FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000749087> ?p ?o ?g. }

• W2000749087 endingPage "4456" @default.
• W2000749087 startingPage "4446" @default.
• W2000749087 abstract "Fatty acid ethyl esters are secondary metabolites produced by Saccharomyces cerevisiae and many other fungi. Their natural physiological role is not known but in fermentations of alcoholic beverages and other food products they play a key role as flavor compounds. Information about the metabolic pathways and enzymology of fatty acid ethyl ester biosynthesis, however, is very limited. In this work, we have investigated the role of a three-member S. cerevisiae gene family with moderately divergent sequences (YBR177c/EHT1, YPL095c/EEB1, and YMR210w). We demonstrate that two family members encode an acyl-coenzymeA:ethanol O-acyltransferase, an enzyme required for the synthesis of medium-chain fatty acid ethyl esters. Deletion of either one or both of these genes resulted in severely reduced medium-chain fatty acid ethyl ester production. Purified glutathione S-transferase-tagged Eht1 and Eeb1 proteins both exhibited acyl-coenzymeA:ethanol O-acyltransferase activity in vitro, as well as esterase activity. Overexpression of Eht1 and Eeb1 did not enhance medium-chain fatty acid ethyl ester content, which is probably due to the bifunctional synthesis and hydrolysis activity. Molecular modeling of Eht1 and Eeb1 revealed the presence of a α/β-hydrolase fold, which is generally present in the substrate-binding site of esterase enzymes. Hence, our results identify Eht1 and Eeb1 as novel acyl-coenzymeA:ethanol O-acyltransferases/esterases, whereas the third family member, Ymr210w, does not seem to play an important role in medium-chain fatty acid ethyl ester formation. Fatty acid ethyl esters are secondary metabolites produced by Saccharomyces cerevisiae and many other fungi. Their natural physiological role is not known but in fermentations of alcoholic beverages and other food products they play a key role as flavor compounds. Information about the metabolic pathways and enzymology of fatty acid ethyl ester biosynthesis, however, is very limited. In this work, we have investigated the role of a three-member S. cerevisiae gene family with moderately divergent sequences (YBR177c/EHT1, YPL095c/EEB1, and YMR210w). We demonstrate that two family members encode an acyl-coenzymeA:ethanol O-acyltransferase, an enzyme required for the synthesis of medium-chain fatty acid ethyl esters. Deletion of either one or both of these genes resulted in severely reduced medium-chain fatty acid ethyl ester production. Purified glutathione S-transferase-tagged Eht1 and Eeb1 proteins both exhibited acyl-coenzymeA:ethanol O-acyltransferase activity in vitro, as well as esterase activity. Overexpression of Eht1 and Eeb1 did not enhance medium-chain fatty acid ethyl ester content, which is probably due to the bifunctional synthesis and hydrolysis activity. Molecular modeling of Eht1 and Eeb1 revealed the presence of a α/β-hydrolase fold, which is generally present in the substrate-binding site of esterase enzymes. Hence, our results identify Eht1 and Eeb1 as novel acyl-coenzymeA:ethanol O-acyltransferases/esterases, whereas the third family member, Ymr210w, does not seem to play an important role in medium-chain fatty acid ethyl ester formation. The synthesis of fatty acid ethyl esters (FAEEs) 3The abbreviations used are: FAEE, fatty acid ethyl ester; AEATase, acyl-CoA:ethanol O-acyltransferase; MCFA, medium-chain fatty acid; GC-FID, headspace gas chromatography coupled with a flame ionization detector; GC-MS, purge-and-trap gas chromatography coupled with mass spectrometry; pNP, p-nitrophenyl; ORF, open reading frame; GST, glutathione S-transferase.3The abbreviations used are: FAEE, fatty acid ethyl ester; AEATase, acyl-CoA:ethanol O-acyltransferase; MCFA, medium-chain fatty acid; GC-FID, headspace gas chromatography coupled with a flame ionization detector; GC-MS, purge-and-trap gas chromatography coupled with mass spectrometry; pNP, p-nitrophenyl; ORF, open reading frame; GST, glutathione S-transferase. is widely distributed in microorganisms, higher plants, and mammals. In mammals, FAEEs are the result of the nonoxidative pathway for the metabolism of ethanol, after ethanol intake (1.Soderberg B.L. Salem R.O. Best C.A. Cluette-Brown J.E. Laposata M. Am. J. Clin. Pathol. 