FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000487817> ?p ?o ?g. }

• W2000487817 endingPage "21491" @default.
• W2000487817 startingPage "21481" @default.
• W2000487817 abstract "The Gram-positive bacterial pathogen Streptococcus pyogenes produces a C3 family ADP-ribosyltransferase designated SpyA (S. pyogenes ADP-ribosyltransferase). Our laboratory has identified a number of eukaryotic protein targets for SpyA, prominent among which are the cytoskeletal proteins actin and vimentin. Because vimentin is an unusual target for modification by bacterial ADP-ribosyltransferases, we quantitatively compared the activity of SpyA on vimentin and actin. Vimentin was the preferred substrate for SpyA (kcat, 58.5 ± 3.4 min−1) relative to actin (kcat, 10.1 ± 0.6 min−1), and vimentin was modified at a rate 9.48 ± 1.95-fold greater than actin. We employed tandem mass spectrometry analysis to identify sites of ADP-ribosylation on vimentin. The primary sites of modification were Arg-44 and -49 in the head domain, with several additional secondary sites identified. Because the primary sites are located in a domain of vimentin known to be important for the regulation of polymerization by phosphorylation, we investigated the effects of SpyA activity on vimentin polymerization, utilizing an in vitro NaCl-induced filamentation assay. SpyA inhibited vimentin filamentation, whereas a catalytic site mutant of SpyA had no effect. Additionally, we demonstrated that expression of SpyA in HeLa cells resulted in collapse of the vimentin cytoskeleton, whereas expression in RAW 264.7 cells impeded vimentin reorganization upon stimulation of this macrophage-like cell line with LPS. We conclude that SpyA modification of vimentin occurs in an important regulatory region of the head domain and has significant functional effects on vimentin assembly. The Gram-positive bacterial pathogen Streptococcus pyogenes produces a C3 family ADP-ribosyltransferase designated SpyA (S. pyogenes ADP-ribosyltransferase). Our laboratory has identified a number of eukaryotic protein targets for SpyA, prominent among which are the cytoskeletal proteins actin and vimentin. Because vimentin is an unusual target for modification by bacterial ADP-ribosyltransferases, we quantitatively compared the activity of SpyA on vimentin and actin. Vimentin was the preferred substrate for SpyA (kcat, 58.5 ± 3.4 min−1) relative to actin (kcat, 10.1 ± 0.6 min−1), and vimentin was modified at a rate 9.48 ± 1.95-fold greater than actin. We employed tandem mass spectrometry analysis to identify sites of ADP-ribosylation on vimentin. The primary sites of modification were Arg-44 and -49 in the head domain, with several additional secondary sites identified. Because the primary sites are located in a domain of vimentin known to be important for the regulation of polymerization by phosphorylation, we investigated the effects of SpyA activity on vimentin polymerization, utilizing an in vitro NaCl-induced filamentation assay. SpyA inhibited vimentin filamentation, whereas a catalytic site mutant of SpyA had no effect. Additionally, we demonstrated that expression of SpyA in HeLa cells resulted in collapse of the vimentin cytoskeleton, whereas expression in RAW 264.7 cells impeded vimentin reorganization upon stimulation of this macrophage-like cell line with LPS. We conclude that SpyA modification of vimentin occurs in an important regulatory region of the head domain and has significant functional effects on vimentin assembly. Streptococcus pyogenes (group A streptococcus) is a Gram-positive bacterial pathogen responsible for a number of human diseases, the most common being mild skin infections and pharyngitis, though more serious infections, such as necrotizing fasciitis, can occur (1Martin J.M. Green M. Group A streptococcus.Semin. Pediatr. Infect. Dis. 2006; 17: 140-148Crossref PubMed Scopus (67) Google Scholar). S. pyogenes produces numerous toxins, including superantigens, proteases, and potent cytolysins. Recently, we described a novel NAD+ glycohydrolase and mono-ADP-ribosyltransferase (ADPRT), 2The abbreviations used are:ADPRTADP-ribosyltransferaseϵ-NAD+etheno-NAD+ϵ-AMPetheno-AMPECDelectron capture dissociationIFintermediate filament. SpyA (2Coye L.H. Collins C.M. Identification of SpyA, a novel ADP-ribosyltransferase of Streptococcus pyogenes.Mol. Microbiol. 