FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000519199> ?p ?o ?g. }

• W2000519199 endingPage "3916" @default.
• W2000519199 startingPage "3907" @default.
• W2000519199 abstract "Phosphorylation of G-protein-linked receptors is thought to play a central role in receptor regulation and desensitization. Unlike the case of the extensively studied β-adrenergic receptor/adenylate cyclase pathway, in which receptor-specific phosphorylation is known to be mediated by β-adrenergic receptor kinase (β-ARK), the kinases responsible for phosphorylation of phospholipase C-linked receptors have yet to be identified, although a role for β-ARK has been implicated. This study describes the purification of a novel 40-kDa receptor kinase from porcine cerebellum that is able to phosphorylate the phospholipase C-linked m3-muscarinic receptor in an agonist-dependent manner. The assay for kinase activity was based on the ability of the kinase to phosphorylate a bacterial fusion protein, Ex-m3, containing amino acids Ser345-Leu463 of the third intracellular loop of the m3-muscarinic receptor. Purification of the muscarinic receptor kinase from a high speed supernatant fraction of porcine cerebellum was achieved using the following steps: (i) 30-60% ammonium sulfate cut and successive chromatography on (ii) butyl-Sepharose (iii) Resource Q, (iv) Resource S, and (v) heparin-Sepharose. The purified protein kinase represented an ∽18,600-fold purification and was a single polypeptide with a molecular weight of ∽40 kDa. Based on the chromatographic mobility, molecular weight, and kinase inhibitor studies, the kinase, designated MRK, was shown to be distinct from previously characterized second messenger regulated protein kinases, β-ARK, and other members of the G-protein-linked receptor kinase family. It therefore represents a new class of receptor kinase. Phosphorylation of G-protein-linked receptors is thought to play a central role in receptor regulation and desensitization. Unlike the case of the extensively studied β-adrenergic receptor/adenylate cyclase pathway, in which receptor-specific phosphorylation is known to be mediated by β-adrenergic receptor kinase (β-ARK), the kinases responsible for phosphorylation of phospholipase C-linked receptors have yet to be identified, although a role for β-ARK has been implicated. This study describes the purification of a novel 40-kDa receptor kinase from porcine cerebellum that is able to phosphorylate the phospholipase C-linked m3-muscarinic receptor in an agonist-dependent manner. The assay for kinase activity was based on the ability of the kinase to phosphorylate a bacterial fusion protein, Ex-m3, containing amino acids Ser345-Leu463 of the third intracellular loop of the m3-muscarinic receptor. Purification of the muscarinic receptor kinase from a high speed supernatant fraction of porcine cerebellum was achieved using the following steps: (i) 30-60% ammonium sulfate cut and successive chromatography on (ii) butyl-Sepharose (iii) Resource Q, (iv) Resource S, and (v) heparin-Sepharose. The purified protein kinase represented an ∽18,600-fold purification and was a single polypeptide with a molecular weight of ∽40 kDa. Based on the chromatographic mobility, molecular weight, and kinase inhibitor studies, the kinase, designated MRK, was shown to be distinct from previously characterized second messenger regulated protein kinases, β-ARK, and other members of the G-protein-linked receptor kinase family. It therefore represents a new class of receptor kinase. INTRODUCTIONMany cell surface neurotransmitter and hormone receptors respond to agonist occupation by activation of phospholipase C. The subsequent hydrolysis of the lipid substrate phosphatidylinositol 4,5-bisphosphate releases the second messengers inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) ( 1The abbreviations used are: Ins(1,4,5)P3 inositol 1,4,5-trisphosphate β-ARK β-adrenergic receptor kinase CHO Chinese hamster ovary MRK muscarinic receptor kinase GRK G-protein linked receptor kinase H-89 (N-[2-((3-(4-bromophenyl)-2-propenyl)-amino)-ethyl]-5-isoquinoline PCR polymerase chain reaction PAGE polyacrylamide gel electrophoresis.) and diacylglycerol (reviewed in (1.Berridge M.J. Nature. 