2003; 119: 94-99PubMed Google Scholar, 2.Criddle D.N. Raraty M.G.T. Neoptolemos J.P. Tepikin A.V. Petersen O.H. Sutton R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 10738-10743Crossref PubMed Scopus (164) Google Scholar). In higher plants and microorganisms, FAEEs are formed as secondary metabolites. Because of their strong fruit flavor, ethyl esters of short- and medium-chain fatty acids (MCFAs) constitute a large group of flavor compounds particularly important in the food, beverage, cosmetic, and pharmaceutical industries. The biosynthesis of FAEEs proceeds by two different enzymatic mechanisms, esterification or alcoholysis (3.Liu S.-Q. Holland R. Crow V.L. Int. Dairy J. 2004; 14: 923-945Crossref Scopus (273) Google Scholar). Esterification is the formation of esters from alcohols and carboxylic acids and is catalyzed by FAEE synthases/carboxylesterases. Alcoholysis is the production of esters from alcohols and acylglycerols or from alcohols and fatty acyl-CoAs derived from metabolism of fatty acids. Alcoholysis is essentially a transferase reaction in which fatty acyl groups from acylglycerols or acyl-CoA derivatives are directly transferred to alcohols. The formation of FAEEs by alcoholysis is catalyzed by acyl-CoA:ethanol O-acyltransferases (AEATases) (4.Laposata M. Prog. Lipid Res. 1998; 37: 307-316Crossref PubMed Scopus (72) Google Scholar). Ester biosynthesis is very common in microorganisms, especially in bacteria and yeasts that are used in the fermentation of alcoholic beverages and food products. Information about the metabolic pathways and enzymology of ester biosynthesis in these microorganisms, however, is still very limited (3.Liu S.-Q. Holland R. Crow V.L. Int. Dairy J. 2004; 14: 923-945Crossref Scopus (273) Google Scholar). In Saccharomyces cerevisiae, however, significant progress has recently been made. S. cerevisiae cells produce a broad range of esters during fermentation, which greatly affect the complex flavor of food and fermented alcoholic beverages (5.Mason A.B. Dufour J.-P. Yeast. 2000; 16: 1287-1298Crossref PubMed Scopus (180) Google Scholar). S. cerevisiae produces not only ethyl esters of short- to medium-chain fatty acids but also acetate esters of different alcohols (6.Verstrepen K.J. Derdelinckx G. Dufour J.-P. Winderickx J. Thevelein J.M. Pretorius I.S. Delvaux F.R. J. Biosci. Bioeng. 2003; 96: 110-118Crossref PubMed Scopus (312) Google Scholar). The enzymes responsible for acetate ester formation are already well defined, in contrast to enzymes involved in the formation of ethyl esters of short- and medium-chain fatty acids. Acetate esters are formed intracellular, in an enzyme-catalyzed condensation reaction between acetyl-CoA and ethanol or a higher alcohol. The reaction is catalyzed by alcohol O-acetyltransferases (EC 2.3.1.84). At present, three different alcohol O-acetyltransferases have been identified in yeast: Atf1, its closely related homologue Lg-Atf1, and Atf2 (for a review, see Ref. 6.Verstrepen K.J. Derdelinckx G. Dufour J.-P. Winderickx J. Thevelein J.M. Pretorius I.S. Delvaux F.R. J. Biosci. Bioeng. 2003; 96: 110-118Crossref PubMed Scopus (312) Google Scholar). Atf1 and Atf2 are present in both S. cerevisiae var. cerevisiae and S. cerevisiae var. pastorianus, whereas Lg-Atf1 is found only in S. cerevisiae var. pastorianus. Homology-based searches of the S. cerevisiae genome have not revealed any other gene encoding a putative ester-synthesizing enzyme with sequence similarity to Atf1 and/or Atf2. Of all known ester synthases, Atf1 is the most important for the production of acetate esters. Deletion analysis has shown that Atf1 is responsible for 80% of isoamyl acetate formation, 75% of phenyl ethyl acetate production, and about 40% of ethyl acetate synthesis. In addition, overexpression of the ATF1 gene results in a more than 100-fold increase in isoamyl acetate production, as well as a 10–200-fold increase in the production of other esters, such as ethyl acetate, phenyl ethyl acetate, and C3-C8 acetate esters (7.Verstrepen K.J. Van Laere S.D.M. Vanderhaegen B.M.P. Derdelinckx G. Dufour J.-P. Pretorius I.S. Winderickx J. Thevelein J.M. Delvaux F.R. Appl. Environ. Microbiol. 