2004; 54: 89-98Crossref PubMed Scopus (41) Google Scholar), and demonstrated a role for SpyA in streptococcal pathogenesis (3Hoff J.S. DeWald M. Moseley S.L. Collins C.M. Voyich J.M. SpyA, a C3-like ADP-ribosyltransferase, contributes to virulence in a mouse subcutaneous model of Streptococcus pyogenes infection.Infect. Immun. 2011; 79: 2404-2411Crossref PubMed Scopus (16) Google Scholar). ADP-ribosyltransferase etheno-NAD+ etheno-AMP electron capture dissociation intermediate filament. Although ADPRTs serve diverse functions, they all maintain a similar mechanism of action, the covalent transfer of an ADP-ribose moiety, donated from NAD+, onto a target protein, modifying target activity. Endogenous eukaryotic ADPRTs function as regulatory enzymes and can modify both intra- and extracellular proteins. Intracellular protein targets include the intermediate filament desmin, heterotrimeric G protein βγ subunit, and elongation factor 2 (4Huang H.Y. Graves D.J. Robson R.M. Huiatt T.W. ADP-ribosylation of the intermediate filament protein desmin and inhibition of desmin assembly in vitro by muscle ADP-ribosyltransferase.Biochem. Biophys. Res. Commun. 1993; 197: 570-577Crossref PubMed Scopus (30) Google Scholar, 5Huang H.Y. Zhou H. Huiatt T.W. Graves D.J. Target proteins for arginine-specific mono(ADP-ribosyl) transferase in membrane fractions from chick skeletal muscle cells.Exp. Cell Res. 1996; 226: 147-153Crossref PubMed Scopus (15) Google Scholar, 6Zhou H. Huiatt T.W. Robson R.M. Sernett S.W. Graves D.J. Characterization of ADP-ribosylation sites on desmin and restoration of desmin intermediate filament assembly by de-ADP-ribosylation.Arch. Biochem. Biophys. 1996; 334: 214-222Crossref PubMed Scopus (22) Google Scholar, 7Lupi R. Corda D. Di Girolamo M. Endogenous ADP-ribosylation of the G protein β subunit prevents the inhibition of type 1 adenylyl cyclase.J. Biol. Chem. 2000; 275: 9418-9424Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 8Lupi R. Dani N. Dietrich A. Marchegiani A. Turacchio S. Berrie C.P. Moss J. Gierschik P. Corda D. Di Girolamo M. Endogenous mono-ADP-ribosylation of the free Gβγ prevents stimulation of phosphoinositide 3-kinase-γ and phospholipase C-β2 and is activated by G-protein-coupled receptors.Biochem. J. 2002; 367: 825-832Crossref PubMed Google Scholar, 9Fendrick J.L. Iglewski W.J. Endogenous ADP-ribosylation of elongation factor 2 in polyoma virus-transformed baby hamster kidney cells.Proc. Natl. Acad. Sci. U.S.A. 1989; 86: 554-557Crossref PubMed Scopus (52) Google Scholar, 10Jäger D. Werdan K. Müller-Werdan U. Endogenous ADP-ribosylation of elongation factor-2 by interleukin-1β.Mol. Cell. Biochem. 2011; 348: 125-128Crossref PubMed Scopus (8) Google Scholar). A member of the ectoenzyme family of vertebrate mono-ADPRTs, ART-1, modifies the defensin human neutrophil peptide-1, regulating its antimicrobial and cytotoxic activities (11Paone G. Wada A. Stevens L.A. Matin A. Hirayama T. Levine R.L. Moss J. ADP ribosylation of human neutrophil peptide-1 regulates its biological properties.Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 8231-8235Crossref PubMed Scopus (112) Google Scholar, 12Paone G. Stevens L.A. Levine R.L. Bourgeois C. Steagall W.K. Gochuico B.R. Moss J. ADP-ribosyltransferase-specific modification of human neutrophil peptide-1.J. Biol. Chem. 2006; 281: 17054-17060Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). ADPRTs also represent a class of potent bacterial toxins. Among them are cholera, diphtheria, and pertussis toxins. The clostridial C2 and C3 toxin families represent a class of bacterial ADPRTs that target cytoskeletal proteins. The actin cytoskeleton is a well characterized target of the C2 toxins; ADP-ribosylated actin subunits are sterically unable to form filaments and furthermore act as capping proteins on existing filaments, leading to the eventual collapse of the actin cytoskeleton (13Margarit S.M. Davidson W. Frego L. Stebbins C.E. A steric antagonism of actin polymerization by a salmonella virulence protein.Structure. 