1993; 361: 315-325Crossref PubMed Scopus (6147) Google Scholar)). The second messenger response to a number of phospholipase C-linked receptors, including the m3-muscarinic receptor, is often complex, consisting of a burst of Ins(1,4,5)P3 production reaching a peak within the first few seconds of receptor stimulation followed by a lower sustained phase of Ins(1,4,5)P3 generation that is maintained for tens of minutes to hours(2.Lambert D.G. Nahorski S.R. Biochem. J. 1990; 265: 555-562Crossref PubMed Scopus (132) Google Scholar, 3.Tobin A.B. Lambert D.G. Nahorski S.R. Mol. Pharmacol. 1992; 42: 1042-1048PubMed Google Scholar, 4.Fisher S.K. Slowiejko D.M. McEwen E.L. Neurochem. Res. 1994; 19: 549-554Crossref PubMed Scopus (20) Google Scholar). Similar patterns of Ins(1,4,5)P3 generation are seen in response to agonist occupation of receptors for GRH(5.Morgan R.O. Chang J.P. Catt K.J. J. Biol. Chem. 1987; 262: 1166-1171Abstract Full Text PDF PubMed Google Scholar), angiotensin(6.Balla T. Baukal A.J. Guillemette G. Catt K.J. J. Biol. Chem. 1988; 263: 4083-4091Abstract Full Text PDF PubMed Google Scholar), bombesin, and CCK(7.Menniti F.S. Takemura H. Oliver K.G. Putney J.W. Mol. Pharmacol. 1991; 40: 727-733PubMed Google Scholar).Little is known of the molecular mechanisms underlying these complex second messenger responses, although recent evidence suggests that some phospholipase C-linked receptors undergo a rapid partial desensitization that results in decreased phospholipase C activity within seconds of agonist occupation(3.Tobin A.B. Lambert D.G. Nahorski S.R. Mol. Pharmacol. 1992; 42: 1042-1048PubMed Google Scholar, 4.Fisher S.K. Slowiejko D.M. McEwen E.L. Neurochem. Res. 1994; 19: 549-554Crossref PubMed Scopus (20) Google Scholar, 7.Menniti F.S. Takemura H. Oliver K.G. Putney J.W. Mol. Pharmacol. 1991; 40: 727-733PubMed Google Scholar, 8.Wojcikiewicz R.J.H. Tobin A.B. Nahorski S.R. Trends Pharmacol. Sci. 1993; 14: 279-285Abstract Full Text PDF PubMed Scopus (108) Google Scholar). Consistent with this notion are studies from our laboratory demonstrating that the early peak phase of Ins(1,4,5)P3 production in response to m3-muscarinic receptor stimulation can be desensitized by a short pre-exposure to agonist, whereas the sustained phase of Ins(1,4,5)P3 production is resistant to desensitization (3.Tobin A.B. Lambert D.G. Nahorski S.R. Mol. Pharmacol. 1992; 42: 1042-1048PubMed Google Scholar).One possible mechanism regulating the receptor/phospholipase C pathway is receptor phosphorylation. The involvement of β-adrenergic receptor phosphorylation in the desensitization of the β-adrenergic/adenylate cyclase system has been well documented (reviewed in (10.Lohse M.J. Biochim. Biophys. Acta. 1993; 1179: 171-188Crossref PubMed Scopus (400) Google Scholar)). In this case the agonist-occupied form of the β-adrenergic receptor is phosphorylated by two kinases, protein kinase A and a receptor-specific kinase termed β-adrenergic receptor kinase (β-ARK). The process of receptor phosphorylation results in uncoupling of the β-adrenergic receptor from the Gs-protein(10.Lohse M.J. Biochim. Biophys. Acta. 1993; 1179: 171-188Crossref PubMed Scopus (400) Google Scholar). It is now clear that in addition to β-adrenergic receptors other G-protein linked receptors also exist as phosphoproteins. In particular, phospholipase C/Gq/11-coupled CCK(11.Klueppelberg U.G. Gates L.K. Gorelick F.S. Miller L.J. J. Biol. Chem. 1991; 266: 2403-2408Abstract Full Text PDF PubMed Google Scholar), m3-muscarinic(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar), α1B-adrenergic(13.Lattion A-L. Diviani D. Cotecchia S. J. Biol. Chem. 1994; 269: 22887-22893Abstract Full Text PDF PubMed Google Scholar), platelet-activating factor(14.Ali H. Richardson R.M. Tomhave E.D. DuBose R.A. Haribabau B. Synderman R. J. Biol. Chem. 1994; 269: 24557-24563Abstract Full Text PDF PubMed Google Scholar), thrombin(15.Ishii K. Chen J. Ishii M. Koch W.J. Freedman N.J. Lefkowitz R.J. Coughlin S.R. J. Biol. Chem. 1994; 269: 1125-1130Abstract Full Text PDF PubMed Google Scholar, 16.Vouret-Craviari V. Grall D. Chambard J-C. Rasmussen U.B. Pouyssegur J. van Obberghen-Schilling E. J. Biol. Chem. 1995; 270: 8367-8372Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), and neurokinin-2 receptors (17.Alblas J. van Etten I. Khanum A. Moolenaar W.H. J. Biol. Chem. 1995; 270: 8944-8951Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) have all been shown to exist as phosphoproteins in intact cells, and the level of phosphorylation is enhanced following agonist stimulation. The receptor-specific kinase(s) responsible for these phosphorylation events have yet to be fully characterized, although some authors have suggested that β-ARK may act as a general G-protein-linked receptor kinase with a broad substrate specificity(18.Kwatra M.M. Schwinn D.A. Schreurs J. Blank J.L. Kim C.M. Benovic J.L. Krausse J.E. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1993; 268: 91961-99164Abstract Full Text PDF Google Scholar). Certainly, β-ARK has been implicated in the phosphorylation of CCK receptors in pancreatic acinar cells (19.Gates L.K. Ulrich C.D. Miller L. Am. J. Physiol. 1993; 264: G840-G847PubMed Google Scholar) and recombinant thrombin receptors expressed in Xenopus oocytes and fibroblasts(15.Ishii K. Chen J. Ishii M. Koch W.J. Freedman N.J. Lefkowitz R.J. Coughlin S.R. J. Biol. Chem. 1994; 269: 1125-1130Abstract Full Text PDF PubMed Google Scholar). Furthermore, substance P and m3-muscarinic receptors have been shown to act as in vitro substrates for β-ARK(18.Kwatra M.M. Schwinn D.A. Schreurs J. Blank J.L. Kim C.M. Benovic J.L. Krausse J.E. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1993; 268: 91961-99164Abstract Full Text PDF Google Scholar, 20.Debburman S.K. Kunapuli P. Benovic J.L. Hosey M. Mol. Pharmacol. 1995; 47: 224-233PubMed Google Scholar).The two isotypes of β-ARK (β-ARK-1 and −2) are members of a family of protein kinases that includes rhodopsin kinase, IT-11, GRK-5, and GRK-6, which are related on the basis of primary amino acid sequence homology and are collectively termed the G-protein-linked receptor kinase family (GRK) (reviewed in (21.Lefkowitz R.J. Cell. 1993; 74: 409-412Abstract Full Text PDF PubMed Scopus (398) Google Scholar)). The existence of the GRK family suggests that G-protein-linked receptor phosphorylation may be mediated by more than one receptor-specific kinase. However, the cellular substrates for IT-11, GRK-5, and GRK-6 are unknown despite in vitro evidence that these kinases are able to phosphorylate a number of G-protein-linked receptors(22.Kunapuli P. Benovic J.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5588-5592Crossref PubMed Scopus (117) Google Scholar, 23.Loudon R.P. Benovic J.L. J. Biol. Chem. 1994; 269: 22691-22697Abstract Full Text PDF PubMed Google Scholar).The possibility that a receptor kinase(s) other than β-ARK may be involved in the phosphorylation of G-protein-linked receptors has been suggested by recent studies from our laboratory on the phospholipase C-linked m3-muscarinic receptor(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). These studies have demonstrated that recombinant human m3-muscarinic receptors expressed in CHO cells (CHO-m3 cells) undergo agonist-mediated phosphorylation on serine. The time course for receptor phosphorylation is very rapid, occurring within seconds of agonist addition, and correlates with the rapid but partial desensitization of the phosphoinositide response seen within the first 20 s of receptor stimulation(8.Wojcikiewicz R.J.H. Tobin A.B. Nahorski S.R. Trends Pharmacol. Sci. 1993; 14: 279-285Abstract Full Text PDF PubMed Scopus (108) Google Scholar, 9.Wojcikiewicz R.J.H. Tobin A.B. Nahorski S.R. J. Neurochem. 1994; 63: 177-185Crossref PubMed Scopus (80) Google Scholar, 12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). Initial characterization demonstrated the kinase to be distinct from the known second messenger-regulated protein kinases, cAMP-dependent protein kinase, cGMP-dependent protein kinase, calcium/calmodulin-dependent protein kinase, and protein kinase C(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). Further characterization in a broken cell preparation revealed that a membrane-associated kinase was able to phosphorylate the m3-muscarinic receptor and that this kinase was not affected by heparin or zinc at concentrations that inhibit β-ARK(24.Tobin A.B. Keys B. Nahorski S.R. FEBS Letts. 