FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000523504> ?p ?o ?g. }

• W2000523504 endingPage "10637" @default.
• W2000523504 startingPage "10630" @default.
• W2000523504 abstract "Lactase-phlorizin hydrolase (LPH) is a membrane bound intestinal hydrolase, with an extracellular domain comprising 4 homologous regions. LPH is synthesized as a large polypeptide precursor, pro-LPH, that undergoes several intra- and extracellular proteolytic steps to generate the final brush-border membrane form LPHβfinal. Pro-LPH is associated through homologous domain IV with the membrane through a transmembrane domain. A truncation of 236 amino acids at the COOH terminus of domain IV (denoted LAC236) does not significantly influence the transport competence of the generated mutant LPH1646MACT (Panzer, P., Preuss, U., Joberty, G., and Naim, H. Y. (1998) J. Biol. Chem. 273, 13861–13869), strongly suggesting that LAC236 is an autonomously folded domain that links the ectodomain with the transmembrane region. Here, we examine this hypothesis by engineering several N-linked glycosylation sites into LAC236. Transient expression of the cDNA constructs in COS-1 cells confirm glycosylation of the introduced sites. The N-glycosyl pro-LPH mutants are transported to the Golgi apparatus at substantially reduced rates as compared with wild-type pro-LPH. Alterations in LAC236 appear to sterically hinder the generation of stable dimeric trypsin-resistant pro-LPH forms. Individual expression of chimeras containing LAC236, the transmembrane domain and cytoplasmic tail of pro-LPH and GFP as a reporter gene (denoted LAC236-GFP) lends strong support to this view: while LAC236-GFP is capable of forming dimersper se, its N-glycosyl variants are not. The data strongly suggest that the LAC236 is implicated in the dimerization process of pro-LPH, most likely by nucleating the association of the ectodomains of the enzyme. Lactase-phlorizin hydrolase (LPH) is a membrane bound intestinal hydrolase, with an extracellular domain comprising 4 homologous regions. LPH is synthesized as a large polypeptide precursor, pro-LPH, that undergoes several intra- and extracellular proteolytic steps to generate the final brush-border membrane form LPHβfinal. Pro-LPH is associated through homologous domain IV with the membrane through a transmembrane domain. A truncation of 236 amino acids at the COOH terminus of domain IV (denoted LAC236) does not significantly influence the transport competence of the generated mutant LPH1646MACT (Panzer, P., Preuss, U., Joberty, G., and Naim, H. Y. (1998) J. Biol. Chem. 273, 13861–13869), strongly suggesting that LAC236 is an autonomously folded domain that links the ectodomain with the transmembrane region. Here, we examine this hypothesis by engineering several N-linked glycosylation sites into LAC236. Transient expression of the cDNA constructs in COS-1 cells confirm glycosylation of the introduced sites. The N-glycosyl pro-LPH mutants are transported to the Golgi apparatus at substantially reduced rates as compared with wild-type pro-LPH. Alterations in LAC236 appear to sterically hinder the generation of stable dimeric trypsin-resistant pro-LPH forms. Individual expression of chimeras containing LAC236, the transmembrane domain and cytoplasmic tail of pro-LPH and GFP as a reporter gene (denoted LAC236-GFP) lends strong support to this view: while LAC236-GFP is capable of forming dimersper se, its N-glycosyl variants are not. The data strongly suggest that the LAC236 is implicated in the dimerization process of pro-LPH, most likely by nucleating the association of the ectodomains of the enzyme. endoplasmic reticulum lactase-phlorizin hydrolase (all forms) uncleaved precursor of LPH monoclonal antibody mannose-rich precursor complex glycosylated precursor a stretch of 236 amino acids (Arg1647-Thr1882) located juxtapose the membrane anchoring domain of pro-LPH green fluorescent protein polyacrylamide gel electrophoresis endoglycosidase N,N,N′,N′-tetramethylethylenediamine The pathways by which membrane and secretory proteins attain their three-dimensional structure, in particular the implication of glycosylation in these events has been the target of extensive investigation in the past few years. N-Glycosylation is necessary for efficient folding in the ER1 (1.Fan H. Meng W. Kilian C. Grams S. Reutter W. Eur. J. Biochem. 