2006; 14: 1219-1229Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 14Wegner A. Aktories K. ADP-ribosylated actin caps the barbed ends of actin filaments.J. Biol. Chem. 1988; 263: 13739-13742Abstract Full Text PDF PubMed Google Scholar, 15Weigt C. Just I. Wegner A. Aktories K. Nonmuscle actin ADP-ribosylated by botulinum C2 toxin caps actin filaments.FEBS Lett. 1989; 246: 181-184Crossref PubMed Scopus (44) Google Scholar, 16Perieteanu A.A. Visschedyk D.D. Merrill A.R. Dawson J.F. ADP-ribosylation of cross-linked actin generates barbed-end polymerization-deficient F-actin oligomers.Biochemistry. 2010; 49: 8944-8954Crossref PubMed Scopus (12) Google Scholar). There is also evidence of C2 family toxin-mediated microtubular reorganization (17Schwan C. Stecher B. Tzivelekidis T. van Ham M. Rohde M. Hardt W.D. Wehland J. Aktories K. Clostridium difficile toxin CDT induces formation of microtubule-based protrusions and increases adherence of bacteria.PLoS Pathog. 2009; 5: e1000626Crossref PubMed Scopus (250) Google Scholar). The C3 family of toxins, including the Staphylococcus aureus EDIN (also termed C3stau) toxin, are small enzymes that lack a known translocation domain. These toxins inactivate Rho GTPases, resulting in a downstream massive and lethal reorganization of the actin cytoskeleton (18Chardin P. Boquet P. Madaule P. Popoff M.R. Rubin E.J. Gill D.M. The mammalian G protein rhoC is ADP-ribosylated by Clostridium botulinum exoenzyme C3 and affects actin microfilaments in Vero cells.EMBO J. 1989; 8: 1087-1092Crossref PubMed Scopus (422) Google Scholar, 19Paterson H.F. Self A.J. Garrett M.D. Just I. Aktories K. Hall A. Microinjection of recombinant p21rho induces rapid changes in cell morphology.J. Cell Biol. 1990; 111: 1001-1007Crossref PubMed Scopus (571) Google Scholar, 20Wiegers W. Just I. Müller H. Hellwig A. Traub P. Aktories K. Alteration of the cytoskeleton of mammalian cells cultured in vitro by Clostridium botulinum C2 toxin and C3 ADP-ribosyltransferase.Eur. J. Cell Biol. 1991; 54: 237-245PubMed Google Scholar, 21Wilde C. Chhatwal G.S. Schmalzing G. Aktories K. Just I. A novel C3-like ADP-ribosyltransferase from Staphylococcus aureus modifying RhoE and Rnd3.J. Biol. Chem. 2001; 276: 9537-9542Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 22Wilde C. Aktories K. The Rho-ADP-ribosylating C3 exoenzyme from Clostridium botulinum and related C3-like transferases.Toxicon. 2001; 39: 1647-1660Crossref PubMed Scopus (64) Google Scholar, 23Wilde C. Chhatwal G.S. Aktories K. C3stau, a new member of the family of C3-like ADP-ribosyltransferases.Trends Microbiol. 2002; 10: 5-7Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar, 24Wilde C. Just I. Aktories K. Structure-function analysis of the Rho-ADP-ribosylating exoenzyme C3stau2 from Staphylococcus aureus.Biochemistry. 2002; 41: 1539-1544Crossref PubMed Scopus (33) Google Scholar). Finally, the promiscuous bacterial effector protein ExoS of Pseudomonas aeruginosa has been shown to ADP-ribosylate numerous targets, including the intermediate filament vimentin (25Coburn J. Dillon S.T. Iglewski B.H. Gill D.M. Exoenzyme S of Pseudomonas aeruginosa ADP-ribosylates the intermediate filament protein vimentin.Infect. Immun. 1989; 57: 996-998Crossref PubMed Google Scholar). Previously, we identified vimentin as a substrate for SpyA (2Coye L.H. Collins C.M. Identification of SpyA, a novel ADP-ribosyltransferase of Streptococcus pyogenes.Mol. Microbiol. 2004; 54: 89-98Crossref PubMed Scopus (41) Google Scholar). Vimentin is an intermediate filament (IF) protein found in cells of mesenchymal origin and forms filaments 10 nm in diameter. Like other IF proteins, vimentin is composed of a globular “head” domain at the N terminus followed by two coiled-coil regions and a globular “tail” domain. Although the role of vimentin is currently being fully elucidated, it is known to be important in cellular stability to mechanical stress, cell movement during wound healing, and leukocyte adhesion and migration (26Eckes B. Dogic D. Colucci-Guyon E. Wang N. Maniotis A. Ingber D. Merckling A. Langa F. Aumailley M. Delouvée A. Koteliansky V. Babinet C. Krieg T. Impaired mechanical stability, migration and contractile capacity in vimentin-deficient fibroblasts.J. Cell Sci. 1998; 111: 1897-1907Crossref PubMed Google Scholar, 27Eckes B. Colucci-Guyon E. Smola H. Nodder S. Babinet C. Krieg T. Martin P. Impaired wound healing in embryonic and adult mice lacking vimentin.J. Cell