1993; 335: 353-357Crossref PubMed Scopus (22) Google Scholar). These findings indicated that m3-muscarinic receptor phosphorylation was mediated by a novel receptor kinase.Described here is the purification from porcine cerebellum of a novel 40-kDa protein kinase that is able to phosphorylate the m3-muscarinic receptor in an agonist-dependent manner. The purification was based on the ability of the muscarinic receptor kinase to phosphorylate a bacterial fusion protein encoding a region of the third intracellular loop of the m3-muscarinic receptor (Ex-m3).EXPERIMENTAL PROCEDURESPreparation of the Bacterial Fusion Protein Ex-m3Preparation of the bacterial expression vector pEx-m3 has previously been described(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). Briefly, a region of the human m3-muscarinic receptor cDNA encoding the third intracellular loop between Ser345 and Leu463, inclusive, was subcloned into the bacterial expression plasmid pGEX-2T (Pharmacia Biotech Inc.). This produced the plasmid pEx-m3 where the region encoding amino acids Ser345-Leu463 of the m3-muscarinic receptor was downstream of, and in frame with, the coding sequence for glutathione S-transferase contained in pGEX-2T. Induction of pEx-m3-transformed Escherichia coli (DH5α) with isopropyl-1-thio-β-D-galactopyranoside (IPTG, 1 mM) resulted in the production of a fusion protein of ∽43.5 kDa (glutathione S-transferase = 27.5 kDa, Ser345-Leu463 16 kDa). The fusion protein was purified over a glutathione-Sepharose affinity matrix (Pharmacia) before being used in the assay described below.Construction of Truncated Bacterial Fusion ProteinsIn order to characterize the substrate specificity of muscarinic receptor kinase preparations a series of truncated forms of Ex-m3 were synthesized. For a summary of the fusion proteins see Fig. 8A.pEx345-427 was constructed using the following PCR primers: 5′ primer, CCCGGATCCCTGGAGAACTCCGCC; 3′ primer, CCGGAATTCAAGCTTGGAGAAGCTTTT. These primers were used to amplify a region of the human m3-muscarinic receptor cDNA that encodes amino acids Ser345-Leu427. The primers were designed to allow in-frame cloning into pGEX-2T via a BamHI site at the 5′ end and an EcoRI site at the 3′ end.pEx376-463 was synthesized using the same strategy, but in this case the 5′ PCR primer was CCCGGATCCACCATCCTCAACTCCACC, and the 3′ primer was CCCGAATTCCAGAGTGGCTTCCTTGAAG. This amplified a region of human m3-muscarinic cDNA that encoded amino acids Thr376-Leu463, which was then cloned into pGEX-2T.pΔHind was constructed by digestion of pEx-m3 with the restriction enzyme HindIII. This removed a section of cDNA from the muscarinic region of pEx-m3 that encoded for amino acids Leu371-Lys426, inclusive.pΔH-V was constructed by ligating two PCR reaction products into pGEX-2T in a three-way ligation where pGEX-2T was digested with BamHI (5′) and EcoRI (3′), PCR reaction product 1 was digested with BamHI (5′) and ApaI (3′), and PCR reaction product 2 was digested with ApaI (5′) and EcoRI (3′). PCR primers used were (for product 1) 5′ primer CCCGGATCCCTGGAGAACTCCGCC and 3′ primer GCTGGGCCCCGGAAGCTTGAGCAC and (for product 2) 5′ primer CAGGGGCCCGAGGAGGAGCTGGGG and 3′ primer CCCGAATTCCAGAGTGGCTTCCTTGAAG. The resulting construct encoded a truncated form of Ex-m3 where amino acids His374-Val391, inclusive, were deleted.The above constructs were used to transform E. coli (DH5α). Induction and purification of fusion proteins was the same as that described for Ex-m3.Assay for Muscarinic Receptor Kinase ActivitySamples from chromatography fractions (10 μl) or from cell or tissue preparations were incubated with purified Ex-m3 (3.5 μg) in kinase buffer (20 mM Tris-HCl, 10 mM MgCl2, 1 mM EGTA, 2 mM dithiothreitol, pH 7.4) containing 50 μM [γ-32P]ATP (0.4-1.0 cpm/fmol) for 10 min at 37°C (final volume, 110 μl). The reaction was terminated by the addition of 1 ml of ice-cold TE buffer (10 mM Tris-HCl, 10 mM EDTA, pH 7.4). Glutathione-Sepharose (20 μl, Pharmacia) was added and collected by centrifugation (13,000 × g for 10 s), washed twice with 1 ml of TE buffer. Bound fusion protein was dissociated by boiling in 2 × SDS-PAGE sample buffer (20 μl). Proteins were resolved by 12% SDS-PAGE. In order to ensure the equal recovery of fusion proteins and to confirm the relative positions of fusion proteins, gels were stained with Coomassie Blue. This was