FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000514089> ?p ?o ?g. }

• W2000514089 endingPage "27522" @default.
• W2000514089 startingPage "27513" @default.
• W2000514089 abstract "We report the identification of a natural antisense mRNA of hyaluronan synthase 2 that we have chosen to designate as HASNT (for HA synthase 2 antisense) in human and mouse. HASNT is transcribed from the opposite strand of the HAS2 gene locus and is represented by several independent expressed sequence tags in human. Portions of the mouse Hasnt gene were identified through an exon-trapping approach. Sequence conservation is extremely low between human and mouse HASNT, and it is not clear whether these mRNAs contain functional open reading frames. HASNT has an alternate splice site in both human and mouse. This splice site is located at an identical position within the gene in both species and results in mRNAs of two different lengths. In each species, the antisense portion of the HASNT gene is complementary to the first exon of HAS2, which represents the 5′-untranslated region. To study the biological activity of HASNT, two human expressed sequence tag clones, representing long and short HASNT splice variants, were cloned into a tetracycline-inducible vector and were stably transfected into human osteosarcoma U2-OS Tet-on cells. The long and short HASNT-expressing cells had a reduction in HAS2 mRNA levels up to 94 and 86%, respectively, whereas hyaluronan biosynthesis was inhibited by 40 and 37%, respectively. Cell proliferation was reduced throughout the time frame of the experiment. Exogenous high molecular mass hyaluronan failed to rescue the suppressed cell proliferation, whereas adenoviral-mediated overexpression of hyaluronan synthase 3, which stimulated endogenous hyaluronan biosynthesis, was able to rescue. Collectively, our data suggest that natural antisense mRNAs of HAS2 are able to regulate HAS2 mRNA levels and hyaluronan biosynthesis in a cell culture model system and may have an important and novel regulatory role in the control of HAS2, HA biosynthesis, and HA-dependent cell functions in vivo. We report the identification of a natural antisense mRNA of hyaluronan synthase 2 that we have chosen to designate as HASNT (for HA synthase 2 antisense) in human and mouse. HASNT is transcribed from the opposite strand of the HAS2 gene locus and is represented by several independent expressed sequence tags in human. Portions of the mouse Hasnt gene were identified through an exon-trapping approach. Sequence conservation is extremely low between human and mouse HASNT, and it is not clear whether these mRNAs contain functional open reading frames. HASNT has an alternate splice site in both human and mouse. This splice site is located at an identical position within the gene in both species and results in mRNAs of two different lengths. In each species, the antisense portion of the HASNT gene is complementary to the first exon of HAS2, which represents the 5′-untranslated region. To study the biological activity of HASNT, two human expressed sequence tag clones, representing long and short HASNT splice variants, were cloned into a tetracycline-inducible vector and were stably transfected into human osteosarcoma U2-OS Tet-on cells. The long and short HASNT-expressing cells had a reduction in HAS2 mRNA levels up to 94 and 86%, respectively, whereas hyaluronan biosynthesis was inhibited by 40 and 37%, respectively. Cell proliferation was reduced throughout the time frame of the experiment. Exogenous high molecular mass hyaluronan failed to rescue the suppressed cell proliferation, whereas adenoviral-mediated overexpression of hyaluronan synthase 3, which stimulated endogenous hyaluronan biosynthesis, was able to rescue. Collectively, our data suggest that natural antisense mRNAs of HAS2 are able to regulate HAS2 mRNA levels and hyaluronan biosynthesis in a cell culture model system and may have an important and novel regulatory role in the control of HAS2, HA biosynthesis, and HA-dependent cell functions in vivo. Hyaluronan (HA) 1The abbreviations used are: HA, hyaluronan; HAS, hyaluronan synthase; HASNT, HA synthase 2 antisense; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide; EST, expressed sequence tag; ORF, open reading frame; bp, base pair(s); kbp, kilobase pair(s). is a linear, unmodified glycosaminoglycan polymer composed