Sci. 2000; 113: 2455-2462Crossref PubMed Google Scholar, 28Nieminen M. Henttinen T. Merinen M. Marttila-Ichihara F. Eriksson J.E. Jalkanen S. Vimentin function in lymphocyte adhesion and transcellular migration.Nat. Cell Biol. 2006; 8: 156-162Crossref PubMed Scopus (347) Google Scholar, 29Ivaska J. Pallari H.M. Nevo J. Eriksson J.E. Novel functions of vimentin in cell adhesion, migration, and signaling.Exp. Cell Res. 2007; 313: 2050-2062Crossref PubMed Scopus (571) Google Scholar). There is also evidence for an important role of vimentin in organelle positioning and membrane protein trafficking (30Styers M.L. Kowalczyk A.P. Faundez V. Intermediate filaments and vesicular membrane traffic. The odd couple's first dance?.Traffic. 2005; 6: 359-365Crossref PubMed Scopus (76) Google Scholar). Like other cytoskeletal proteins, vimentin appears to have a role in cell signal transduction, potentially as a scaffold for signaling molecules, and caspase-cleaved vimentin promotes apoptosis (31Pallari H.M. Eriksson J.E. Sci. STKE. 2006; 2006: pe53Crossref PubMed Scopus (96) Google Scholar, 32Coulombe P.A. Wong P. Cytoplasmic intermediate filaments revealed as dynamic and multipurpose scaffolds.Nat. Cell Biol. 2004; 6: 699-706Crossref PubMed Scopus (280) Google Scholar, 33Byun Y. Chen F. Chang R. Trivedi M. Green K.J. Cryns V.L. Caspase cleavage of vimentin disrupts intermediate filaments and promotes apoptosis.Cell Death Differ. 2001; 8: 443-450Crossref PubMed Scopus (285) Google Scholar, 34Schietke R. Bröhl D. Wedig T. Mücke N. Herrmann H. Magin T.M. Mutations in vimentin disrupt the cytoskeleton in fibroblasts and delay execution of apoptosis.Eur. J. Cell Biol. 2006; 85: 1-10Crossref PubMed Scopus (45) Google Scholar). Vimentin production has also been implicated in the maturation and full bactericidal function of macrophages (35Mor-Vaknin N. Punturieri A. Sitwala K. Markovitz D.M. Vimentin is secreted by activated macrophages.Nat. Cell Biol. 2003; 5: 59-63Crossref PubMed Scopus (407) Google Scholar, 36Benes P. Macecková V. Zdráhal Z. Konecná H. Zahradnícková E. Muzík J. Smarda J. Role of vimentin in regulation of monocyte/macrophage differentiation.Differentiation. 2006; 74: 265-276Crossref PubMed Scopus (48) Google Scholar). The effects of SpyA on vimentin function have not been described; however, vimentin was recently identified as a target in a screen of endogenously ADP-ribosylated proteins (37Dani N. Stilla A. Marchegiani A. Tamburro A. Till S. Ladurner A.G. Corda D. Di Girolamo M. Combining affinity purification by ADP-ribose-binding macro domains with mass spectrometry to define the mammalian ADP-ribosyl proteome.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 4243-4248Crossref PubMed Scopus (87) Google Scholar). Although the effect of ADP-ribosylation on actin by bacterial ADPRTs has been studied extensively, the effect of this modification on vimentin has not been previously elucidated. However, ADP-ribosylation of the related IF protein desmin by an endogenous muscle ADPRT has been reported and was found to cause impairment in IF formation (4Huang H.Y. Graves D.J. Robson R.M. Huiatt T.W. ADP-ribosylation of the intermediate filament protein desmin and inhibition of desmin assembly in vitro by muscle ADP-ribosyltransferase.Biochem. Biophys. Res. Commun. 1993; 197: 570-577Crossref PubMed Scopus (30) Google Scholar, 5Huang H.Y. Zhou H. Huiatt T.W. Graves D.J. Target proteins for arginine-specific mono(ADP-ribosyl) transferase in membrane fractions from chick skeletal muscle cells.Exp. Cell Res. 1996; 226: 147-153Crossref PubMed Scopus (15) Google Scholar, 38Yuan J. Huiatt T.W. Liao C.X. Robson R.M. Graves D.J. The effects of mono-ADP-ribosylation on desmin assembly-disassembly.Arch. Biochem. Biophys. 1999; 363: 314-322Crossref PubMed Scopus (21) Google Scholar). The two major sites of modification of desmin, determined by MALDI analysis, were located in the N-terminal head domain in the same region containing regulatory phosphorylation sites, important for the regulation of polymerization (6Zhou H. Huiatt T.W. Robson R.M. Sernett S.W. Graves D.J. Characterization of ADP-ribosylation sites on desmin and restoration of desmin intermediate filament assembly by de-ADP-ribosylation.Arch. Biochem. Biophys. 