particularly important in experiments using truncated fusion proteins, where the extent of phosphorylation was compared as a method of determining substrate specificity of the kinase preparations. Gels were then dried and autoradiographs obtained, and/or bands corresponding to the fusion protein were excised and counted.Cell CultureCHO cell cultures stably transfected with human m3-muscarinic receptor cDNA (CHO-m3 cells, a kind gift from Dr. N. J. Buckley, Department of Pharmacology, University College, London) contained ∽2100 fmol of receptor/mg of protein. These cells were routinely maintained in α-minimal essential medium supplemented with penicillin (100 IU/ml), streptomycin (100 μg/ml), fungizone (2.5 μg/ml), and fetal calf serum (10% v/v).Preparation of Crude Cytosolic or Membrane Fractions from CHO-m3 CellsInitial muscarinic receptor kinase preparations were obtained from cytosolic and membrane fractions of CHO-m3 cells. The cytosolic preparation was obtained by harvesting 10 (175-cm2) flasks of CHO-m3 cells, which were resuspended in 2 ml of kinase buffer plus protease inhibitors (1 mM PMSF, 10 μg/ml soybean trypsin inhibitor, 1 μg/ml leupeptin, 1 μg/ml pepstatin A, 100 μg/ml benzamine, 100 μg/ml iodoacetamide). The cells were allowed to swell for 10-15 min and were then homogenized by a 10-s pulse in a tissue homogenizer (Polytron). A high speed supernatant fraction was then obtained by centrifugation for 30 min at 300,000 × g, and proteins were adjusted to 1-5 mg/ml.Membranes were prepared from CHO-m3 cells by homogenization of the cells as above but this time in 15 ml of TE buffer plus protease inhibitors. Membranes were collected by centrifugation at 15,000 × g for 10 min and resuspended in kinase buffer at 1 mg protein/ml.10 μl of either the membrane or cytosolic preparations were used in the assay for kinase activity.Purification of Muscarinic Receptor Kinase from Porcine CerebellumCerebella from 15 young pigs (∽180 g of tissue) were homogenized in 1 liter of TE buffer containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 μg/ml soybean trypsin inhibitor, 1 μg/ml leupeptin, 1 μg/ml pepstatin A, 100 μg/ml benzamine, 100 μg/ml iodoacetamide). All subsequent buffers contained this complement of protease inhibitors, and the preparation was carried out at 4°C. The homogenate was centrifuged at 12,000 × g for 45 min, and a high speed supernatant fraction (S200 fraction) was obtained by further centrifugation at 200,000 × g for 60 min. The protein pellet from a 30-60% ammonium sulfate cut of the S200 fraction was resuspended in TE buffer (120 ml) and dialyzed against TE buffer containing 1 M (NH4)2SO4. This preparation was loaded onto a 70-ml butyl-Sepharose fast flow column (16 × 320 mm) equilibrated with TE buffer containing 1 M (NH4)2SO4. Proteins were eluted with a linear gradient of 1-0 M (NH4)2SO4 over 10 bed volumes (flow rate = 1 ml/min). Fractions (12 ml) were collected, and the peak activity, which eluted at ∽0.54 M (NH4)2SO4, was pooled and dialyzed against TE buffer.The sample was then passed through a 6-ml Resource Q (Pharmacia) column. This resolved muscarinic receptor kinase activity from casein kinase II that during the course of this study was found to also phosphorylate the Ex-m3 fusion protein (see “Results” and “Discussion”). The flow-through from the Resource Q column was applied to a 1-ml Resource S (Pharmacia) column. The Resource S column was then eluted using a linear gradient of 0-0.5 M NaCl over 20 bed volumes (flow rate = 1 ml/min). 1-ml fractions were collected. The kinase activity eluted as a single peak at ∽0.32 M NaCl. These fractions were combined and passed through a 1-ml heparin-Sepharose column equilibrated with 0.32 M NaCl. The column was eluted using a linear gradient of 0.32-2.0 M NaCl. The kinase activity eluted as a single peak at ∽0.87 M NaCl.Partial Purification of Muscarinic Receptor Kinase Activity from Particulate and Soluble Fractions of CHO-m3 CellsTen confluent (175-cm2) flasks of CHO-m3 cells were harvested and resuspended in 10 ml of TE buffer containing protease inhibitors (as above). Cells were allowed to swell for 10-15 min and then were homogenized using a 10-s pulse in a Polytron. Cell debris was removed by centrifugation (3 min at 500 × g). Membrane