1997; 246: 243-251Crossref PubMed Scopus (75) Google Scholar, 2.Letourneur O. Sechi S. Willette-Brown J. Robertson M.W. Kinet J.P. J. Biol. Chem. 1995; 270: 8249-8256Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 3.Riederer M.A. Hinnen A. J. Bacteriol. 1991; 173: 3539-3546Crossref PubMed Google Scholar, 4.Zhang Y. Dahms N.M. Biochem. J. 1993; 295: 841-848Crossref PubMed Scopus (27) Google Scholar, 5.Roberts P.C. Garten W. Klenk H.D. J. Virol. 1993; 67: 3048-3060Crossref PubMed Google Scholar), interaction with calnexin and calreticulin (6.Cannon K.S. Hebert D.N. Helenius A. J. Biol. Chem. 1996; 271: 14280-14284Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), receptor-ligand binding (7.Zhang R. Cai H. Fatima N. Buczko E. Dufau M.L. J. Biol. Chem. 1995; 270: 21722-21728Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), transport to lysosomes (8.Chapman R.L. Kane S.E. Erickson A.H. J. Biol. Chem. 1997; 272: 8808-8816Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar), polarized sorting to the apical plasma membrane (9.Scheiffele P. Peranen J. Simons K. Nature. 1995; 378: 96-98Crossref PubMed Scopus (417) Google Scholar), and also for optimal expression of some proteins (10.Shen F. Wang H. Zheng X. Ratnam M. Biochem. J. 1997; 327: 759-764Crossref PubMed Scopus (37) Google Scholar). The addition ofN-linked core oligosaccharides to membrane and secretory glycoproteins occurs co-translationally at asparagine residues in the tripeptide sequon Asn-Xaa-Ser/Thr soon after translocation of the nascent polypeptide into the lumen of the endoplasmic reticulum (ER). However, the presence of the sequon does not ensure core glycosylation, as many proteins contain sequons that remain either unglycosylated or glycosylated to a variable extent (11.Allen S. Naim H.Y. Bulleid N.J. J. Biol. Chem. 1995; 270: 4797-4804Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). N-Glycosyl sugar chains are core-glycosylated in the ER and become complex glycosylated by passing through the Golgi apparatus. AlthoughN-glycosylation in the ER constitutes the critical step in the initial folding of proteins, the complex glycosylated chains in some glycoproteins, acquired in the Golgi, are also required for the acquisition of a correct conformation (12.Loo T.W. Clarke D.M. J. Biol. Chem. 1998; 273: 14671-14674Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Several roles forN-linked oligosaccharides in protein folding have been described so far. Their presence assists folding by facilitating disulfide bond formation (11.Allen S. Naim H.Y. Bulleid N.J. J. Biol. Chem. 1995; 270: 4797-4804Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 13.Feng W. Matzuk M.M. Mountjoy K. Bedows E. Ruddon R.W. Boime I. J. Biol. Chem. 1995; 270: 11851-11859Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 14.Rickert K.W. Imperiali B. Chem. Biol. 1995; 2: 751-759Abstract Full Text PDF PubMed Scopus (55) Google Scholar) or through a chaperone-mediated glucose trimming and reglycosylation cycle in the ER (15.Hebert D.N. Foellmer B. Helenius A. Cell. 1995; 81: 425-433Abstract Full Text PDF PubMed Scopus (490) Google Scholar). The absence of N-glycosyl chains influences the quaternary structure of proteins as has been demonstrated for the dimerization of MUC2 mucin (16.Asker N. Axelsson M.A.B. Olofsson S.-O. Hansson G.C. J. Biol. Chem. 1998; 273: 18857-18863Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Also highly glycosylated protein domains, like the carboxyl-terminal peptide (CTP) of the human placental hormone CG-β subunit, can participate in the folding of the whole subunit (17.Muyan M. Boime I. Mol. Endocrinol. 