of repeating (N-acetyl-d-glucosamine-β(1→4)-d-glucuronic acid-β(1→3)) disaccharide units. HA is both a common and necessary component of extracellular matrices within most vertebrate tissues (1Meyer K. Palmer J.W. J. Biol. Chem. 1934; 107: 629-634Abstract Full Text PDF Google Scholar, 2Knudson W. Laurent C.B. J. Cell Sci. 1992; 99: 227-235Crossref Google Scholar, 3Knudson C.B. Knudson W. FASEB J. 1993; 7: 1233-1241Crossref PubMed Scopus (601) Google Scholar). HA functions not only as a major structural component, but it can also regulate a variety of physiological and pathological functions, such as cell proliferation, cell adhesion, migration, differentiation, and metastatic spread of tumor cells (4Rilla K. Lammi M.J. Sironen R. Torronen K. Luukkonen M. Hascall V.C. Midura R.J. Hyttinen M. Pelkonen J. Tammi M. Tammi R. J. Cell Sci. 2002; 115: 3633-3643Crossref PubMed Scopus (59) Google Scholar, 5Itano N. Atsumi F. Sawai T. Yamada Y. Miyaishi O. Senga T. Hamaguchi M. Kimata K. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3609-3614Crossref PubMed Scopus (268) Google Scholar, 6Turley E.A. Nobel P.W. Bourguignon L.Y.W. J. Biol. Chem. 2002; 277: 4589-4592Abstract Full Text Full Text PDF PubMed Scopus (882) Google Scholar). Mammalian HA is synthesized at the plasma membrane by one of three HA synthases (HASs), HAS1, HAS2, and HAS3 (7Spicer A.P. McDonald J.A. J. Biol. Chem. 1998; 273: 1923-1932Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar, 8Itano N. Sawai T. Yoshida M. Lenas P. Yamada Y. Imagawa M. Shinomura T. Hamaguchi M. Yoshida Y. Ohnuki Y. Miyauchi S. Spicer A.P. McDonald J.A. Kimata K. J. Biol. Chem. 1999; 274: 25085-25092Abstract Full Text Full Text PDF PubMed Scopus (717) Google Scholar). Three mammalian HASs are differentially expressed in response to external stimulation or physiopathological conditions (9Elvin J.A. Clark A.T. Wang P. Wolfman N.M. Matzuk M.M. Mol. Endocrinol. 1999; 13: 1035-1048Crossref PubMed Google Scholar, 10Kaback L.A. Smith T.J. J. Clin. Endocrinol. Metab. 1999; 84: 4079-4084Crossref PubMed Google Scholar, 11Yamada Y. Itano N. Hata K. Ueda M. Kimata K. J. Investig. Dermatol. 2004; 122: 631-639Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 12Recklies A.D. White C. Melching L. Roughley P.J. Biochem. J. 2001; 354: 17-24Crossref PubMed Scopus (113) Google Scholar, 13Itano N. Sawai T. Atsumi F. Miyaishi O. Kannagi R. Hamaguchi M. Kimata J. Biol. Chem. 2004; 279: 679-687Abstract Full Text Full Text PDF Scopus (125) Google Scholar). Recent studies show that many cell types synthesize significant amounts of HA from an apparently minimal HAS2 mRNA pool (≤50 copies) (4Rilla K. Lammi M.J. Sironen R. Torronen K. Luukkonen M. Hascall V.C. Midura R.J. Hyttinen M. Pelkonen J. Tammi M. Tammi R. J. Cell Sci. 2002; 115: 3633-3643Crossref PubMed Scopus (59) Google Scholar). Expression of HAS mRNAs is correlated with HA biosynthesis. In general, it can be stated that expression of HAS mRNAs correlates with HA biosynthesis; high levels of HAS mRNAs are mirrored by high levels of HA biosynthesis (14Jacobson A. Brinck J. Briskin M.J. Spicer A.P. Heldin P. Biochem. J. 2000; 348: 29-35Crossref PubMed Scopus (188) Google Scholar, 15Fulop A.S. Hascall V.C. Arch. Biochem. Biophys. 1997; 337: 261-266Crossref PubMed Scopus (136) Google Scholar). For instance, mouse cumulus cell oocyte complexes, isolated immediately after inducing an ovulatory cycle (at which time they do not synthesize HA), expressed no Has2 mRNA. When HA biosynthesis began ∼3–4 h later, however, Has2 mRNA was expressed at high levels (15Fulop A.S. Hascall V.C. Arch. Biochem. Biophys. 1997; 337: 261-266Crossref PubMed Scopus (136) Google Scholar). HAS2 expression can be stimulated by many growth factors and cytokines. Platelet-derived growth factor-BB is able to dramatically stimulate HA biosynthesis by normal human mesothelial cells (14Jacobson A. Brinck J. Briskin M.J. Spicer A.P. Heldin P. Biochem. J. 2000; 348: 29-35Crossref PubMed Scopus (188) Google Scholar). This stimulation of HA biosynthesis corresponded closely with a rapid increase in HAS2 mRNA levels. Overall, studies suggest that HAS gene transcription represents the primary control mechanism that acts to regulate HA biosynthesis on a cellular level. It is not surprising, therefore, that reduction of the HAS2 copy number affects HA biosynthesis and HA-related cell