2003; 69: 5228-5237Crossref PubMed Scopus (269) Google Scholar). The deletion and overexpression analysis also showed that Atf1 is only involved in acetate ester synthesis and not in FAEE synthesis. Recently, a possible alcohol acyltransferase, designated Eht1 (ethanol hexanoyl transferase I) has been suggested as a candidate ethyl ester synthase (5.Mason A.B. Dufour J.-P. Yeast. 2000; 16: 1287-1298Crossref PubMed Scopus (180) Google Scholar). However, this putative alcohol acyltransferase has not been studied in any detail, and there are no experimental data to confirm the role of this protein in fatty acid ethyl ester synthesis. Here, we show that EHT1 belongs to a three-member gene family, also containing YPL095c and YMR210w, and we demonstrate an enzymatic role for Eht1 and Ypl095c in the synthesis and hydrolysis of MCFA ethyl esters in yeast. Because Ypl095c seems to be the most important enzyme for the synthesis of MCFA ethyl esters, we propose to call the YPL095c gene, EEB1, for ethyl ester biosynthesis gene 1. On the other hand, our results do not reveal an important role for Ymr210w in the synthesis of MCFA ethyl esters. Its precise function therefore remains currently unclear. Microbial Strains and Culturing Conditions—All plasmids, bacterial strains, and yeast strains used in this study are listed in Table 1. Yeast cultures were routinely grown at 30 °C in YPD medium (4% [w/v] glucose (Merck), 2% peptone (Difco), and 1% yeast extract (Difco) (8.Sherman F. Fink G.R. Hicks J. Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1991Google Scholar). Cultures were shaken with an orbital shaker at 50 rpm for test tubes or a horizontal shaker at 150 rpm for Erlenmeyer flasks. For selection of yeast overexpression transformants, minimal synthetic defined medium was used, containing 1.7 g liter-1 yeast nitrogen base without amino acids and without ammonium (Difco), 2.5 g liter-1 (NH4)2SO4 and 2% glucose (Merck), supplemented with 0.69 g liter-1 complete supplement mixture-Leu (Bio 101, Inc. Systems). For selection of yeast deletion mutants, YPD medium was used, supplemented with 150 mg liter-1 Geneticin (G418, Duchefa Biochemie). Escherichia coli was grown in Luria-Bertani medium containing 1% Bacto tryptone (Difco), 1% NaCl, and 0.5% yeast extract (Difco).TABLE 1Strains and plasmids used in this studyStrains and plasmidsGenotype or descriptionSource or Ref.S. cerevisiae BY4741 (wt)MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0ResGen/Invitrogen Belgium BY4741 Δeht1MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 eht1Δ0::KANrThis study BY4741 Δeeb1MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 eeb1Δ0::KANrThis study BY4741 Δymr210wMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 ymr210wΔ0::KANrThis study BY4741 Δeht1 Δeeb1MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 eht1Δ0::KANr eeb1Δ0::KANrThis study BY4741 Δeht1 Δymr210wMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 eht1Δ0::KANr ymr210wΔ0::KANrThis study BY4741 Δeeb1 Δymr210wMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 eeb1Δ0::KANrThis studyymr210wΔ0::KANr BY4741 Δeht1 Δeeb1MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0This study Δymr210weht1Δ0::KANr eeb1Δ0::KANr ymr210wΔ0::KANr BY4741 pEHT1sMATa his3Δ1 leu2Δ0/LEU2 met15Δ0 ura3Δ0This studyEHT1::PGK1p-EHT1-PGK1t SMR1–410 BY4741 pEEB1sMATa his3Δ1 leu2Δ0/LEU2 met15Δ0 ura3Δ0This studyEEB1::PGK1p-EEB1-PGK1t SMR1–410 BY4741 pYMR210wsMATa his3Δ1 leu2Δ0/LEU2 met15Δ0 ura3Δ0This studyYMR210w::PGK1p-YMR210w-PGK1t SMR1–410E. coli DH5αF′ end A1 hsdR17 supE44 thi-1 recA gyrA relA1 Δ (lacZYA-argF) U169 deoR [Φ80dlac DE(lacZ)M15]GIBCO-BRL/Life technologies BL21 (DE3)F- ompT hsdSB (rB-mB-) gal dcm rne131 (DE3)ResGen/Invitrogen BelgiumPlasmids pUG6bla TEF2p-KANMX-TEF2t11.Güldener U. Heck S. Fielder T. Beinhauer J. Hegemann J.H. Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1335) Google Scholar ps (empty vector, Yip)bla LEU2 SMR1–410 PGK1p-PGK1t35.Lilly M. Lambrechts M.G. Pretorius I.S. Appl. Environ. Microbiol. 2000; 66: 744-753Crossref PubMed Scopus (282) Google Scholar pEHT1-sbla LEU2 SMR1–410 PGK1p-EHT1-PGK1tThis study pEEB1-sbla LEU2 SMR1–410 PGK1p-EEB1-PGK1tThis study pYMR210w-sbla LEU2 SMR1–410 PGK1p-YMR210w-PGK1tThis study pSSE1aEEB1 and EHT1 were cloned into pGEX-4T-1 (Amersham Biosciences)GST-EEB1This study pSSE2aEEB1 and EHT1 were cloned into pGEX-4T-1 (Amersham Biosciences)GST-EHT1This studya EEB1 and EHT1 were cloned into pGEX-4T-1 (Amersham Biosciences) Open table in a new tab DNA Manipulations—Standard procedures for the isolation and manipulation of DNA were used (9.Ausubel F.M.R. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Struhl K. Current Protocols in Molecular Biology. Wiley, New York1994Google Scholar). Restriction enzymes, T4 DNA ligase, and Expand high fidelity DNA polymerase (Roche Applied Science) were used for enzymatic DNA manipulations as recommended by the supplier. Yeast transformation was carried out using the lithium acetate method (10.Gietz R.D. Schiestl R.H. Willems A.R. Woods R.A. Yeast. 1995; 11: 355-360Crossref PubMed Scopus (1667) Google Scholar). Construction of the Deletion Strains—Original deletions of EHT1, EEB1, and YMR210w were constructed by integrative transformation of strain BY4741, using KANMX from pUG6 (see Table 1) as selection cassette (11.Güldener U. Heck S. Fielder T. Beinhauer J. Hegemann J.H. Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1335) Google Scholar). The following primers were used for the amplification of DNA fragments by PCR: for the EHT1 ORF, EHT1-ORF-F (ATTAATATGAGCGTTTTTTAAGTTCTATTATTACATTGATAGTAGTTGCGTAAAAAACAAAGCTCATAAAAGTTTCCGATCAGCTGAAGCTTCGTACGC) and EHT1-ORF-R (AAAAATACATAACTTAAAATAAGGGGCATTGATCCAATGTTGTATAAATACATAGGAAAGTGGTTTGAAAATTGTGTGACAGCATAGGCCACTAGTGGATC); for the EEB1 ORF, EEB1-ORF-F (GGTTGCCTACTTATTTTCGGTATTTTTGAAGATTAGCAAAAGTCAAGATATCAAGTATTTTCATATTTGTCATTTTACAGCTGAAGCTTCGTACGC) and EEB1-ORF-R (AGCACAGCGTGGGGAGGATGTAAATAGAGAAATAAAAGAACAGATTATTATGTGTAAGGAATTTTATTAAGAACAATGATAGGCCA CTAGTGGATC); and for the YMR210w ORF, YMR210w-ORF-F (TATTTGAATTCGATAAAAACCAACTACTTTGTTATTTTAAACTGTATTATACAAACGCTGGTAAACTTCCAGAGACGATCAGCTGAAGCTTCGTACGC) and YMR210w-ORF-R (TTTCATTCAGAAAAATGATGTCGAACATCAAAAAAAAAAATTAGGTTACACATCTAAAAAGTTGACTTATTTACAAAGCATAGGCCACTAGTGGATC). Double deletants were constructed by crossing single deletants in all three pair wise combinations (Table 1), followed by sporulation. Haploid double deletants were isolated from non-parental ditypes (two G148R spores/two G418S spores) or from tetratypes (three G418R spores/one G418Sspore). The triple deletant was constructed by crossing the two haploid double deletants BY4741 (eht1Δ eeb1Δ) and BY4741 (eht1Δ ymr210wΔ) and sporulation of the diploid. All deletant strains used in this work were verified by PCR and sequencing to confirm the replacement of the genomic EHT1, EEB1, or YMR210w gene with the kanamycine gene. Sequencing was performed by the dideoxy chain-method with an Applied Biosystems (Foster City, California) model 3100 Avant sequencer according to the supplier's instructions. All sequencing reactions were performed at least twice. Sequences were analyzed with ABI Prisma and vector NTI Advance (Informax/Invitrogen, Merelbeke, Belgium) software. Construction of the Overexpression Strains—The plasmids pEHT1s, pEEB1s, and pYMR210ws were constructed by insertion of the respective ORFs into the XhoI restriction site in the PGK1 overexpression cassette of the ps vector (see Table 1) (the EHT1, EEB1, and YMR210w PCR products were cut with XhoI). The following primers were used for the amplification of DNA fragments by PCR: for the EHT1 ORF, XhoI-EHT1-ORF-F (TTGCCTCGAGATGTCAGAAGTTTCCAAAGCC, the XhoI restriction site is underlined) and XhoI-EHT1-ORF-R (TTGCCTCGAGTCATACA TATTCATCA AAC); for the EEB1 ORF, Xho-I-EEB1-ORF-F (TTGCCTCGAGATGTTTCGCCGTACTATC) and XhoI-EEB1-ORF-R (TTGCCTCGAGTTATAAAACTAACTCATCAAAG) and for the YMR210w ORF, XhoI-YMR210w-ORF-F (TTGCCTCGAGATGCGTTAAGAATTGTTAC) and XhoI-YMR210w-ORF-R (TTGCCTCGAGCTAATTCGCGCGAAAGGTGTG). Before transformation, the vectors were linearized in the inserted gene: pEEB1s was linearized with Bstz17I, and pEHT1s and pYMR210ws were linearized with SmaI. The empty vector was linearized in the SMR1–410 marker gene, which is a single base mutant of the ILV2 gene, with BlpI. The overexpression strains were verified using PCR and sequencing to confirm the correct genomic integration of the respective PGK1 overexpression constructs. Construction of the pSSE1 and pSSE2 Plasmids—The plasmids pSSE1 and pSSE2 were constructed by insertion of the respective ORFs into the SalI/NotI restriction site of pGEX-4T-1 (Table 1) (the EHT1 and EEB1 PCR products were cut with SalI and NotI). The following primers were used for the amplification of DNA fragments by PCR: for the EEB1 ORF, EEB1-GST-F (AGTTGCCGTCGACTTCGCTCGGGTTACTATCCAAC; the SalI restriction site is underlined) and EEB1-GST-R (ATCAACGGGCGGCCGCATAAAACTAACTCATCAAA; the NotI restriction site is underlined); for the EHT1 ORF, EHT1-GST-F (AGTTGCCGTCGACCAGAAGTTCCAAATGGCCAGC) and EHT1-GST-R (ATCAACGGGCGGCCGCCATACGACTAATTCATCAAA). Plasmids were constructed in E. coli strain DH5α and transformed in E. coli strain BL21(DE3) for the purification of Eht1 and Eeb1. Fermentation Experiments—Yeast precultures were shaken overnight at 28 °C in test tubes containing 5 ml of YPD medium. After 16 h of growth, 1 ml of the overnight culture was used to inoculate 50 ml of YPD medium in 250-ml Erlenmeyer flasks, and this second preculture was shaken at 28 °C until stationary growth phase (A600 = 2) was reached. Cells were washed with sterile, distilled water and used to inoculate 350 ml of fresh, prewarmed (28 °C) YPD medium containing 8% glucose to an A600 of 0.4. Static fermentation was carried out at 20 °C in flasks with water locks placed on top, to create semi-anaerobic conditions to maximize ester production. Samples for chromatographic analysis were taken after 96 h of fermentation and immediately cooled on ice in an airtight container. Headspace Gas Chromatography Coupled with Flame Ionization Detection (GC-FID) Analysis—Headspace gas chromatography coupled with flame ionization detection (GC-FID) was used for the measurement of ethyl hexanoate in the fermentation products of the deletion and overexpression strains. Samples of 5 ml were collected in 15-ml precooled glass tubes, which were immediately closed and cooled on ice. The GC-FID was also calibrated for ethyl butanoate, ethyl hexanoate, and ethyl octanoate for the enzyme tests. In this case, 200-μl samples were used. Samples were then analyzed with a calibrated Autosystem XL gas chromatograph with a headspace sampler (HS40; PerkinElmer Life Sciences) and equipped with a CP-Wax 52 CB column (length, 50 m; internal diameter, 0.32 mm; layer thickness, 1.2 μm; Chrompack, Varian, Palo Alto, CA). Samples were heated for 16 min at 60 °C in the headspace autosampler. The injection block and flame ionization detector temperatures were kept constant at 180 and 250 °C, respectively; helium was used as the carrier gas. The oven temperature was 75 °C held for 6 min and then increased to 110 °C at 25 °C min-1 and held at 100 °C for 3.5 min. Results were analyzed with PerkinElmer Life Sciences Turbochrom Navigator software. Purge-and-Trap GC-MS Analysis—Purge-and-trap gas chromatography coupled with mass spectrometry (GC-MS) was used for the measurement of ethyl butanoate, ethyl octanoate, and ethyl decanoate in the fermentation products of the deletion and overexpression strains. Samples (25 ml) were collected in airtight tubes and centrifuged (5 min; 5000 × g; 2 °C). The supernatant was poured into precooled 25 ml airtight tubes, and 100 μl of a 10% antifoam reagent (Sigma) was added to the sample. In addition, 100 μl of a 250 mg liter-1 solution of 2-ethyl hexanal (Sigma) in distilled water was added as an internal standard. Five milliliters of this sample was transferred into a Tekmar Dohrman 3000 (Emerson, Mason, OH) purge-and-trap sampler unit with following characteristics: helium carrier gas; 10 min purge at 120 °C; 15 min dry purge; cold trap temperature, -100 °C; 6-min desorption at 250 °C. A Fisons GC 8000 + MFA 815 cold-trap/control unit (Thermofinnigan, San Jose, CA) contained a Chrompack CP-Wax 52 CB column (length, 50 m; internal diameter, 0.32 mm; layer thickness, 1.2 μm; Varian). The oven program was as follows: 1 min at 50 °C, 4 °C min-1 to 120 °C, 2.5 °C min-1 to 165 °C, 15 °C min-1 to 240 °C, and 5 min at 240 °C. Total ion mass chromatograms were obtained in a Fisons MD 800 apparatus and analyzed with the masslab software program. Protein Purification—400-ml cultures of E. coli BL21(DE3) cells expressing the appropriate GST fusion were grown to an A600 nm = 1, induced with isopropyl β-d-thiogalactopyranoside (0.6 mm final) for 3 h at 30 °C, collected by centrifugation, and washed once in lysis buffer A (125 mm NaCl, 0.5% Triton-X-100, 1 mm dithiothreitol, 1 mm EDTA, and 50 mm sodium phosphate, pH 7.5). Washed cells were resuspended in 5 ml of lysis buffer A containing protease-inhibitor mix (Complete EDTA-free, Roche Applied Science) and 0.2 mg/ml lysozyme, incubated on ice for 15 min, and then lysis was completed by two 15 s pulses of sonication (model 450 sonifier, Branson). Lysates were clarified at 4 °C by centrifugation at 12,000 × g. The resulting supernatant fraction was mixed with 200 μl of a 50:50 slurry of glutathione-agarose beads (Amersham Biosciences) that had been pre-equilibrated in lysis buffer A and incubated for 1 h at 4°Con a rollerdrum. Beads were collected by centrifugation for 1 min at 500 × g, washed five times with 1 ml of wash buffer (125 mm NaCl, 0.05% Triton X-100, and 50 mm sodium phosphate, pH 7.5), and GST fusion proteins were eluted with 200 μl of elution buffer (125 mm NaCl, 0.1% Triton-X-100, 20 mm glutathione, and 50 mm sodium phosphate, pH 7.5). 