1998; 12: 766-772PubMed Google Scholar). We used human lactase-phlorizin hydrolase (EC 3.2.1.23–3.2.1.62) (LPH) as the appropriate model protein to study the influence ofN-glycosyl sugar chains on the folding of single protein domains. This enzyme is synthesized in intestinal cells as a pro-LPH that undergoes one intracellular proteolytic cleavage in the Golgi apparatus to generate a mature LPHβinitial that is targeted with high fidelity to the apical membrane. A final cleavage step takes place in the intestinal lumen by trypsin to generate LPHβfinal that exerts its biological function in hydrolyzing lactose. Pro-LPH consists of four homologous regions with 38–55% homology and is associated with the plasma-membrane via a membrane anchor at the COOH terminus of the LPHβfinaldomain (18.Mantei N. Villa M. Enzler T. Wacker H. Boll W. James P. Hunziker W. Semenza G. EMBO J. 1988; 7: 2705-2713Crossref PubMed Scopus (212) Google Scholar). The different protein domains are likely involved together or independently in the folding of pro-LPH. Most notably is the critical role of the profragment, LPHα, in the maturation of LPHβinitial (19.Wuthrich M. Grunberg J. Hahn D. Jacob R. Radebach I. Naim H.Y. Sterchi E.E. Arch. Biochem. Biophys. 1996; 336: 27-34Crossref PubMed Scopus (21) Google Scholar, 20.Jacob R. Radebach I. Wuthrich M. Grunberg J. Sterchi E.E. Naim H.Y. Eur. J. Biochem. 1996; 236: 789-795Crossref PubMed Scopus (26) Google Scholar). Deletion of this NH2-terminal domain leads to a drastic reduction in the proportion of correctly folded and transport-competent molecules (21.Naim H.Y. Jacob R. Naim H. Sambrook J.F. Gething M.J. J. Biol. Chem. 1994; 269: 26933-26943Abstract Full Text PDF PubMed Google Scholar,22.Oberholzer T. Mantei N. Semenza G. FEBS Lett. 1993; 333: 127-131Crossref PubMed Scopus (27) Google Scholar). Apart from the LPHα domain, the transmembrane and perhaps also the cytoplasmic domains of pro-LPH play a key role in acquisition of a correct dimeric protein structure (23.Naim H.Y. Naim H. Eur. J. Cell Biol. 1996; 70: 198-208PubMed Google Scholar) and transport competence of the enzyme (24.Panzer P. Preuss U. Joberty G. Naim H.Y. J. Biol. Chem. 1998; 273: 13861-13869Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). The homologous region IV contains a subdomain with structural characteristics of unfolded, highlyO-glycosylated stalk regions found in a variety of membrane proteins such as low density lipoprotein receptor, sucrase isomaltase, and aminopeptidase N (25.Hunziker W. Spiess M. Semenza G. Lodish H.F. Cell. 1986; 46: 227-234Abstract Full Text PDF PubMed Scopus (235) Google Scholar, 26.Olsen J. Cowell G.M. Konigshofer E. Danielsen E.M. Moller J. Laustsen L. Hansen O.C. Welinder K.G. Engberg J. Hunziker W. FEBS Lett. 1988; 238: 307-314Crossref PubMed Scopus (197) Google Scholar). This domain harbors the catalytic site of the lactose hydrolytic activity. We could show that deletion of 236 amino acids located in the immediate vicinity of the membrane in homologous region IV had almost no influence on the quaternary structure, transport, and sorting of LPH to the plasma membrane (24.Panzer P. Preuss U. Joberty G. Naim H.Y. J. Biol. Chem. 1998; 273: 13861-13869Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). By contrast, a further deletion of 87 amino acids upstream of the 236-amino acid stretch have led to an inhibition of the dimerization event and to a substantial reduction in the transport capacity of the deletion mutant. This suggested that the last 236 amino acids of domain IV fold independently of the extracellular domain and might function as a link between the globular protein and the membrane by forming a stalk region. Structural predictions of the first 20 amino acids of the deleted region reveal an α-helical structure similar to the stalk of aminopeptidase-N (27.Vogel L.K. Noren O. Sjostrom H. FEBS Lett. 1992; 308: 14-17Crossref PubMed Scopus (25) Google Scholar). Additionally, according to data derived from a survey of large number of O-glycosylation sites (28.Wilson I.B. Gavel Y. von Heijne G. Biochem. J. 1991; 275: 529-534Crossref PubMed Scopus (240) Google Scholar), the first 50 amino acids of the deleted region contain several potentialO-glycosylation sites, which are presumably glycosylated in the mature form of LPH (amino acids 869–1927) (29.Naim H.Y. Lentze M.J. J. Biol. Chem. 1992; 267: 25494-25504Abstract Full Text PDF PubMed Google Scholar). In this paper we addressed the role of this domain in the context of the overall folding of pro-LPH by introducing potential N-glycosylation sites into this domain. We demonstrate that the mutated constructs are at least partially misfolded and transported to the cell surface at markedly lower rates than the wild-type species. The effect of the additional N-glycosylation sites is in all likelihood