and cytosolic fractions were then prepared by centrifugation at 15,000 × g for 10 min. The supernatant was passed through a 1-ml Resource S column equilibrated with TE buffer, and the column was eluted using a linear gradient from 0 to 0.5 M NaCl. 1-ml fractions were collected. Kinase activity eluted from the Resource S column at the same position as that observed in the brain preparation, i.e. ∽0.32 M NaCl.Membranes from the above preparation were either used directly to test for muscarinic receptor kinase activity or extracted with 15 ml of 1.5 M KCl/TE buffer for 3 h at 4°C. The extract was dialyzed against TE buffer and run through a 1-ml Resource S column. The column was eluted as described above. The peak kinase activity eluted at ∽0.32 M NaCl.Phosphorylation of m3-Muscarinic Receptors in Membrane Preparations from CHO-m3 CellsCrude CHO-m3 cell membranes were prepared as described above and resuspended in kinase buffer at 1 mg of protein/ml. 50 μl of membranes (∽0.1 pmol of receptor) were used in a phosphorylation reaction mixture that contained final concentrations of 20 mM Tris-HCl, pH 7.4, 10 mM MgCl2,1 mM EGTA, 2 mM dithiothreitol, 100 μM [γ-32P] ATP (1-4 cpm/fmol of ATP) ± 1 mM carbachol and ± 10 μM atropine. Total volume was 100 μl. Reactions were started by the addition of ATP and continued at 32°C for 10 min. Reactions were stopped by centrifugation at 13,000 × g for 30 s. The supernatant was removed by aspiration, and membranes were solubilized with 1 ml of solubilization buffer (10 mM Tris-HCl, pH 7.4, 10 mM EDTA, 500 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxycholate) for 30 min on ice. m3-Muscarinic receptors were then immunoprecipitated with a specific antiserum (number 332) as described previously(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar).In experiments to test the ability of the fusion protein Ex-m3 to inhibit the m3-muscarinic receptor phosphorylation, Ex-m3 (3.5 μg) or a molar equivalent of glutathione S-transferase was added to the reaction mixture. At the end of the reaction Ex-m3 (3.5 μg) was added to control tubes, thereby ensuring that all tubes contained equal amounts of Ex-m3, since the fusion protein will compete with the receptor for the antibody in the immunoprecipitation. The reaction was then stopped in the way described above, and m3-muscarinic receptors were then solubilized and immunoprecipitated.In experiments where purified muscarinic receptor kinase was tested for its ability to phosphorylate the intact m3-muscarinic receptor, an aliquot of the kinase preparation (10 μl, ∽2.5 pmol) was added to the reaction mixture. To control tubes a buffer blank was added (this gave a final NaCl concentration of 87 mM). The reaction was then started and terminated as described above.Muscarinic Receptor Kinase AutophosphorylationAn aliquot of purified muscarinic receptor kinase (20 μl) was added to a reaction mix containing 20 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 1 mM EGTA, 2 mM dithiothreitol, 130 mM NaCl, 100 μM [γ-32P] ATP (1-4 cpm/fmol of ATP) (total volume, 135 μl). After 30 min at 37°C the reaction was terminated by the addition of 15 μl of ice-cold 100% trichloroacetic acid. The precipitated protein pellet was resuspended in 20 μl of 2 × SDS-PAGE loading buffer and resolved on a 12% SDS-PAGE gel.Miscellaneous ProceduresSilver stain was performed using a Bio-Rad silver stain kit. Determination of the relative intensities of phosphorylated bands was carried out using a Bio-Rad model GS 670 densitometer.RESULTSAssay for Muscarinic Receptor Kinase ActivityPrevious studies from our laboratory have demonstrated that the m3-muscarinic receptor expressed in CHO cells (CHO-m3 cells) was phosphorylated in an agonist-dependent manner by a kinase distinct from the G-protein-linked receptor kinases characterized to date(12.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar, 24.Tobin A.B. Keys B. Nahorski S.R. FEBS Letts. 