functions, such as cell migration and proliferation (4Rilla K. Lammi M.J. Sironen R. Torronen K. Luukkonen M. Hascall V.C. Midura R.J. Hyttinen M. Pelkonen J. Tammi M. Tammi R. J. Cell Sci. 2002; 115: 3633-3643Crossref PubMed Scopus (59) Google Scholar). These studies highlight the importance of HAS gene transcript levels to both HA biosynthesis and basic cellular functions. Despite recent progress in studies focused upon the differential expression of three mammalian HAS isoforms and identification of the respective promoter sequences, the molecular mechanisms that regulate HAS mRNA levels remain unclear. Gene structures and promoter sequences have now been identified for all three HAS genes (16Yamada Y. Itano N. Zako M. Yoshida M. Lenas P. Niim A. Ueda M. Kimata K. Biochem. J. 1998; 330: 1223-1227Crossref PubMed Scopus (17) Google Scholar, 17Zhang W. Watson C.E. Liu C. Williams K.J. Werth V.P. Biochem. J. 2000; 349: 91-97Crossref PubMed Scopus (65) Google Scholar, 18Monslow J. Williams J.D. Norton N. Guy C.A. Price I.K. Coleman S.L. Williams N.M. Buckland P.R. Spicer A.P. Topley N. Davies M. Bowen T. Intern. J. Biochem. & Cell Biol. 2003; 35: 1272-1283Crossref PubMed Scopus (33) Google Scholar). The HAS2 and HAS3 genes are organized in a similar fashion, with the entire 5′-untranslated region encoded within the first exon. This gene organization has been maintained over at least 500 million years of evolution. The first exon of the Amphioxus (Branchiostoma floridae) has genes is composed of the entire 5′-untranslated region, whereas the remainder of the coding sequence is contained within one large exon. 2A. Spicer and R. Taft, unpublished data. Glucocorticoids induce a rapid and sustained, near-total suppression of HAS2 mRNA levels in osteosarcoma cells and dermal fibroblasts, mediated through substantial decreases in both gene transcription and HAS2 mRNA stability (17Zhang W. Watson C.E. Liu C. Williams K.J. Werth V.P. Biochem. J. 2000; 349: 91-97Crossref PubMed Scopus (65) Google Scholar). Interleukin-1β and transforming growth factor-β inhibited the HAS2 mRNA level in osteosarcoma and chondrocytes (12Recklies A.D. White C. Melching L. Roughley P.J. Biochem. J. 2001; 354: 17-24Crossref PubMed Scopus (113) Google Scholar). Overall, several lines of evidence suggest that additional mechanisms may act in concert with changes in transcriptional activity to rapidly regulate HAS2 mRNA levels. Natural antisense RNAs are endogenous transcripts, which are complementary to mRNA sequences of known function, i.e. their sense sequences (19Vanhee-Brossollet C. Vaquero C. Gene. 1998; 211: 1-9Crossref PubMed Scopus (236) Google Scholar). Natural antisense RNAs are capable of regulating prokaryotic and eukaryotic gene expression (19Vanhee-Brossollet C. Vaquero C. Gene. 1998; 211: 1-9Crossref PubMed Scopus (236) Google Scholar, 20Knee R. Murphy P.R. Neurochem. Int. 1997; 31: 379-392Crossref PubMed Scopus (106) Google Scholar, 21Brantl S. Biochim. Biophys. Acta. 2002; 1575: 15-25Crossref PubMed Scopus (195) Google Scholar). Natural antisense RNAs exert their regulatory effects at multiple levels, including transcription, RNA editing, post-transcription, and translation (22Farrel C.M. Lukens L.N. J. Biol. Chem. 1995; 270: 3400-3408Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 23Tosic M. Roach A. de Rivaz J.C. Dolivo M. Matthieu J.M. EMBO J. 1990; 9: 401-406Crossref PubMed Scopus (45) Google Scholar, 24Wightman B. Ha I. Ruvkun G. Cell. 1993; 75: 855-862Abstract Full Text PDF PubMed Scopus (3166) Google Scholar, 25Dickson G. Hill V. Graham I.R. Neuromuscular Disorder. 2002; 12: 67-70Abstract Full Text Full Text PDF Scopus (25) Google Scholar). By altering the expression of a particular gene, natural antisense RNAs regulate biological functions, such as development, viral infection, or adaptive responses (26Good L. Cell. Mol. Life Sci. 2003; 60: 854-861Crossref PubMed Scopus (48) Google Scholar). Antisense transcription is predicted to be abundant in the human and mouse genomes (27Shendure J. Church G.M. Genome Biology. 2002; 3: 1-14Crossref Google Scholar). Through analyses of the mouse genome sequence, computer searches have predicted the expression of over 2000 putative sense-antisense RNA pairs (28The FANTOM Consortium the RIKEN Genome Exploration Research Group Phases I & II Team Nature. 