limited to the folding of a region including the 236 amino acids stretch, but nevertheless implicates the dimerization event and subsequent trafficking of the mutants. Tissue culture reagents, streptomycin, penicillin, Dulbecco's modified Eagle's medium (DMEM), and methionine-free DMEM were purchased from Life Technologies, Inc. Pepstatin, leupeptin, aprotinin, and molecular weight standards for SDS-PAGE were purchased from Sigma.l-[35S]Methionine (>800 Ci/mmol) and protein A-Sepharose were obtained from Amersham Pharmacia Biotech. Acrylamide and N,N′-methylenebisacrylamide were obtained from Carl Roth GmbH & Co., Karlsruhe, Germany. SDS, TEMED, ammonium persulfate, dithiothreitol, and Triton X-100 were obtained from Merck, Darmstadt, Germany. Endo-β-N-acetylglucosaminidase H (endo H), endo-β-N-acetylglucosaminidase F (containing N-glycosidase F (or N-glycanase) (endo F/GF), and phenylmethanesulfonyl fluoride were purchased from Roche Diagnostics (Mannheim). All other reagents were of superior analytical grade. Restriction enzymes, T4 polymerase, and ligase were obtained from New England Biolabs. Oligonucleotide-directed mutagenesis was performed with the “Altered SitesTM in Vitro mutagenesis System” from Promega Corp., Madison, WI. The following oligonucleotides were used in this context: 5′-CAAAAGAAGAGTTGGCAGTGGCAT-3′ for the LPHI1697N, 5′-GCCACGAGCGATTTGCGATGGAAGC-3′ for the LPHD1711N, 5′-CATAAATTGGAGAGTCATTGTATTC-3′ for the LPHP1743S. The plasmid pLPH containing the full-length cDNA of LPH inserted into the unique EcoRI site of vector pGEM4Z (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar) was used for subcloning of the distalEcoRI/PstI fragment of LPH into the vector pSelect (Promega). This construct was the template for all three mutagenesis reactions with the Altered SitesTM in Vitro Mutagenesis System. Mutagenized plasmids were sequenced to confirm the mutagenesis reaction and cloned back into the full-length LPH cDNA. For expression in COS-1 cells, the pSG8-LPHI1697N, pSG8-LPHD1711N, and pSG8-LPHP1743S expression vectors were constructed by ligating the full-length LPH cDNA clones into the uniqueEcoRI site of the pSG8 vector. TheEcoRI/ScaI fragment from pLPH (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar) containing full-length LPH was cloned in-frame into the polycloning site of peGFP-N1 (CLONTECH) to create pLPH-GFP, encoding the cDNA for a pro-LPH molecule with COOH-terminal fused GFP (pro-LPH-GFP). For the generation of the LAC236-GFP series the signal sequence of LPH, LPHsignal, was synthesized at first by polymerase chain reaction using full-length LPH cDNA as template as described (21.Naim H.Y. Jacob R. Naim H. Sambrook J.F. Gething M.J. J. Biol. Chem. 1994; 269: 26933-26943Abstract Full Text PDF PubMed Google Scholar). Another cDNA comprising the last 20 nucleotides of LPHsignal (nucleotides 52–71) and nucleotides 4955 to 4974 of pro-LPH were synthesized by polymerase chain reaction using pLPH, pSG8-LPHI1697N, pSG8-LPHD1711N, or pSG8-LPHP1743S as template and the following oligonucleotides: LPHsig/1646, GTTTTTCATGCTGGGGGTCACGTGACAGGAGCTTGGCTGC, and cLPH6869, CTCTAACGGTGCAGCAGGAC. The resulting DNA molecules were fused to LPHsignal in four different assembly polymerase chain reactions. The reaction products were each digested withEcoRI/ScaI and cloned in-frame into the polycloning site of peGFP-N1 (CLONTECH) to create pLAC236wt-GFP, pLAC236I1697N-GFP, pLAC236D1711N-GFP, and pLAC236P1743S-GFP. The sequence of the constructs was confirmed by DNA sequencing. COS-1-cells were cultured in DMEM supplemented with 10% fetal calf serum, 50 units/ml penicillin, and 50 mg/ml streptomycin (denoted complete medium). They were transfected without DNA (mock) or 2 μg of the appropriate recombinant DNA using DEAE-dextran essentially as described before (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar). Transiently transfected COS-1 cells were labeled 48–60 h post-transfection with 80 μCi of [35S]methionine in methionine-free DMEM containing 2% fetal calf serum, 50 units/ml penicillin, and 50 mg/ml streptomycin (denoted Met-free medium). In pulse-chase experiments labeling was performed for 1 h at 37 °C followed by a chase with non-labeled methionine for different periods of time. The labeled cells were rinsed two times with phosphate-buffered saline. Cells were solubilized with 1 ml/dish of cold lysis buffer essentially as described before (24.Panzer P. Preuss U. Joberty G. Naim H.Y. J. Biol. Chem. 1998; 273: 13861-13869Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). The cell extracts were centrifuged to remove nuclei and debris. Thereafter the supernatants were incubated with mouse anti-human lactase-phlorizin hydrolase monoclonal antibody HBB 1/909/34/74 (31.Hauri H.P. Sterchi E.E. Bienz D. Fransen J.A. Marxer A. J. Cell Biol. 1985; 101: 838-851Crossref PubMed Scopus (377) Google Scholar) from Dr. H.