1993; 335: 353-357Crossref PubMed Scopus (22) Google Scholar). Hence, in order to isolate the novel m3-muscarinic receptor kinase an assay for kinase activity was developed.The bacterial fusion protein Ex-m3, containing a region of the third intracellular loop of the human m3-muscarinic receptor (Ser345-Leu463) acted as a substrate for a kinase in cytosolic extracts from CHO-m3 cells (Fig. 1). There was no phosphorylation of the bacterially expressed glutathione S-transferase (Fig. 1). Furthermore, following digestion of phosphorylated Ex-m3 fusion protein with thrombin, a process that releases the m3-muscarinic receptor region, the 32P label was associated only with the m3-muscarinic region and not the glutathione S-transferase portion of the fusion protein (data not shown). A similar kinase activity was also identified in membrane preparations from CHO-m3 cells, but the kinase activity was ∽30-fold lower than that observed in cytosolic extracts. Studies described below indicate that the kinase associated with the membrane fraction is likely to be the same as the cytosolic kinase.Figure 1:Phosphorylation of Ex-m3 by a cytosolic extract from CHO-m3 cells. A high speed supernatant extract from CHO-m3 cells (10-50 μg of protein) was tested for kinase activity capable of phosphorylating the recombinant bacterial proteins, Ex-m3 (3.5 μg) and glutathione S-transferase (2.0 μg, GST). Shown is a Coomassie Blue stain of the purified bacterial proteins indicating their relative positions on a 12% SDS-PAGE gel and an autoradiograph showing the phosphorylated products. Indicated are the positions of prestained molecular weight standards. The results are representative of at least five experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We have previously demonstrated agonist-driven m3-muscarinic receptor phosphorylation in membranes from CHO-m3 cells, suggesting that the muscarinic receptor kinase is, at least in part, associated with the plasma membrane(24.Tobin A.B. Keys B. Nahorski S.R. FEBS Letts. 1993; 335: 353-357Crossref PubMed Scopus (22) Google Scholar). In order to confirm that the Ex-m3 fusion protein was acting as a pseudosubstrate for the m3-muscarinic receptor kinase, experiments were conducted to investigate the ability of Ex-m3 to block agonist sensitive muscarinic receptor phosphorylation in membranes from CHO-m3 cells. Fig. 2 shows that Ex-m3 was able to inhibit agonist-induced m3-muscarinic receptor phosphorylation in CHO-m3 membranes, whereas glutathione S-transferase had no effect. Note also, that in addition to blocking m3-muscarinic receptor phosphorylation, the Ex-m3 fusion protein was itself phosphorylated (Fig. 2).Figure 2:Inhibition of agonist-driven phosphorylation of m3-muscarinic receptors in membranes from CHO-m3 cells. Membranes from CHO-m3 cells (50 μg of protein, ∽0.1 pmol of m3-receptor) were challenged with or without 1 mM carbachol in the presence of 100 μM [γ-32P]ATP (1-4 cpm/fmol of ATP) for 10 min at 32°C. The receptors were then solubilized, immunoprecipitated, and resolved by 8% SDS-PAGE. The effect of Ex-m3 (3.5 μg) or a molar equivalent of glutathione S-transferase (2.0 μg, GST) on agonist-driven m3-muscarinic receptor phosphorylation was determined. Note: in the lane where Ex-m3 was added, the fusion protein as well as the receptor was immunoprecipitated. Indicated are the positions of prestained molecular weight standards. The results are representative of two experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Purification of the Muscarinic Receptor Kinase (MRK) from Porcine CerebellumDuring the course of developing the purification strategy it was found that casein kinase II, which has a ubiquitous distribution, was able to phosphorylate the Ex-m3 fusion protein (see “Discussion”). This complicated initial tissue distribution studies that showed very little Ex-m3 fusion protein phosphorylation by kinases in cytosolic extracts from peripheral tissues (liver, lung, kidney, and heart) but a robust phosphorylation of the Ex-m3" @default.
• W2000519199 created "2016-06-24" @default.
• W2000519199 creator A5002195913 @default.
• W2000519199 creator A5019996915 @default.
• W2000519199 creator A5035925879 @default.
• W2000519199 date "1996-02-01" @default.
• W2000519199 modified "2023-09-29" @default.
• W2000519199 title "Identification of a Novel Receptor Kinase That Phosphorylates a Phospholipase C-linked Muscarinic Receptor" @default.
• W2000519199 cites W1245933497 @default.
• W2000519199 cites W1481438484 @default.
• W2000519199 cites W1494647602 @default.
• W2000519199 cites W1496517521 @default.
