection. Values are expressed as means ± S.E. (n = 3 ∼ 5). *, p < 0.01 compared with the wild-type IGFBP-5 N-domain (hBP5N) group. The expression levels of these mutant fusion proteins were analyzed by immunoblotting using an anti-Gal4DBD antibody and are shown in C.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To test whether any of these residues unique to human IGFBP-5 are critical for its transactivation activity, we mutated each to the corresponding human IGFBP-1 sequence. The effects of these mutations on transactivation activity are shown in Fig. 5B. Mutation of Pro22 to Ser did not decrease transactivation activity, suggesting that this proline residue play little role in the transactivation activity. In contrast, mutation of Glu8 to Ala significantly decreased transactivation to 71.0 ± 7.1% of that of the wild-type IGFBP-5 N-domain (n = 5, p < 0.01). The transactivation activities of mutants D11S, E12A, E43L, and E52A were also significantly reduced relative to wild-type IGFBP-5 N domain (all p < 0.01, Fig. 5B). Mutation of the non-conserved Glu26 to Ser caused a modest reduction in transactivation activity, but this reduction did not reach statistical significance. Mutation of the polar amino acid Gln56 to Arg strongly reduced transactivation activity (46.4 ± 3.3%, n = 5, p < 0.01). These data indicate that several acidic residues and Gln56 are important for transactivation. Western immunoblot analysis revealed that expression levels of these mutant fusion proteins were similar (Fig. 5C), thus excluding the possibility that these changes were due to different levels of protein expression or degradation. We next generated several double and triple mutants. The E30S/P31A mutant had significantly reduced activity compared with that of the wild-type IGFBP-5 N-domain (79.4 ± 11.3%, n = 5, p < 0.01, Fig. 5B). The transactivation activities of the E8A/D11S/E12A triple mutant and E52A/Q56R double mutant were 19.3 ± 0.9% and 19.8 ± 1.4% of that of the wild type IGFBP-5 N-domain (both p < 0.01, n = 3, Fig. 6A). These values are significantly lower than those of the corresponding single mutations (p < 0.05). These results suggest that residues Glu8, Asp11,Glu12, Glu30/Pro31,Glu43,Glu52, and Gln56 are important for transactivation activity. The combinatory effects of mutating the acidic residues were examined by generating mutants E8A/D11S/E12A/E43L, E43L/E52A/Q56R, and E8A/D11S/E12A/E52A/Q56R. As shown in Fig. 6A, these mutants acted like the IGFBP-1 fusion protein in that they had essentially no transactivation activity (E8A/D11S/E12A/E43L: 7.8 ± 1.5%; E43L/E52A/Q56R: 9.5 ± 2.0%; E8A/D11S/E12A/E52A/Q56R: 5.2 ± 0.9%, all n = 5). Again, no marked differences were found in the expression levels of these mutant proteins (Fig. 6B). Transactivation Activity of Other IGFBPs—Because nuclear localization has also been reported for IGFBP-3 and -2 (13Schedlich L.J. Young T.F. Firth S.M. Baxter R.C. J. Biol. Chem. 1998; 273: 18347-18352Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 14Schedlich L.J. Le Page S.L. Firth S.M. Briggs L.J. Jans D.A. Baxter R.C. J. Biol. Chem. 2000; 275: 23462-23470Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar, 25Jaques G. Noll K. Wegmann B. Witten S. Kogan E. Radulescu R.T. Havemann K. Endocrinology. 1997; 138: 1767-1770Crossref PubMed Scopus (124) Google Scholar, 26Wraight C.J. Liepe I.J. White P.J. Hibbs A.R. Werther G.A. J. Invest. Dermatol. 1998; 111: 239-242Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 27Besnard V. Corroyer S. Trugnan G. Chadelat K. Nabeyrat E. Cazals V. Clement A. Biochim. Biophys. Acta. 2001; 1538: 47-58Crossref PubMed Scopus (36) Google Scholar), we speculated that IGFBPs other than IGFBP-5 may possess similar transactivation activity. We therefore investigated the activity of the other five members of the IGFBP gene family. As shown in Fig. 7A, the bovine IGFBP-3 N-domain caused a significant 17.39 ± 0.62-fold (p < 0.01, n = 3) increase over the pBind control. This activity was essentially the same as that of the human IGFBP-5 N-domain (17.44 ± 2.31, n = 5). Like IGFBP-5, the transactivation activity of IGFBP-3 appeared to be conserved, because zebrafish IGFBP-3 had strong activity (data not shown). Human IGFBP-2 N-domain also showed significant activity (10.90 ± 1.77-fold, n = 5, p < 0.01 compared with pBind control). In contrast, no activity was observed for human IGFBP-1 N-domain (1.70 ± 0.38-fold, n = 5) or IGFBP-6 N-domain (1.12 ± 0.26-fold, n = 5). The N-domain of human IGFBP-4 had modest transactivation activity (6.04 ± 0.98-fold, n = 5, p < 0.05). These results indicate that IGFBP-5, -3, -2, and possibly -4, but not IGFBP-1 or -6, possess a transactivation domain in their N-domains. Ligand-independent effects of IGFBP-5 on cell growth, migration, and apoptosis/survival have been documented in a number of cell types (2Andress D.L. Birnbaum R.S. J. Biol. Chem. 1992; 267: 22467-22472Abstract Full Text PDF PubMed Google Scholar, 3Mohan S. Nakao Y. Honda Y. Landale E. Leser U. Dony C. Lang K. Baylink D.J. J." @default.