-P. Hauri (Biocenter, Basel, Switzerland) or with the mouse anti-GFP antibody B34 (Babco) and precipitated with protein A-Sepharose. Following immunoprecipitation, the protein A-Sepharose beads were washed 3 times with washing buffer A (0.5% Triton X-100, 0.05% sodium deoxycholate in phosphate-buffered saline) and 3 times with washing buffer B (500 mm NaCl, 10 mm EDTA, 0.5% Triton X-100 in 125 mm Tris/HCl, pH 8.0) prior to analysis of the samples by SDS-PAGE and fluorography. Cells transfected with constructs containing GFP were also fixed with 3% paraformaldehyde 48 h post-transfection and the recombinant proteins were visualized by confocal laser microscopy (Leica TCS SP). Lactase activity was measured according to Dahlqvist (33.Dahlqvist A. Anal. Biochem. 1968; 22: 99-107Crossref PubMed Scopus (1021) Google Scholar) using lactose (Fluka) as substrate. Detergent extracts of transfected COS-1 cells (10 dishes of confluent cells) were used for immunoprecipitation of LPH. The immunoprecipitates were subsequently assayed for lactase activity essentially as described by Naim et al. (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar). Immunoprecipitates from biosynthetically labeled COS-1 cells were treated with 0.5 mg of the pancreatic protease trypsin at 37 °C for 0, 5, or 15 min, and the reaction was stopped by the addition of 2 mg of soybean trypsin inhibitor (Roche Molecular Biochemicals) at 4 °C followed by boiling in SDS-PAGE sample buffer. According to Ref. 24.Panzer P. Preuss U. Joberty G. Naim H.Y. J. Biol. Chem. 1998; 273: 13861-13869Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar, transfected COS-1 cells were labeled 48 h post-transfection for 6 h with [35S]methionine, washed two times with phosphate-buffered saline, and solubilized in 500 μl of 6 mm n-dodecyl-β-d-maltoside, 50 mmTris/HCl, 100 mm NaCl, pH 7.4, and a mixture of protease inhibitors. To remove nuclei and debris the cell extracts were centrifuged for 20 min at 17,000 × g at 4 °C. The supernatants were layered onto a continuous gradient from 10 to 30% or 5 to 25% (w/v) sucrose. After centrifugation for 22 h at 100,000 × g at 4 °C, different fractions were collected and immunoprecipitated with mAb anti-LPH or mAb anti-GFP and analyzed on 6% SDS-PAGE. Digestion of 35S-labeled immunoprecipitates with endo-β-N-acetylglucosaminidase H (endo H) and endo-β-N-acetylglucosaminidase F/glycopeptidase F (endo F/GF) was performed as described previously (34.Naim H.Y. Sterchi E.E. Lentze M.J. Biochem. J. 1987; 241: 427-434Crossref PubMed Scopus (125) Google Scholar). Truncation of 236 amino acids immediately upstream of the membrane anchor of LPH did not affect the quaternary structure, transport competence, or polarized sorting of the enzyme (24.Panzer P. Preuss U. Joberty G. Naim H.Y. J. Biol. Chem. 1998; 273: 13861-13869Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). These data suggested that this stretch (LAC236), which lies in the homologous region IV of LPH, is independently folded and is probably a linker between the transmembrane of LPH and the remainder of its ectodomain. To investigate this hypothesis and explore further structural features and the role of this region within the ectodomain of LPH, we introduced mutations that result in potential N-glycosylation sites (sequon Asn-X-Ser/Thr). The mutants contained one of the following amino acid substitutions: Ile1697 to Asn1697 (LPHI1697N), Asp1711 to Asn1711 (LPHD1711N), and Pro1743 to Ser1743 (LPHP1743S) (Fig.1). The influence of these mutations on the biosynthesis, folding, and transport of pro-LPH was investigated in COS cells transfected with expression vectors containing