1996; 334: 214-222Crossref PubMed Scopus (22) Google Scholar, 39Geisler N. Weber K. Phosphorylation of desmin in vitro inhibits formation of intermediate filaments. Identification of three kinase A sites in the amino-terminal head domain.EMBO J. 1988; 7: 15-20Crossref PubMed Scopus (153) Google Scholar, 40Geisler N. Hatzfeld M. Weber K. Phosphorylation in vitro of vimentin by protein kinases A and C is restricted to the head domain. Identification of the phosphoserine sites and their influence on filament formation.Eur. J. Biochem. 1989; 183: 441-447Crossref PubMed Scopus (93) Google Scholar). The current study seeks to characterize the SpyA-mediated ADP-ribosylation of vimentin. Although SpyA was shown to be a promiscuous ADPRT, modifying a number of proteins in a two-dimensional gel analysis, vimentin appeared to be a major target (2Coye L.H. Collins C.M. Identification of SpyA, a novel ADP-ribosyltransferase of Streptococcus pyogenes.Mol. Microbiol. 2004; 54: 89-98Crossref PubMed Scopus (41) Google Scholar). We present enzyme kinetic data for SpyA modification of vimentin and actin, which supports the hypothesis that vimentin is an important target of SpyA. To understand the nature of the ADP-ribosylation of vimentin, we determined primary sites of modification using tandem mass spectrometry. We demonstrate the effect of SpyA-mediated ADP-ribosylation on the ability of vimentin to form filaments in vitro and the in vivo effects of SpyA on the vimentin cytoskeleton in HeLa cells and activated RAW 264.7 macrophages. Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, and Pfu Turbo DNA polymerase were purchased from New England Biolabs. [32P]NAD+, etheno-NAD (ϵ-NAD+), and biotinylated NAD+ were purchased from American Radiolabeled Chemicals (St. Louis, MO), Biolog Inc. (Hayward, CA), and Trevigen (Gaithersburg, MD), respectively. All tissue culture supplies were purchased from Invitrogen, and all chemicals were acquired from Sigma-Aldrich unless indicated otherwise. Bovine cardiac actin and Syrian hamster vimentin were purchased from Cytoskeleton (Denver, CO). Chemicon (Temecula, CA) produced all antibodies except where indicated. Protective antigen was acquired from List Biologicals (Campbell, CA), and Slow Fade light Antifade reagent was from Molecular Probes, Inc. (Grand Island, NY). Ultrapure Salmonella minnesota R595 lipopolysaccharide (LPS) was a gift from Dr. Brad Cookson and Dr. Tessa Bergsbaken (List Biologicials). S. pyogenes SF370 was purchased from the ATCC (The Global Bioresource CenterTM). Escherichia coli strains BL21(DE3), DH5α, and Rosetta (DE3) were acquired from Novagen (Philadelphia, PA). E. coli DH5α was the host strain for all recombinant plasmids, unless otherwise noted. E. coli cultures were grown in Luria broth (LB) with aeration at 37 °C, in the presence of either kanamycin (30 μg/ml) or carbenicillin (50 μg/ml) when needed. Human cDNA (I.M.A.G.E. Clone ID 4823475) was used to amplify a 1,401-bp PCR product consisting of the gene encoding vimentin. The primer pair GCCATGGGATCCACCAGGTCCGTGTCCT (forward, NcoI site in boldface type) and GAAGCTTCTTCAAGGTCATCGTGATG (reverse, HindIII site in boldface type) was employed for PCR. The PCR product was digested with NcoI and HindIII and ligated into NcoI/HindIII-digested pET21d (Novagen). The resulting plasmid was designated pET21Vim and transformed into competent E. coli Rosetta (DE3) using the manufacturer's protocol. For transfection of HeLa cells, transfection plasmids pCMV-myc-SpyA and pCMV-myc-SpyA-E187A were constructed by PCR-amplifying the spyA and spyA-E187A using pET15b-SpyA and pET15b-SpyAE187A template, respectively, and primers GAGAGAGAGAATTCTGGTCTGTGAGCACTATGAGCGGGC (forward primer) and GAGAGAGACTCGAGTTACAAACTGCCCTTGAAATACGCTTC (reverse primer). The PCR product was digested with EcoRI and XhoI and ligated into the eukaryotic expression vector pCMV-myc (Clontech, Mountain View, CA) also digested with EcoRI and XhoI and transformed into E. coli. A second SpyA expression plasmid utilizing the bicistronic expression plasmid pEF1α-IRES-DsRed-Express2 (Clontech) was created for use in the RAW 264.7 cells. The spyA and spyA-E187A inserts were created as described above, using forward primer GAGAGAGAGAATTCGCCACCATGGTCTGTGAGCACTATGAGCGG and reverse primer GAGAGAGAGGATCCTCACAAACTGCCCTTGAAATACGCTTCTATG. The resulting PCR product was digested with EcoRI and BamHI, ligated into similarly digested pEF1α-IRES-DsRed-Express2, and transformed into E. coli. The resulting plasmids were pEF1α-IRES-DsRed-Express2-SpyA and pEF1α-IRES-DsRed-Express2-SpyAE187A. For expression and purification of SpyA and the catalytic site mutant SpyAE187A, the expression plasmids pET15bSpyA and pET15bSpyA-E187A were utilized as described (2Coye L.H. Collins C.M. Identification of SpyA, a novel ADP-ribosyltransferase of Streptococcus pyogenes.Mol. Microbiol. 