2002; 420: 563-573Crossref PubMed Scopus (1407) Google Scholar). Many antisense RNAs are conserved among species, such as the c-myc antisense in human, bovine, and rodents (29Kindy M.S. McCormack J.E. Buckler A.J. Levine R.A. Sonensheim G.E. Mol. Cell. Biol. 1987; 7: 2857-2862Crossref PubMed Scopus (34) Google Scholar, 30Nepveu A. Marcus K.B. EMBO J. 1986; 5: 2859-2865Crossref PubMed Scopus (146) Google Scholar, 31Bentley D.L. Groudine M. Nature. 1986; 321: 702-706Crossref PubMed Scopus (486) Google Scholar). The wide distribution and conservation of endogenous antisense transcripts strongly suggest that antisense RNAs are not accidental and may play a general regulatory role in gene expression in many higher eukaryotes, including mammals. In our current investigation, we have discovered natural antisense mRNAs of human and mouse HAS2 that are transcribed from the opposite strand of the HAS2 gene locus. We have chosen to designate these natural HAS2 antisense genes as HASNT. We have demonstrated herein that HASNT mRNAs reduce HAS2 mRNA levels and HA biosynthesis in HASNT-transfected cells. Our data suggest that HASNT is a novel and important mechanism in the regulation of HAS2 mRNA levels, HAS2-associated HA biosynthesis and HA-related biological functions in vivo. Data Base Searches—Nucleotide-nucleotide BLAST searches were performed of the human and mouse expressed sequence tag (EST) data bases using the full-length human and mouse HAS2 cDNA sequences and partial genomic sequences. Candidate ESTs were used to screen the EST data base in an effort to extend sequences through creation of a contig of overlapping EST sequences. Putative polypeptide sequences were also searched against the protein data base using standard search parameters with suppression of the low complexity filter. Additional data bases that were used include the University of Santa Cruz Genome Site and the Ensembl site. Reagents—All reagents were purchased from Sigma unless stated otherwise. Real time PCR reagents were purchased from Applied Biosystems (Foster City, CA). Tetracycline-inducible pTRE2hyg plasmid vector, doxycycline, geneticin (G418), and hygromycin were purchased from BD Biociences. pCIneo plasmid vector was purchased from Promega Corporation (Los Altos, CA). [3H]acetic acid (4.7 Ci/mmol) was purchased from PerkinElmer Life Sciences. HASNT EST clones, Dulbecco's modified Eagle's medium, McCoy's 5A medium, fetal bovine serum, L-glutamax, and antibiotics were purchased from Invitrogen. All other molecular biology reagents were purchased from Invitrogen, BD Biosciences, or Ambion (Austin, TX). Cell Culture—SV40-transformed African green monkey kidney, COS-1, cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and supplemented with 5 mm L-glutamax and 1× penicillin-streptomycin. The U2-OS Tet-on osteosarcoma cell line was purchased from BD Biosciences. These cells were grown in McCoy's 5A medium with 10% fetal bovine serum supplemented with 100 μg/ml geneticin (G418) (active constituent). L, S-HASNT/pTRE2hyg, and pTRE2hyg vector plasmid-transfected cells were selected in McCoy's 5A medium containing 100 μg/ml geneticin (G418) and 250 μg/ml hygromycin. Stably transfected cells were maintained in McCoy's 5A medium with 100 μg/ml geneticin (G418) and 100 μg/ml hygromycin. All experiments using stably transfected U2-OS cells were performed in the absence of antibiotics, except 1.5 μg/ml doxycycline. Cultures were maintained at 37 °C in 5% CO2. Plasmid Construction—Exon-trapping vectors were prepared by forced blunt ligation of genomic restriction fragments of the mouse Has2 gene into the unique BbsI restriction endonuclease site that is located within the chimeric intron of the pCIneo expression vector (Promega Corporation). Insert orientation was determined through a combination of restriction mapping and automated DNA sequencing. Human HASNT cDNAs were amplified from EST-derived plasmid DNAs by PCR using oligonucleotides that incorporate flanking BamHI and NheI restriction sites. Resultant HASNT cDNAs were inserted into the pTRE2hyg vector via the BamHI/NheI restriction sites. Nucleotide sequences of HASNT EST cDNA clones and inserts of HASNT/pTRE2hyg plasmid constructs were verified by automated DNA sequencing. Exon Trapping in COS-1 Cells—Genomic restriction fragments derived from previously identified mouse Has2 genomic clones (7Spicer A.P. McDonald J.A. J. Biol. Chem. 1998; 273: 