16 μl of the GST fusion proteins were boiled with 4 μl of sample buffer for SDS-PAGE and were analyzed by staining with Coomassie Brilliant Blue and by immunoblotting with an appropriate antibody. In Vitro AEATase Enzyme Assay—Ethyl butanoate, ethyl hexanoate, and ethyl octanoate synthase activity was measured by headspace gas chromatography. The method described here is a modified version of the method described by Malcorps and Dufour (12.Malcorps P. Dufour J.-P. Eur. J. Biochem. 1992; 210: 1015-1022Crossref PubMed Scopus (107) Google Scholar). Ethyl butanoate, ethyl hexanoate and ethyl octanoate synthase assays were carried out for 1 h at 30 °C in a medium (200 μl) containing 200 mm KH2PO4, pH 7.8, 0.513 m ethanol, and 100 μm butyryl-CoA, hexanoyl-CoA, and octanoyl-CoA, respectively. Butyryl-CoA, hexanoyl-CoA, and octanoyl-CoA were purchased from Sigma. The specific activity is expressed as nmol of ester formed s-1 mg-1 protein. Total amount of protein in the samples was determined using a standard method (13.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar). Under all conditions, the enzyme activities were proportional to the amount of protein added and to the incubation time. Esterase Assay—Esterase activity with p-nitrophenyl esters as substrates was determined by measuring the amount of p-nitrophenol released by esterase catalyzed hydrolysis (14.Gilham D. Lehner R. Methods. 2005; 36: 139-147Crossref PubMed Scopus (147) Google Scholar). Substrate specificity against p-nitrophenyl (p-NP) esters was determined using p-nitrophenyl esters with a chain length between C2 (p-nitrophenyl acetate) and C18 (p-nitrophenyl stearate). Stock solutions of 100 mm p-nitrophenyl ester were made in CH2Cl2. All p-nitrophenyl esters were purchased from Sigma. Immediately prior to initiation of the assay, 10 μl of the stock solution was diluted into 10 ml of buffer containing 20 mm Tris-HCl, pH 8.0, 150 mm NaCl, and 0.01% Triton-X-100. Protein samples of up to 20 μl were incubated with 0.2 ml of substrate solution in 96-well clear microtiter plates. After incubation for 1 h at 30 °C,the liberation of p-nitrophenol was measured as the increase in absorbance at 410 nm in an ultraviolet-visible spectrophotometer against a blank without enzyme. The specific activity is expressed as nmol of p-nitrophenol released per s-1 μg-1 protein. The total amount of protein in the samples was determined using a standard method (13.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar). Under all conditions, the enzyme activities were proportional to the amount of protein added and to the incubation time. S. cerevisiae Contains a Family of Putative Ethyl Ester Biosynthesis Genes—The genes EHT1, YPL095c, and YMR210w constitute a three-gene family of moderately divergent sequences. We have named YPL095c EEB1 for “ethyl ester biosynthesis” gene 1 (see further). Pair wise comparisons of EHT1 with EEB1 showed 58 and 63% identity at the amino acid and DNA levels, respectively, and comparison with YMR210w showed 32 and 58% identity at the amino acid and DNA levels, respectively. The comparison of EEB1 and YMR210w gives 31 and 55% identity at the amino acid and DNA levels, respectively. Fig. 1A shows an alignment of Eht1, Eeb1, and Ymr210w. Sequence comparisons of EHT1, EEB1, and YMR210w with annotated data bases revealed sequence similarity with orthologues of various fungi (Fig. 1B). Eht1 and Eeb1 share common orthologues, while Ymr210w clearly shows similarity with a different set of orthologues. The sequence similarity of Eht1 and Eeb1 with common orthologues suggests that one of these two genes is a duplicated gene copy possibly arising from the ancient genome duplication of S. cerevisiae. According to Manolis et al. (15.Manolis K. Birren B.W. Lander E.S. Nature. 