2004; 54: 89-98Crossref PubMed Scopus (41) Google Scholar). All enzymes were subsequently assayed for activity via a vimentin modification assay. 877 nm vimentin, 100 mm biotinylated NAD, 0.5 μm SpyA, 100 μm biotinylated NAD+ in 100 mm HEPES, pH 7.2, was reacted for 1 h at 37 °C. The samples were then resolved on a 15% SDS-polyacrylamide gel. Biotinylated samples were analyzed via Western blot against biotinylated ADP-ribose using streptavidin-HRP (1:10,000) (Pierce). To express human vimentin, E. coli BL21(DE3) Rosetta was transformed with pET21Vim and grown in LB with carbenicillin (50 μg/ml) overnight with aeration at 37 °C. The transformed cells were subcultured and grown to an A600 of 0.6. Isopropyl β-d-thiogalactoside was added to a final concentration of 1 mm. Vimentin was expressed for 6 h at 37 °C. Cells were then centrifuged for 10 min at 4,400 × g at 4 °C and then frozen at −20 °C. The pellets were defrosted and passed through a French press to lyse cells. Lysates were centrifuged for 10 min at 4,400 × g at 4 °C, and pelleted inclusion bodies were collected. The inclusion bodies were then washed twice in 0.1% Triton X-100 in PBS. The final pellet was dissolved overnight in 8 m urea in vimentin subunit buffer (10 mm Tris, pH 8.4). This and all subsequent steps were done at 4 °C with stirring. The urea was removed by stepwise dialysis, beginning with dialysis against 4 m urea in vimentin subunit buffer for 4 h. The vimentin solution was subsequently dialyzed against 2, 1, and 0.5 m and finally 0 m urea in vimentin subunit buffer, each for a minimum of 4 h. Unless otherwise stated, all constants were expressed as averaged values ± S.D. of three independent experiments, each done in triplicate. To determine the kinetic constants, the fluorescent NAD+ analog, ϵ-NAD+, was used as described (41Visschedyk D.D. Perieteanu A.A. Turgeon Z.J. Fieldhouse R.J. Dawson J.F. Merrill A.R. Photox, a novel actin-targeting mono-ADP-ribosyltransferase from Photorhabdus luminescens.J. Biol. Chem. 2010; 285: 13525-13534Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar), with the following modifications. The ADP-ribosylation reaction was performed as follows: 8.77 μm human vimentin or actin was added to 0.085 μm SpyA in 100 mm HEPES buffer at 37 °C. Nine concentrations of ϵ-NAD+ were added for final concentrations of 300, 200, 100, 50, 25, 12.5, 6.25, 1, or 0 μm. Control experiments were also performed in the absence of vimentin or actin to determine the rate of NAD+-glycohydrolysis. To create a standard calibration curve, concentrations of ϵ-AMP identical to those used for ϵ-NAD+ were also analyzed under the same conditions. Reactions were then run on an Envision Multilabel plate reader (PerkinElmer Life Sciences) at 300-nm excitation and 415-nm emission. Readings were taken for a minimum of 30 min. Prior to data analysis, the background glycohydrolase activity was subtracted from the ADP-ribosylation reactions. Fluorescence intensity was converted to micromolar of product formed using the ϵ-AMP calibration curve as previously described (42Armstrong S. Merrill A.R. Application of a fluorometric assay for characterization of the catalytic competency of a domain III fragment of Pseudomonas aeruginosa exotoxin A.Anal. Biochem. 2001; 292: 26-33Crossref PubMed Scopus (41) Google Scholar, 43Klebl B.M. Pette D. A fluorometric assay for measurement of mono-ADP-ribosyltransferase activity.Anal. Biochem. 