1923-1932Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar) were ligated into the BbsI site of the general purpose expression vector pCIneo. This site is located within the chimeric intron that is positioned between the transcription start site and the multiple cloning site of the plasmid. Resultant plasmid DNAs were transiently transfected into COS-1 cells growing in 10-cm cell culture dishes using Superfect transfection reagent (Qiagen) under conditions recommended by the manufacturer. Forty-eight hours after transfection, total RNAs were isolated from transfected cells using TRIzol reagent (Invitrogen) as recommended by the manufacturer. Reverse-transcription PCR was performed on 1 μg of total RNA from each sample, as described previously (32Spicer A.P. Seldin M.F. Gendler S.J. J. Immunol. 1995; 155: 3079-3091PubMed Google Scholar), using the following oligonucleotide primers made according to the sequence of the pCIneo vector: forward (PCR only), 5′-GGTAGCCTTGCAGAAGTTGGTCGT-3′; reverse (RT and PCR), 5′-CACTGCATTCTAGTTGTGGTTTGTC-3′. Prior to reverse transcription, reactions were treated with 10 units of DNase I for 15 min at 37 °C followed by 5 min at 95 °C to destroy plasmid DNAs that might have co-purified with the total RNAs. PCR reactions proceeded through 30 cycles at 94 °C for 10 s, 67 °C for 30 s, and 72 °C for 1 min and were completed with a final extension step of 72 °C for 5 min. Amplified DNA fragments were separated by electrophoresis through 2% agarose gels and visualized by ethidium bromide staining and UV illumination. Amplified fragments were gel-purified (Qiagen gel extraction kit) and directly cloned through TOPO cloning using conditions recommended by the manufacturer (Invitrogen). Resultant plasmid DNAs were sequenced using automated DNA sequencing, and the sequences of putative exons were determined. To map the position of putative exons relative to each other, DNA sequencing, restriction mapping, and PCR amplifications were performed utilizing cloned genomic DNA fragments as the templates. Northern Blot—A human multiple tissue Northern blot membrane was purchased from BD Biosciences. The probe for human HASNT was unique to HASNT and represented a portion of the first exon and all of the third HASNT exon shown in Fig. 2. Hybridization and washing conditions were as recommended by the manufacturer. The HASNT blot was exposed to film (Biomax MR) for 8 days at –80 °C with two intensifier screens. The blot was then stripped and rehybridized with a human HAS2 cDNA probe, representing the open reading frame (ORF) only. Reverse Transcription-PCR of Human HASNT—Total RNAs were isolated from individual clones using TRIzol reagent (Invitrogen) as recommended by the manufacturer. One microgram of total RNA was reverse-transcribed using human HASNT-specific reverse primer. This reverse primer would only anneal to HASNT mRNAs and would not reverse transcribe HAS2 cDNAs. The reverse transcription was performed using M-MuLV reverse transcriptase (Ambion, Austin, TX) at 42 °C for 1 h. Two-hundred nanograms of total RNA were used to amplify a partial human HASNT cDNA by PCR using human HASNT-specific forward and reverse primers. The human HASNT-specific primers were: forward, 5′-GGATCC-TGGCCCGATCTTTCTGC-3′; and reverse, 5′-GCTAGC-CTTAAGTTGGAGGAGGCAGAAG-3′. The primers possessed BamHI and NheI restriction endonuclease sites, respectively, at their 5′-ends to facilitate additional cloning experiments. These primers would only amplify a human HASNT cDNA corresponding to Long-HASNT (L-HASNT). Furthermore, these primers were designed such that they would not amplify sequences from total genomic DNA nor HAS2 cDNAs under the PCR conditions that were used. The PCR conditions were 95 °C for 5 min, followed by 35 cycles at 95 °C for 30 s, 62 °C for 30 s, 72 °C for 30 s, and 5 min at 72 °C. Preparation of Stable Transfectants Expressing Antisense RNA to HAS2—U2-OS cells were transfected with pTRE2hyg/L-HASNT, pTRE2hyg/S-HASNT and pTRE2hyg vector, respectively. Transfection was performed using Superfect (Qiagen) according to the manufacturer's recommendation. Transfected cells were subjected to limiting dilution and were plated in 96-well plates. All transfectants were selected through 4–6 weeks of antibiotic selection in 400 μg/ml geneticin and 300 μg/ml hygromycin until cell growth was stable. Stable transfectants were maintained in the parental medium supplemented with 100 μg/ml geneticin and 100 μg/ml hygromycin. Cell Proliferation—Cell proliferation assays were performed using the MTT cell proliferation kit (Roche Applied Science) (33Denizot F. Lang R. J. Immunol. Methods. 