• W2000454848 created "2016-06-24" @default.
• W2000454848 creator A5026811332 @default.
• W2000454848 creator A5057077440 @default.
• W2000454848 creator A5084205776 @default.
• W2000454848 creator A5086749248 @default.
• W2000454848 date "2006-05-01" @default.
• W2000454848 modified "2023-10-18" @default.
• W2000454848 title "Several Acidic Amino Acids in the N-domain of Insulin-like Growth Factor-binding Protein-5 Are Important for Its Transactivation Activity" @default.
• W2000454848 cites W1569741533 @default.
• W2000454848 cites W1584406385 @default.
• W2000454848 cites W1936612717 @default.
• W2000454848 cites W1966516812 @default.
• W2000454848 cites W1972273837 @default.
• W2000454848 cites W1975213791 @default.
• W2000454848 cites W1976299678 @default.
• W2000454848 cites W1977236952 @default.
• W2000454848 cites W1985987710 @default.
• W2000454848 cites W1991095866 @default.
• W2000454848 cites W1993635973 @default.
• W2000454848 cites W2000394884 @default.
• W2000454848 cites W2001641438 @default.
• W2000454848 cites W2006345660 @default.
• W2000454848 cites W2012505775 @default.
• W2000454848 cites W2020308645 @default.
• W2000454848 cites W2023211332 @default.
• W2000454848 cites W2024642928 @default.
• W2000454848 cites W2024707576 @default.
• W2000454848 cites W2027454234 @default.
• W2000454848 cites W2028246431 @default.
• W2000454848 cites W2029098538 @default.
• W2000454848 cites W2034967926 @default.
• W2000454848 cites W2038163496 @default.
• W2000454848 cites W2039756216 @default.
• W2000454848 cites W2041327254 @default.
• W2000454848 cites W2041807810 @default.
• W2000454848 cites W2045015715 @default.
• W2000454848 cites W2053099348 @default.
• W2000454848 cites W2053296976 @default.
• W2000454848 cites W2058196624 @default.
• W2000454848 cites W2059784252 @default.
• W2000454848 cites W2071482027 @default.
• W2000454848 cites W2081062649 @default.
• W2000454848 cites W2083106037 @default.
• W2000454848 cites W2086867296 @default.
• W2000454848 cites W2095385109 @default.
• W2000454848 cites W2105014300 @default.
• W2000454848 cites W2105803506 @default.
• W2000454848 cites W2112981515 @default.
• W2000454848 cites W2120622189 @default.
• W2000454848 cites W2123782952 @default.
• W2000454848 cites W2123930465 @default.
• W2000454848 cites W2132629607 @default.
• W2000454848 cites W2133386615 @default.
• W2000454848 cites W2133647910 @default.
• W2000454848 cites W2136140283 @default.
• W2000454848 cites W2171971275 @default.
• W2000454848 cites W2232689465 @default.
• W2000454848 doi "https://doi.org/10.1074/jbc.m506941200" @default.
• W2000454848 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16543235" @default.
• W2000454848 hasPublicationYear "2006" @default.
• W2000454848 type Work @default.
• W2000454848 sameAs 2000454848 @default.
• W2000454848 citedByCount "51" @default.
• W2000454848 countsByYear W20004548482012 @default.
• W2000454848 countsByYear W20004548482013 @default.
• W2000454848 countsByYear W20004548482015 @default.
• W2000454848 countsByYear W20004548482017 @default.
• W2000454848 countsByYear W20004548482018 @default.
• W2000454848 countsByYear W20004548482019 @default.
• W2000454848 countsByYear W20004548482020 @default.
• W2000454848 countsByYear W20004548482021 @default.
• W2000454848 countsByYear W20004548482022 @default.
• W2000454848 countsByYear W20004548482023 @default.
• W2000454848 crossrefType "journal-article" @default.
• W2000454848 hasAuthorship W2000454848A5026811332 @default.
• W2000454848 hasAuthorship W2000454848A5057077440 @default.
• W2000454848 hasAuthorship W2000454848A5084205776 @default.
• W2000454848 hasAuthorship W2000454848A5086749248 @default.
• W2000454848 hasBestOaLocation W20004548481 @default.
• W2000454848 hasConcept C104317684 @default.
• W2000454848 hasConcept C1292079 @default.
• W2000454848 hasConcept C134018914 @default.
• W2000454848 hasConcept C134306372 @default.
• W2000454848 hasConcept C170493617 @default.
• W2000454848 hasConcept C185592680 @default.
• W2000454848 hasConcept C2775960820 @default.
• W2000454848 hasConcept C2779306644 @default.
• W2000454848 hasConcept C2780378035 @default.
• W2000454848 hasConcept C2780689927 @default.
• W2000454848 hasConcept C33923547 @default.
• W2000454848 hasConcept C36503486 @default.
• W2000454848 hasConcept C515207424 @default.
• W2000454848 hasConcept C55493867 @default.
• W2000454848 hasConcept C86339819 @default.
• W2000454848 hasConcept C86803240 @default.
• W2000454848 hasConceptScore W2000454848C104317684 @default.
• W2000454848 hasConceptScore W2000454848C1292079 @default.

• next