2004; 428: 617-624Crossref PubMed Scopus (1120) Google Scholar), EHT1 and EEB1 are located on duplicated regions of the S. cerevisiae genome, which could mean that they share a similar function. It is interesting to note that all the orthologues of Eht1 and Eeb1 and also Ymr210w have an as yet unknown function. This means that Eht1, Eeb1 and Ymr210w belong to yet uncharacterized gene families. With the functional investigation of these three enzymes, we will have a first clue of the possible functional role of the members of these two gene families. Deletion Analysis of EHT1, EEB1, and YMR210w and Medium-chain Fatty Acid Ethyl Ester Synthesis—To determine the possible function of EHT1, EEB1, and YMR210w in MCFA ethyl ester synthesis, we first constructed all the single, double, and triple deletion mutants for those three genes (see “Experimental Procedures” and Table 1). All single and multiple deletion strains are haploid viable. They were tested for possible growth defects by growing them in complete medium with glucose at 30 °C. The strain eht1Δ eeb1Δ showed a little delayed lag phase but reached the same A600 nm as the other strains in stationary phase (data not shown). To determine the effect of the deletion of EHT1, EEB1, and YMR210w on the synthesis of MCFA ethyl esters, the strains eht1Δ, eeb1Δ, ymr210wΔ, eht1Δ eeb1Δ, eht1Δ ymr210wΔ, eeb1Δ ymr210wΔ, and eht1Δ eeb1Δ ymr210wΔ were tested in batch culture fermentations for MCFA ethyl ester production. After 5 days of fermentation, samples for volatile compound determination were taken. They were analyzed by headspace GC-FID and purge-and-trap GC-MS. Fermentations and chromatographic analysis were performed as described under “Experimental Procedures.” The results of the GC-FID and GC-MS analyses are given in Fig. 2. Each fermentation experiment and the subsequent analysis were repeated three times for each strain. Fig. 2 shows that the levels of ethyl butanoate, ethyl hexanoate, ethyl octanoate, and ethyl decanoate produced during fermentation with the eeb1Δ strain were reduced in comparison with those produced by the wild type strain by, respectively, 36, 88, 45, and 40%. Compared with the eeb1Δ strain, deletion of EHT1 did not affect the production of ethyl butanoate and ethyl decanoate and resulted in only minor decreases in ethyl hexanoate formation (36%) and ethyl octanoate formation (20%). Deletion of YMR210w did not affect the production of MCFA ethyl esters, suggesting that Ymr210w has no role in the production of MCFA ethyl esters or that its role is redundant with that of other gene products. The double deletion strain eht1Δ eeb1Δ produced similar levels of ethyl butanoate, ethyl hexanoate, and ethyl decanoate as the eeb1Δ single deletion strain and a lower level of ethyl octanoate (82% reduction in comparison to the wild type), indicating that Eht1 plays only a minor role in MCFA ethyl ester synthesis, while Eeb1 is the most important enzyme for MCFA ethyl ester synthesis. The double deletion of EEB1 and YMR210w produced similar levels of ethyl butanoate and ethyl hexanoate in comparison to the eeb1Δ strain but lower levels for ethyl octanoate and ethyl decanoate. The double deletion strain eht1Δ ymr210wΔ showed no significant difference in the production of MCFA ethyl esters in comparison with the wild type strain. The eht1Δ eeb1Δ ymr210wΔ strain produced similar levels of ethyl butanoate and ethyl hexanoate as the eht1Δ eeb1Δ strain but showed a further 65% decrease in the production of ethyl octanoate and a further 88% decrease in the production of ethyl decanoate in comparison with the eht1Δ eeb1Δ strain. This confirms that Ymr210w plays no significant role in ethyl butanoate and ethyl hexanoate production but indicates that it does contri" @default.
• W2000749087 created "2016-06-24" @default.
• W2000749087 creator A5011858509 @default.
• W2000749087 creator A5035778660 @default.
• W2000749087 creator A5045008022 @default.
• W2000749087 creator A5061046602 @default.
• W2000749087 creator A5061157545 @default.
• W2000749087 creator A5080156795 @default.
• W2000749087 creator A5090068893 @default.
• W2000749087 date "2006-02-01" @default.
• W2000749087 modified "2023-10-12" @default.
• W2000749087 title "The Saccharomyces cerevisiae EHT1 and EEB1 Genes Encode Novel Enzymes with Medium-chain Fatty Acid Ethyl Ester Synthesis and Hydrolysis Capacity" @default.