1986; 89: 271-277Crossref PubMed Scopus (4357) Google Scholar). Standard curves were generated for each cell clone. Cells were synchronized by culture in fetal bovine serum-free medium for 72 h. Cell numbers were determined using a hemocytometer. Two thousand cells in 100 μl of McCoy 5A medium containing 5% fetal bovine serum and doxycycline (2 μg/ml), of individual L-, S-HASNT, and Vec-only clones, were seeded into 96-well plates and cultured for 1–5 days at 37 °C, 5% CO2. Ten microliters of MTT reagent were added to the wells every 24 h during the experimental period and then incubated exactly for another 4 h before adding 100 μl of lysis buffer. After adding lysis buffer, the cells were incubated overnight at 37 °C, 5% CO2, the absorbances at A590 were measured in a multiwell spectrophotometer, and the cell numbers were calculated based on individual standard curves. Cell Adhesion Assay—Two-hundred thousand cells were seeded onto 10-cm cell culture plates. Cells were incubated for 30, 60, and 120 min at 37 °C, 5% CO2. At the end of incubation, non-adherent cells were removed by gently washing three times with 10 ml of phosphate-buffered saline. Adherent cells were trypsinized and counted using a hemocytometer. The experiments were repeated six times. Quantitative Analysis of HAS2 Expression—Total RNAs were isolated from individual clones using TRIzol reagent (Invitrogen) as recommended by the manufacturer. Relative expression levels of HAS2 were determined by quantitative real time PCR. Gene-specific primers and probes were designed using Primer Express software version 2.0 (Applied Biosystems) and were as follows: forward, 5′-TCATGCTTTTGACGCTGTATGTAG-3′; reverse, 5′-CAAGCACCATGTCATATTGTTGTC-3′ (IDT, Coralville, IA); and probe, 5′-FAM-(CCAATAGCATGCATAGAGCAACGTTCCA)-TAMRA-3′ (Biosearch Technologies, Inc. Novato, CA). One microgram of total RNA was reverse-transcribed to first strand cDNA by incubating with random hexamer and M-MuLV reverse transcriptase (Ambion, Austin, TX) at 45 °C for 1 h. Two-hundred nanograms of total RNA were used for real time PCR. The TaqMan® real time PCR reaction conditions were: 1 cycle at 50 °C for 10 min and 40 cycles at 95 °C for 10 min and at 60 °C for 10 min. The TaqMan® real time PCR was performed in an ABI Prism® 7700 sequence detection system (Applied Biosystems). Data were analyzed by SDS software version 1.7 (Applied Biosystems). Amplifications of β-actin, which was used as the internal control for normalization, were performed using the β-actin detection reagent (Applied Biosystems). Standard curves for HAS2 and β-actin were generated by serial dilution of U2-OS total RNA. Data were discarded if the amplification efficiency was below 80%. Metabolic HA Biosynthesis Assay—HA synthesis was detected by labeling HA with [3H]acetic acid (34Spicer A.P. Iozzo Renato V. Proteoglycan Protocols, Methods in Molecular Biology. 171. Humana Press, Totowa, New Jersey2001: 378-379Google Scholar). Briefly, cells were seeded in 10-cm plates at 25% confluence in medium containing 1.5 μg doxycycline/ml and 100 μCi [3H]acetic acid/ml and cultured for 48 h. Cell numbers were determined using a hemocytometer. HA in the culture medium, on the cell surface, and inside cells was pooled together. Three volumes of 1.3% potassium acetate/95% ethanol were added to each sample and incubated overnight at –20 °C to precipitate macromolecules. Precipitates were resuspended in 5 ml of 0.5% (w/v) protease XIV (Sigma) solution (100 mm Tris-HCl, pH 8.0) and incubated overnight at 37 °C on a rocking platform. Samples were precipitated again with 3 volumes of 1.3% potassium acetate/95% ethanol. Precipitates were resuspended in 1 ml of 20 mm sodium acetate, pH 5.0. One-half of each sample was digested with 20 turbidity reducing units of streptomyces hyaluronate lyase (Sigma) in 20 mm sodium acetate buffer, pH 5.0, at 60 °C overnight. HA was precipitated using 125 μl of 12% cetyl pyridinium chloride (CEPC) solution and washed in 500 μl of 0.05% CEPC/50 mm NaCl. Final pellets were resuspended in 200 μl of methanol and counted in the 2500TR liquid scintillation analyzer (Packard, Downers Grove, IL). HAS3 Adenovirus Infection—Cells were seeded at 20% confluence in 10-cm cell culture dishes in culture medium with 1.5 μg/ml doxycycline. When cells reached 40–45% confluence, the monolayers were washed twice with phosphate-buffered saline, and then mouse HAS3 adenovirus 3J. Y. Tien, W. Huang, and A. Spicer, manuscript in preparation. was added to each culture dish. The multiplicity of infection was between 500 and 1000 optical plaque units/cell. The monolayers were cultured in the presence of adenovirus at 37 °C, 5% CO2, for another 2 h, and then fresh culture medium was added to each culture dish. The cell cultures were incubated at 37 °C, 5% CO2, for another 72 h before being assayed. Cell Proliferation Rescue Assays—The cell proliferation assays for HA rescue were performed as mentioned above, except that the medium contained 100 μg/ml high molecular weight HA (Fisher). Cell proliferation assays for HAS3 rescue were performed using the HAS3 adenovirus-infected HASNT cells, prepared as mentioned above. Discovery of Natural Antisense mRNAs of HAS2 (HASNT)— Data base searches using the complete published cDNA sequence for human and mouse HAS2 identified several EST clones (Fig. 1A) that shared sequence identity with the 5′-untranslated region (5′-UTR) of human HAS2 (Fig. 1B). Many of these clones were oriented in a direction consistent with their transcription from the opposite strand of the HAS2 locus, representing putative cis-encoded natural antisense mRNAs of HAS2. Through additional data base searches, a total sequence of 1.6 kbp (Fig. 1B) was derived for the human transcript, which was split into 4 exons, all of which were flanked by a consensus splice acceptor and donor sequences (Figs. 1 and 2). The 1.6-kbp cDNA was initially assembled in silico from overlapping EST sequences and then confirmed as being part of a contiguous mRNA using RT-PCR (data not shown). A short ORF was predicted within the human sequence, although the functionality of this ORF remains unclear to date. The predicted polypeptide had no sequence identity to any other polypeptide sequence and was not conserved with any predicted polypeptide generated from the derived mouse sequence. Although we have been able to verify the 1.6-kbp cDNA sequence for human HASNT using RT-PCR, all efforts to determine the true transcription start site(s) of this transcript have failed to date. Based upon our RT-PCR, quantitative RT-PCR, and Northern analyses, HASNT represents an extremely rare transcript. We have screened two cDNA libraries without success and have made multiple attempts at 5′-RACE and primer extensions to determine the true transcription start site for HASNT. In the absence of complete sequence information and the confirmed presence or identity of a functional ORF, we have assigned this gene the name HASNT. Four exons were identified. The four HASNT exons were distributed as follows with respect to the previously described HAS2 gene structure. One HASNT exon was encoded by sequences located within intron 1 of HAS2, one exon was complementary to a portion of HAS2 exon 1, and two HASNT exons were encoded by sequences located within the proximal promoter region for HAS2 (Fig. 2). An alternate splice site was identified, which resulted in alternate mRNAs with long (L) and short (S) antisense regions. Long (L)-HASNT, represented by image clone 5171029 (GenBank™ accession number BI829151), has 257 nucleotides of perfect complementary sequence to a region starting ∼70 bp from the presumed transcription start site of human HAS2 (accession number AJ604570), whereas Short (S)-HASNT, represented by im" @default.
• W2000514089 created "2016-06-24" @default.
• W2000514089 creator A5033346109 @default.
• W2000514089 creator A5033489502 @default.
• W2000514089 date "2005-07-01" @default.
• W2000514089 modified "2023-10-18" @default.
• W2000514089 title "Natural Antisense mRNAs to Hyaluronan Synthase 2 Inhibit Hyaluronan Biosynthesis and Cell Proliferation" @default.
• W2000514089 cites W1502415301 @default.
• W2000514089 cites W1537414502 @default.
• W2000514089 cites W1544466168 @default.
• W2000514089 cites W1629179716 @default.
• W2000514089 cites W1857705665 @default.
• W2000514089 cites W1953380675 @default.
• W2000514089 cites W1964278976 @default.
• W2000514089 cites W1972225180 @default.
• W2000514089 cites W1986234964 @default.