• W2000519199 cites W1511477623 @default.
• W2000519199 cites W1529589512 @default.
• W2000519199 cites W1532377506 @default.
• W2000519199 cites W1538620682 @default.
• W2000519199 cites W1556616823 @default.
• W2000519199 cites W1570573502 @default.
• W2000519199 cites W1575215033 @default.
• W2000519199 cites W1583846229 @default.
• W2000519199 cites W1594024004 @default.
• W2000519199 cites W1596104133 @default.
• W2000519199 cites W1681220287 @default.
• W2000519199 cites W1770711785 @default.
• W2000519199 cites W182149432 @default.
• W2000519199 cites W1904128007 @default.
• W2000519199 cites W1969728996 @default.
• W2000519199 cites W1970057376 @default.
• W2000519199 cites W1974018894 @default.
• W2000519199 cites W1979306125 @default.
• W2000519199 cites W1980166477 @default.
• W2000519199 cites W1981115167 @default.
• W2000519199 cites W1997049897 @default.
• W2000519199 cites W2015648136 @default.
• W2000519199 cites W2022281449 @default.
• W2000519199 cites W2032580095 @default.
• W2000519199 cites W2037212988 @default.
• W2000519199 cites W2044397943 @default.
• W2000519199 cites W2057923873 @default.
• W2000519199 cites W2072842460 @default.
• W2000519199 cites W2086617442 @default.
• W2000519199 cites W2114164301 @default.
• W2000519199 cites W2154373957 @default.
• W2000519199 doi "https://doi.org/10.1074/jbc.271.7.3907" @default.
• W2000519199 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8632012" @default.
• W2000519199 hasPublicationYear "1996" @default.
• W2000519199 type Work @default.
• W2000519199 sameAs 2000519199 @default.
• W2000519199 citedByCount "35" @default.
• W2000519199 countsByYear W20005191992012 @default.
• W2000519199 countsByYear W20005191992018 @default.
• W2000519199 crossrefType "journal-article" @default.
• W2000519199 hasAuthorship W2000519199A5002195913 @default.
• W2000519199 hasAuthorship W2000519199A5019996915 @default.
• W2000519199 hasAuthorship W2000519199A5035925879 @default.
• W2000519199 hasBestOaLocation W20005191991 @default.
• W2000519199 hasConcept C170493617 @default.
• W2000519199 hasConcept C180361614 @default.
• W2000519199 hasConcept C185592680 @default.
• W2000519199 hasConcept C2775960820 @default.
• W2000519199 hasConcept C55493867 @default.
• W2000519199 hasConcept C75184817 @default.
• W2000519199 hasConcept C79186569 @default.
• W2000519199 hasConcept C86803240 @default.
• W2000519199 hasConcept C95444343 @default.
• W2000519199 hasConceptScore W2000519199C170493617 @default.
• W2000519199 hasConceptScore W2000519199C180361614 @default.
• W2000519199 hasConceptScore W2000519199C185592680 @default.
• W2000519199 hasConceptScore W2000519199C2775960820 @default.
• W2000519199 hasConceptScore W2000519199C55493867 @default.
• W2000519199 hasConceptScore W2000519199C75184817 @default.
• W2000519199 hasConceptScore W2000519199C79186569 @default.
• W2000519199 hasConceptScore W2000519199C86803240 @default.
• W2000519199 hasConceptScore W2000519199C95444343 @default.
• W2000519199 hasIssue "7" @default.
• W2000519199 hasLocation W20005191991 @default.
• W2000519199 hasOpenAccess W2000519199 @default.
• W2000519199 hasPrimaryLocation W20005191991 @default.
• W2000519199 hasRelatedWork W1972865543 @default.
• W2000519199 hasRelatedWork W2050316456 @default.
• W2000519199 hasRelatedWork W2069251863 @default.
• W2000519199 hasRelatedWork W2076970302 @default.
• W2000519199 hasRelatedWork W2078422320 @default.
• W2000519199 hasRelatedWork W2097097666 @default.
• W2000519199 hasRelatedWork W2125332686 @default.
• W2000519199 hasRelatedWork W2142925367 @default.
• W2000519199 hasRelatedWork W2611083600 @default.
• W2000519199 hasRelatedWork W351849447 @default.
• W2000519199 hasVolume "271" @default.
• W2000519199 isParatext "false" @default.
• W2000519199 isRetracted "false" @default.
• W2000519199 magId "2000519199" @default.
• W2000519199 workType "article" @default.