• W2000749087 cites W1850569493 @default.
• W2000749087 cites W1914512945 @default.
• W2000749087 cites W1971612445 @default.
• W2000749087 cites W1972728295 @default.
• W2000749087 cites W1981272991 @default.
• W2000749087 cites W1988351824 @default.
• W2000749087 cites W2005533842 @default.
• W2000749087 cites W2022987806 @default.
• W2000749087 cites W2023977281 @default.
• W2000749087 cites W2040694939 @default.
• W2000749087 cites W2047439787 @default.
• W2000749087 cites W2049505636 @default.
• W2000749087 cites W2055264790 @default.
• W2000749087 cites W2056009575 @default.
• W2000749087 cites W2065926860 @default.
• W2000749087 cites W2073413181 @default.
• W2000749087 cites W2074717002 @default.
• W2000749087 cites W2081933515 @default.
• W2000749087 cites W2106882534 @default.
• W2000749087 cites W2116905253 @default.
• W2000749087 cites W2120811155 @default.
• W2000749087 cites W2123559957 @default.
• W2000749087 cites W2123972485 @default.
• W2000749087 cites W2130755410 @default.
• W2000749087 cites W2137441463 @default.
• W2000749087 cites W2144483796 @default.
• W2000749087 cites W2145568733 @default.
• W2000749087 cites W2147059525 @default.
• W2000749087 cites W2150661070 @default.
• W2000749087 cites W2171716817 @default.
• W2000749087 cites W4293247451 @default.
• W2000749087 doi "https://doi.org/10.1074/jbc.m512028200" @default.
• W2000749087 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16361250" @default.
• W2000749087 hasPublicationYear "2006" @default.
• W2000749087 type Work @default.
• W2000749087 sameAs 2000749087 @default.
• W2000749087 citedByCount "246" @default.
• W2000749087 countsByYear W20007490872012 @default.
• W2000749087 countsByYear W20007490872013 @default.
• W2000749087 countsByYear W20007490872014 @default.
• W2000749087 countsByYear W20007490872015 @default.
• W2000749087 countsByYear W20007490872016 @default.
• W2000749087 countsByYear W20007490872017 @default.
• W2000749087 countsByYear W20007490872018 @default.
• W2000749087 countsByYear W20007490872019 @default.
• W2000749087 countsByYear W20007490872020 @default.
• W2000749087 countsByYear W20007490872021 @default.
• W2000749087 countsByYear W20007490872022 @default.
• W2000749087 countsByYear W20007490872023 @default.
• W2000749087 crossrefType "journal-article" @default.
• W2000749087 hasAuthorship W2000749087A5011858509 @default.
• W2000749087 hasAuthorship W2000749087A5035778660 @default.
• W2000749087 hasAuthorship W2000749087A5045008022 @default.
• W2000749087 hasAuthorship W2000749087A5061046602 @default.
• W2000749087 hasAuthorship W2000749087A5061157545 @default.
• W2000749087 hasAuthorship W2000749087A5080156795 @default.
• W2000749087 hasAuthorship W2000749087A5090068893 @default.
• W2000749087 hasBestOaLocation W20007490871 @default.
• W2000749087 hasConcept C104317684 @default.
• W2000749087 hasConcept C181199279 @default.
• W2000749087 hasConcept C185592680 @default.
• W2000749087 hasConcept C2777576037 @default.
• W2000749087 hasConcept C53270655 @default.
• W2000749087 hasConcept C543025807 @default.
• W2000749087 hasConcept C55493867 @default.
• W2000749087 hasConcept C94412978 @default.
• W2000749087 hasConceptScore W2000749087C104317684 @default.
• W2000749087 hasConceptScore W2000749087C181199279 @default.
• W2000749087 hasConceptScore W2000749087C185592680 @default.
• W2000749087 hasConceptScore W2000749087C2777576037 @default.
• W2000749087 hasConceptScore W2000749087C53270655 @default.
• W2000749087 hasConceptScore W2000749087C543025807 @default.
• W2000749087 hasConceptScore W2000749087C55493867 @default.
• W2000749087 hasConceptScore W2000749087C94412978 @default.
• W2000749087 hasIssue "7" @default.
• W2000749087 hasLocation W20007490871 @default.
• W2000749087 hasLocation W20007490872 @default.
• W2000749087 hasOpenAccess W2000749087 @default.
• W2000749087 hasPrimaryLocation W20007490871 @default.
• W2000749087 hasRelatedWork W1965505065 @default.
• W2000749087 hasRelatedWork W2075571722 @default.
• W2000749087 hasRelatedWork W2363373624 @default.
• W2000749087 hasRelatedWork W2366062815 @default.
• W2000749087 hasRelatedWork W2367753394 @default.
• W2000749087 hasRelatedWork W2374635544 @default.
• W2000749087 hasRelatedWork W2377785145 @default.

• next