• W2000514089 cites W1987893498 @default.
• W2000514089 cites W1991426319 @default.
• W2000514089 cites W1996164869 @default.
• W2000514089 cites W1996938657 @default.
• W2000514089 cites W1999600600 @default.
• W2000514089 cites W2002552794 @default.
• W2000514089 cites W2008678914 @default.
• W2000514089 cites W2028071636 @default.
• W2000514089 cites W2030013621 @default.
• W2000514089 cites W2034343563 @default.
• W2000514089 cites W2035536358 @default.
• W2000514089 cites W2069649792 @default.
• W2000514089 cites W2086045686 @default.
• W2000514089 cites W2087366555 @default.
• W2000514089 cites W2089764248 @default.
• W2000514089 cites W2095741501 @default.
• W2000514089 cites W2103961160 @default.
• W2000514089 cites W2111548417 @default.
• W2000514089 cites W2128466784 @default.
• W2000514089 cites W2131272801 @default.
• W2000514089 cites W2142445831 @default.
• W2000514089 cites W2146505397 @default.
• W2000514089 cites W2156149672 @default.
• W2000514089 cites W2160467221 @default.
• W2000514089 cites W2167704983 @default.
• W2000514089 cites W2172200283 @default.
• W2000514089 cites W2323623488 @default.
• W2000514089 cites W2394711375 @default.
• W2000514089 cites W4231361297 @default.
• W2000514089 cites W4249313446 @default.
• W2000514089 cites W55039410 @default.
• W2000514089 cites W69500600 @default.
• W2000514089 doi "https://doi.org/10.1074/jbc.m411544200" @default.
• W2000514089 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15843373" @default.
• W2000514089 hasPublicationYear "2005" @default.
• W2000514089 type Work @default.
• W2000514089 sameAs 2000514089 @default.
• W2000514089 citedByCount "72" @default.
• W2000514089 countsByYear W20005140892012 @default.
• W2000514089 countsByYear W20005140892013 @default.
• W2000514089 countsByYear W20005140892014 @default.
• W2000514089 countsByYear W20005140892015 @default.
• W2000514089 countsByYear W20005140892017 @default.
• W2000514089 countsByYear W20005140892018 @default.
• W2000514089 countsByYear W20005140892019 @default.
• W2000514089 countsByYear W20005140892020 @default.
• W2000514089 countsByYear W20005140892021 @default.
• W2000514089 countsByYear W20005140892022 @default.
• W2000514089 countsByYear W20005140892023 @default.
• W2000514089 crossrefType "journal-article" @default.
• W2000514089 hasAuthorship W2000514089A5033346109 @default.
• W2000514089 hasAuthorship W2000514089A5033489502 @default.
• W2000514089 hasBestOaLocation W20005140891 @default.
• W2000514089 hasConcept C104317684 @default.
• W2000514089 hasConcept C112243037 @default.
• W2000514089 hasConcept C1491633281 @default.
• W2000514089 hasConcept C153911025 @default.
• W2000514089 hasConcept C181199279 @default.
• W2000514089 hasConcept C185592680 @default.
• W2000514089 hasConcept C202416437 @default.
• W2000514089 hasConcept C2777529286 @default.
• W2000514089 hasConcept C2781236742 @default.
• W2000514089 hasConcept C54355233 @default.
• W2000514089 hasConcept C553450214 @default.
• W2000514089 hasConcept C55493867 @default.
• W2000514089 hasConcept C62112901 @default.
• W2000514089 hasConcept C67705224 @default.
• W2000514089 hasConcept C86803240 @default.
• W2000514089 hasConcept C95444343 @default.
• W2000514089 hasConceptScore W2000514089C104317684 @default.
• W2000514089 hasConceptScore W2000514089C112243037 @default.
• W2000514089 hasConceptScore W2000514089C1491633281 @default.
• W2000514089 hasConceptScore W2000514089C153911025 @default.
• W2000514089 hasConceptScore W2000514089C181199279 @default.
• W2000514089 hasConceptScore W2000514089C185592680 @default.
• W2000514089 hasConceptScore W2000514089C202416437 @default.
• W2000514089 hasConceptScore W2000514089C2777529286 @default.
• W2000514089 hasConceptScore W2000514089C2781236742 @default.
• W2000514089 hasConceptScore W2000514089C54355233 @default.
• W2000514089 hasConceptScore W2000514089C553450214 @default.
• W2000514089 hasConceptScore W2000514089C55493867 @default.
• W2000514089 hasConceptScore W2000514089C62112901 @default.

• next