1996; 239: 145-152Crossref PubMed Scopus (20) Google Scholar). The linear range, 0–5 min, was determined, and the rates of the reactions were measured for each concentration of ϵ-NAD+. These rates were subsequently analyzed using nonlinear regression analysis by Prism software. The data were fit to a standard Michaelis-Menten model. Statistical significance was measured by an unpaired t test, and the two-tailed p value was reported as less than 0.0001 (GraphPad). Equimolar amounts of hamster vimentin and actin (877 nm) were added to 0.5 μm SpyA, 100 μm biotinylated NAD+ or [32P]NAD+ in 100 mm HEPES. Reactions were incubated at 37 °C, and 20-μl aliquots were taken at 0, 0.25, 5, 10, 30, and 90 min. Proteins were then resolved via SDS-PAGE, and biotinylated samples were assessed by Western blot as described under “Recombinant Protein Expression, Purification, and Activity.” Radiolabeled samples, in triplicate, were subjected to phosphorimaging using a Storm 840 PhosphorImager (GE Healthcare) and analyzed using ImageJ software (44Abramoff M.D. Magalhaes P.J. Ram S.J. Image processing with ImageJ.Biophotonics International. 2004; 11: 36-42Google Scholar). Hydroxylamine (NH2OH) and mercuric chloride (HgCl2) were used to probe the chemical sensitivity of SpyA-modified vimentin. SpyA (0.5 μm) was reacted with 4.5 μm hamster vimentin and 100 μm biotinylated NAD+ in 100 mm HEPES for 1 h at 37 °C. The reaction was terminated by boiling for 5 min, and samples were incubated with either 0.5 m NaCl (control), 1 mm HgCl2, or 0.5 m NH2OH for 90 min at 30 °C. Samples were then resolved by 15% SDS-PAGE and analyzed via Western blot as describe under “Competition Assay.” A time course, with time points at 0, 5, 10, 20, 30, 60, 90, 120, 150, and 180 min, was run to determine ADP-ribose incorporation into vimentin. 2.3 μm hamster vimentin was incubated at 37 °C with 0.3 μm SpyA and a 100 μm mixture of NAD+ and [32P]NAD+ in 100 mm HEPES. Reactions were terminated by the addition of 6× SDS-PAGE loading buffer with β-mercaptoethanol. Proteins were resolved by 15% SDS-PAGE. The gel was fixed and dried, and vimentin bands were excised and subjected to scintillation counting. A calibration curve was created using serial dilutions of the NAD+/[32P]NAD+ mixture, and counts/min were converted to μm radiolabeled ADP-ribose incorporated/μm vimentin. An 877 nm concentration of either hamster or human vimentin was incubated with SpyA (1, 0.5, or 0.2 μm) and 100 μm NAD+ in 100 mm HEPES buffer for 5, 15, or 30 min. Following protein incubation with SpyA, urea was added to a final concentration of 6 m, and 1.5 μl of 1.5 m Tris, pH 8.8, was added to maintain a basic pH during reduction. Proteins were reduced for 1 h at 37 °C with 5 mm tris(2-carboxyethyl)phosphine. Alkylation of cysteine residues was performed with 30 mm iodoacetamide for 1 h in the dark at room temperature, followed by the addition of dithiothreitol (DTT) to a final concentration of 30 mm and a 1-h incubation at room temperature. Samples were then diluted with 900 μl of 50 mm ammonium bicarbonate, and sequencing grade trypsin (Promega, Madison, WI) or GluC (Roche Applied Science) was added at a protein/enzyme ratio of 1:50. Digestion proceeded overnight at room temperature. Samples were desalted using a Vydac silica C18 macrospin column (The Nest Group, Southborough, MA). ADP-ribosylated peptides were analyzed using the “marker ion” approach previously described by Hengel et al. (45Hengel S.M. Shaffer S.A. Nunn B.L. Goodlett D.R. Tandem mass spectrometry investigation of ADP-ribosylated kemptide.J. Am. Soc. Mass Spectrom. 2009; 20: 477-483Crossref PubMed Scopus (35) Google Scholar, 46Hengel S.M. Icenogle L. Collins C. Goodlett D.R. Sequence assignment of ADP-ribosylated peptides is facilitated as peptide length increases.Rapid Commun. Mass Spectrom. 2010; 24: 2312-2316Crossref PubMed Scopus (8) Google Scholar). Briefly, peptides were analyzed using electrospray ionization in a linear ion trap Fourier transform ion cyclotron resonance mass spectrometer or linear ion trap Orbitrap (Thermo Electron Corp., San Jose, CA). HPLC columns were packed in house (0.75-μm inner diameter × 11 cm; 100 Å Magic C18AQ: Michrom Bioresources, Auburn, CA), and separations were performed with an inline Agilent 1100 binary HPLC pump or nanoAcquity (Waters, Milford, MA), using a linear gradient of 5–35% acetonitrile over 60 min. Electrospray ionization voltage was applied with a liquid junction prior to the analytical column using a gold wire and a micro-tee junction (47Yi E.C" @default.
• W2000487817 created "2016-06-24" @default.