the mutated LPH cDNAs. Fig. 2 shows an SDS-PAGE analysis of the immunoprecipitated mutants. Within 6 h of biosynthetic labeling each mutant revealed two polypeptides. Treatment of these forms with endo H demonstrated the type of glycosylation of these forms. The higher molecular mass species (∼230 kDa) were resistant to endo H indicating their complex type of glycosylation, while the smaller polypeptides (∼215 kDa) were sensitive and shifted to approximately 200-kDa band (Fig. 2 B). In analogy with wild-type pro-LPH, these forms correspond to the mannose-rich (∼215 kDa) and complex glycosylated (∼230 kDa) species and could both be deglycosylated by treatment with endo F/GF. The introduced potentialN-glycosylation sites in pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S could be electrophoretically demonstrated to be indeed glycosylated when compared with wild-type pro-LPH. The mannose-rich polypeptides as well as their complex glycosylated forms revealed slight shifts in their apparent molecular masses as compared with their wild-type counterparts (indicated by the asterisk). In contrast to the complex glycosylated counterparts, the endo H-treated deglycosylated mannose-rich forms of the mutants and wild-type pro-LPH shifted to identical apparent molecular weights. Variations in the apparent molecular weights of the complex glycosylated pro-LPH glycoforms could be detected, whereby wild-type pro-LPH was smaller than each of the mutated proteins (pro-LPHc versuspro-LPHc*). Since the N-deglycosylated mannose-rich pro-LPH molecules are all of the same size, an increase in molecular weight is the consequence of additionalN-glycosylation at the added sites. In addition to size shifts, variations in the proportions of the complex glycosylated forms of the mutants as compared with wild-type pro-LPH could be detected. We therefore compared the transport kinetics of pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S with those of wild-type pro-LPH by applying a pulse-chase protocol. The results are shown in Fig. 3. Mutant forms and wild-type pro-LPH were detected exclusively as mannose-rich species after 1 h of pulse. Wild-type pro-LPH was processed in the Golgi apparatus much faster than the mutants. Within 2 h of chase complex glycosylated pro-LPH appeared, while 4 to 8 h were required to see the complex glycosylated species of pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S. While approximately 50% of wild-type pro-LPH was converted to a complex glycosylated species within 12 h of chase, 20% of pro-LPHI1697N, 25% of pro-LPHD1711N, and only 18% of pro-LPHP1743S were found as complex glycosylated species within an identical chase period (see Fig. 3 B). Taken together, the results demonstrate that the glycosylation mutants were transported to the Golgi apparatus, albeit at a much slower rate than wild-type pro-LPH.Figure 2Expression of wild-type pro-LPH , pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S in COS-1 cells. Transfected COS-1 cells were labeled for 6 h (pro-LPHwt) or 10 h (pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S) with [35S]methionine. After immunoprecipitation with mAb anti-LPH (HBB) the samples were divided into three aliquots and treated with endo H, endo F/PNGase F, or not treated. The samples were analyzed by SDS-PAGE on 6% slab gels.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Transport kinetics of wild-type pro-LPH and mutant proteins. A, COS-1 cells were transfected with the cDNA of wild-type pro-LPH and the mutants, pulse labeled for 1 h with [35S]methionine and chased for the indicated periods of time with cold methionine. The immunoprecipitates were analyzed by SDS-PAGE on 6% slab gels. B, densitometric scanning of the fluorograms shown in A.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The reduced transport rates of the pro-LPH glycosylation mutants is most likely the consequence of an altered three-dimensional structure as has been shown previously for other polypeptides (1.Fan H. Meng W. Kilian C. Grams S. Reutter W. Eur. J. Biochem. 1997; 246: 243-251Crossref PubMed Scopus (75) Google Scholar, 2.Letourneur O. Sechi S. Willette-Brown J. Robertson M.W. Kinet J.P. J. Biol. Chem. 1995; 270: 8249-8256Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 3.Riederer M.A. Hinnen A. J. Bacteriol. 1991; 173: 3539-3546Crossref PubMed Google Scholar, 4.Zhang Y. Dahms N.M. Biochem. J. 1993; 295: 841-848Crossref PubMed Scopus (27) Google Scholar, 5.Roberts P.C. Garten W. Klenk H.D. J. Virol. 1993; 67: 3048-3060Crossref PubMed Google Scholar). We investigated therefore the folding properties of the mutants as compared with wild-type pro-LPH by utilizing (i) enzymatic activity assays and (ii) protease sensitivity. COS-1 cells were transiently transfected with the cDNAs of pro-LPHI1697N, pro-LPHD1711N, pro-LPHP1743S, and wild-type pro-LPH and were labeled for 6 h with [35S]methionine. The cell lysates were immunoprecipitated with mAb anti-LPH (HBB). Part of each immunoprecipitate was separated by SDS-PAGE to confirm the expression of the expected species, while the remainder was assayed for enzymatic activity using lactose as a substrate. The electrophoretic analysis revealed the expected molecular forms (not shown, but refer to Fig. 2). The enzymatic activities of the three N-glycosylation mutants reached only background levels indicating that the mutants are not active. The wild-type pro-LPH control was as expected enzymatically active with a specific activity levels similar to that reported previously (5.6–5.8 × 109 IU/mol) (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar). The activity site of lactase within pro-LPH has been assigned to glutamic acid residues 1271 and 1747 in rabbit LPH (32.Wacker H. Keller P. Falchetto R. Legler G. Semenza G. J. Biol. Chem. 1992; 267: 18744-18752Abstract Full Text PDF PubMed Google Scholar). One explanation for the lack of enzymatic activity in the three mutants are misfolded structures around glutamic acid 1747, which lies in a close proximity to the mutations made in pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S. We probed the folding pattern of the mutants by using a trypsin sensitivity assay. Trypsin cleaves correctly folded pro-LPH to a 160-kDa LPHβfinal mature enzyme which is resistant toward further protease treatment (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar). A change in the trypsin cleavage pattern is compatible with altered protein folding, since novel trypsin cleavage sites become exposed which are normally shielded in the core of the correctly folded native protein (30.Naim H.Y. Lacey S.W. Sambrook J.F. Gething M.J. J. Biol. Chem. 1991; 266: 12313-12320Abstract Full Text PDF PubMed Google Scholar,35.Jacob R. Bulleid N.J. Naim H.Y. J. Biol. Chem. 1995; 270: 18678-18684Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar). Pro-LPH was immunoprecipitated from transfected COS-1 cells labeled with [35S]methionine for 10 h and the immunoprecipitates were treated with trypsin for 5 or 15 min at 37 °C. As shown in Fig. 4 the 160-kDa LPHβfinal appeared within 5 min of trypsin treatment and persisted at the same size and intensity after 15 min of digestion. By contrast, a similar band did not appear when the mutants were treated with trypsin. Faint bands corresponding to the pro-LPH glycoforms were still observed in the 5-min time point, but these forms were completely degraded within 15 min of trypsin treatment. Taken together, the lack of enzymatic activity and the accessibility to degradation by trypsin strongly suggest that pro-LPHI1697N, pro-LPHD1711N, and pro-LPHP1743S have" @default.
• W2000523504 created "2016-06-24" @default.
• W2000523504 creator A5034476412 @default.
• W2000523504 creator A5044873395 @default.
• W2000523504 creator A5054419302 @default.
• W2000523504 creator A5091380230 @default.
• W2000523504 date "2000-04-01" @default.
• W2000523504 modified "2023-09-30" @default.
• W2000523504 title "Additional N-Glycosylation and Its Impact on the Folding of Intestinal Lactase-phlorizin Hydrolase" @default.
• W2000523504 cites W1482595433 @default.
• W2000523504 cites W1506033718 @default.
• W2000523504 cites W1527995842 @default.
• W2000523504 cites W1538933232 @default.
• W2000523504 cites W1574672893 @default.
• W2000523504 cites W1606351341 @default.
• W2000523504 cites W1870828328 @default.
• W2000523504 cites W1964045538 @default.
• W2000523504 cites W1964117622 @default.
• W2000523504 cites W1966551225 @default.
• W2000523504 cites W1988676882 @default.
• W2000523504 cites W1991830834 @default.