• W2000487817 creator A5013886117 @default.
• W2000487817 creator A5023542709 @default.
• W2000487817 creator A5040152113 @default.
• W2000487817 creator A5077830669 @default.
• W2000487817 creator A5081817209 @default.
• W2000487817 creator A5082031224 @default.
• W2000487817 creator A5090274106 @default.
• W2000487817 date "2012-06-01" @default.
• W2000487817 modified "2023-09-27" @default.
• W2000487817 title "Molecular and Biological Characterization of Streptococcal SpyA-mediated ADP-ribosylation of Intermediate Filament Protein Vimentin" @default.
• W2000487817 cites W129191972 @default.
• W2000487817 cites W1518494318 @default.
• W2000487817 cites W1547349392 @default.
• W2000487817 cites W1572866498 @default.
• W2000487817 cites W1584847179 @default.
• W2000487817 cites W1586819758 @default.
• W2000487817 cites W1607962470 @default.
• W2000487817 cites W170283987 @default.
• W2000487817 cites W1821042112 @default.
• W2000487817 cites W1963927564 @default.
• W2000487817 cites W1969349910 @default.
• W2000487817 cites W1971137669 @default.
• W2000487817 cites W1974890655 @default.
• W2000487817 cites W1978128233 @default.
• W2000487817 cites W1979805063 @default.
• W2000487817 cites W1981567871 @default.
• W2000487817 cites W1987008680 @default.
• W2000487817 cites W1989241545 @default.
• W2000487817 cites W1990569194 @default.
• W2000487817 cites W1991320177 @default.
• W2000487817 cites W1997945239 @default.
• W2000487817 cites W1999641519 @default.
• W2000487817 cites W2000857527 @default.
• W2000487817 cites W2002010372 @default.
• W2000487817 cites W2002117112 @default.
• W2000487817 cites W2002401447 @default.
• W2000487817 cites W2005441336 @default.
• W2000487817 cites W2007070822 @default.
• W2000487817 cites W2008867391 @default.
• W2000487817 cites W2010898602 @default.
• W2000487817 cites W2016290019 @default.
• W2000487817 cites W2018172411 @default.
• W2000487817 cites W2018741337 @default.
• W2000487817 cites W2019803551 @default.
• W2000487817 cites W2023022330 @default.
• W2000487817 cites W2023814514 @default.
• W2000487817 cites W2025599551 @default.
• W2000487817 cites W2025962782 @default.
• W2000487817 cites W2026465178 @default.
• W2000487817 cites W2028094847 @default.
• W2000487817 cites W2028813908 @default.
• W2000487817 cites W2029872541 @default.
• W2000487817 cites W2030374826 @default.
• W2000487817 cites W2031096972 @default.
• W2000487817 cites W2036145728 @default.
• W2000487817 cites W2038106230 @default.
• W2000487817 cites W2038935831 @default.
• W2000487817 cites W2048828174 @default.
• W2000487817 cites W2048906629 @default.
• W2000487817 cites W2054091633 @default.
• W2000487817 cites W2055645490 @default.
• W2000487817 cites W2057232203 @default.
• W2000487817 cites W2059550312 @default.
• W2000487817 cites W2067129601 @default.
• W2000487817 cites W2067605157 @default.
• W2000487817 cites W2073464906 @default.
• W2000487817 cites W2075188961 @default.
• W2000487817 cites W2077103365 @default.
• W2000487817 cites W2078776671 @default.
• W2000487817 cites W2084480265 @default.
• W2000487817 cites W2087901383 @default.
• W2000487817 cites W2092518143 @default.
• W2000487817 cites W2093977796 @default.
• W2000487817 cites W2108157943 @default.
• W2000487817 cites W2114389798 @default.
• W2000487817 cites W2115875812 @default.
• W2000487817 cites W2117109291 @default.
• W2000487817 cites W2130150098 @default.
• W2000487817 cites W2134754798 @default.
• W2000487817 cites W2139547086 @default.
• W2000487817 cites W2142667010 @default.
• W2000487817 cites W2143325804 @default.
• W2000487817 cites W2148256413 @default.
• W2000487817 cites W2150807470 @default.
• W2000487817 cites W2155733208 @default.
• W2000487817 cites W2157162711 @default.
• W2000487817 cites W2160483862 @default.
• W2000487817 cites W2166820447 @default.
• W2000487817 cites W2171339171 @default.
• W2000487817 cites W33138032 @default.
• W2000487817 doi "https://doi.org/10.1074/jbc.m112.370791" @default.
• W2000487817 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3375569" @default.
• W2000487817 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22549780" @default.
• W2000487817 hasPublicationYear "2012" @default.
• W2000487817 type Work @default.
• W2000487817 sameAs 2000487817 @default.

• next