• W2000523504 cites W1994900016 @default.
• W2000523504 cites W200081977 @default.
• W2000523504 cites W2006260523 @default.
• W2000523504 cites W2013314128 @default.
• W2000523504 cites W2030220645 @default.
• W2000523504 cites W2035391351 @default.
• W2000523504 cites W2040809334 @default.
• W2000523504 cites W2042488865 @default.
• W2000523504 cites W2051793369 @default.
• W2000523504 cites W2052518211 @default.
• W2000523504 cites W2056675361 @default.
• W2000523504 cites W2058669904 @default.
• W2000523504 cites W2065713456 @default.
• W2000523504 cites W2066719256 @default.
• W2000523504 cites W2071188744 @default.
• W2000523504 cites W2071809874 @default.
• W2000523504 cites W2074461464 @default.
• W2000523504 cites W2079230562 @default.
• W2000523504 cites W2110389243 @default.
• W2000523504 cites W2113559525 @default.
• W2000523504 cites W2120693849 @default.
• W2000523504 cites W2122997552 @default.
• W2000523504 cites W2137300408 @default.
• W2000523504 cites W2172683288 @default.
• W2000523504 cites W2339918210 @default.
• W2000523504 cites W2402099112 @default.
• W2000523504 doi "https://doi.org/10.1074/jbc.275.14.10630" @default.
• W2000523504 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10744759" @default.
• W2000523504 hasPublicationYear "2000" @default.
• W2000523504 type Work @default.
• W2000523504 sameAs 2000523504 @default.
• W2000523504 citedByCount "34" @default.
• W2000523504 countsByYear W20005235042013 @default.
• W2000523504 countsByYear W20005235042015 @default.
• W2000523504 countsByYear W20005235042016 @default.
• W2000523504 countsByYear W20005235042017 @default.
• W2000523504 countsByYear W20005235042018 @default.
• W2000523504 countsByYear W20005235042019 @default.
• W2000523504 countsByYear W20005235042020 @default.
• W2000523504 crossrefType "journal-article" @default.
• W2000523504 hasAuthorship W2000523504A5034476412 @default.
• W2000523504 hasAuthorship W2000523504A5044873395 @default.
• W2000523504 hasAuthorship W2000523504A5054419302 @default.
• W2000523504 hasAuthorship W2000523504A5091380230 @default.
• W2000523504 hasBestOaLocation W20005235041 @default.
• W2000523504 hasConcept C134018914 @default.
• W2000523504 hasConcept C161573976 @default.
• W2000523504 hasConcept C181199279 @default.
• W2000523504 hasConcept C185592680 @default.
• W2000523504 hasConcept C2777313579 @default.
• W2000523504 hasConcept C2778117581 @default.
• W2000523504 hasConcept C2778974006 @default.
• W2000523504 hasConcept C2779306644 @default.
• W2000523504 hasConcept C2780120296 @default.
• W2000523504 hasConcept C55493867 @default.
• W2000523504 hasConcept C86803240 @default.
• W2000523504 hasConceptScore W2000523504C134018914 @default.
• W2000523504 hasConceptScore W2000523504C161573976 @default.
• W2000523504 hasConceptScore W2000523504C181199279 @default.
• W2000523504 hasConceptScore W2000523504C185592680 @default.
• W2000523504 hasConceptScore W2000523504C2777313579 @default.
• W2000523504 hasConceptScore W2000523504C2778117581 @default.
• W2000523504 hasConceptScore W2000523504C2778974006 @default.
• W2000523504 hasConceptScore W2000523504C2779306644 @default.
• W2000523504 hasConceptScore W2000523504C2780120296 @default.
• W2000523504 hasConceptScore W2000523504C55493867 @default.
• W2000523504 hasConceptScore W2000523504C86803240 @default.
• W2000523504 hasIssue "14" @default.
• W2000523504 hasLocation W20005235041 @default.
• W2000523504 hasOpenAccess W2000523504 @default.
• W2000523504 hasPrimaryLocation W20005235041 @default.
• W2000523504 hasRelatedWork W1538933232 @default.
• W2000523504 hasRelatedWork W1574672893 @default.
• W2000523504 hasRelatedWork W1898655829 @default.
• W2000523504 hasRelatedWork W1964045538 @default.
• W2000523504 hasRelatedWork W1994040703 @default.
• W2000523504 hasRelatedWork W2000523504 @default.

• next