FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000795897> ?p ?o ?g. }

• W2000795897 endingPage "68" @default.
• W2000795897 startingPage "64" @default.
• W2000795897 abstract "A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonucleotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changes, and we now find protein-mediated renaturation to occur." @default.
• W2000795897 created "2016-06-24" @default.
• W2000795897 creator A5010639425 @default.
• W2000795897 creator A5020826583 @default.
• W2000795897 creator A5023658551 @default.
• W2000795897 creator A5037750170 @default.
• W2000795897 creator A5078822576 @default.
• W2000795897 date "1995-07-10" @default.
• W2000795897 modified "2023-10-17" @default.
• W2000795897 title "Fluorescence-detected interactions of oligonucleotides in RecA complexes" @default.
• W2000795897 cites W1506534753 @default.
• W2000795897 cites W1521772215 @default.
• W2000795897 cites W1533244785 @default.
• W2000795897 cites W1563123332 @default.
• W2000795897 cites W1591999606 @default.
• W2000795897 cites W2013570811 @default.
• W2000795897 cites W2016892437 @default.
• W2000795897 cites W2046871612 @default.
• W2000795897 cites W2050377333 @default.
• W2000795897 cites W2064956572 @default.
• W2000795897 cites W2074340625 @default.
• W2000795897 cites W2079866816 @default.
• W2000795897 cites W2087906849 @default.
• W2000795897 cites W2093777620 @default.
• W2000795897 cites W2096564718 @default.
• W2000795897 cites W2104450882 @default.
• W2000795897 cites W2137133056 @default.
• W2000795897 cites W2152251331 @default.
• W2000795897 cites W2156460738 @default.
• W2000795897 cites W2159075866 @default.
• W2000795897 cites W960004291 @default.
• W2000795897 doi "https://doi.org/10.1016/0014-5793(95)00600-e" @default.
• W2000795897 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7615090" @default.
• W2000795897 hasPublicationYear "1995" @default.
• W2000795897 type Work @default.
• W2000795897 sameAs 2000795897 @default.
• W2000795897 citedByCount "9" @default.
• W2000795897 countsByYear W20007958972012 @default.
• W2000795897 crossrefType "journal-article" @default.
• W2000795897 hasAuthorship W2000795897A5010639425 @default.
• W2000795897 hasAuthorship W2000795897A5020826583 @default.
• W2000795897 hasAuthorship W2000795897A5023658551 @default.
• W2000795897 hasAuthorship W2000795897A5037750170 @default.
• W2000795897 hasAuthorship W2000795897A5078822576 @default.
• W2000795897 hasConcept C104317684 @default.
• W2000795897 hasConcept C111357860 @default.
• W2000795897 hasConcept C121332964 @default.
• W2000795897 hasConcept C121745418 @default.
• W2000795897 hasConcept C12554922 @default.
• W2000795897 hasConcept C129312508 @default.
• W2000795897 hasConcept C14228908 @default.
• W2000795897 hasConcept C178790620 @default.
• W2000795897 hasConcept C185592680 @default.
• W2000795897 hasConcept C192468462 @default.
• W2000795897 hasConcept C2778301229 @default.
• W2000795897 hasConcept C2778951431 @default.
• W2000795897 hasConcept C41625074 @default.
• W2000795897 hasConcept C512185932 @default.
• W2000795897 hasConcept C552990157 @default.
• W2000795897 hasConcept C55493867 @default.
• W2000795897 hasConcept C62520636 @default.
• W2000795897 hasConcept C71240020 @default.
• W2000795897 hasConcept C75473681 @default.
• W2000795897 hasConcept C86803240 @default.
• W2000795897 hasConcept C91881484 @default.
• W2000795897 hasConceptScore W2000795897C104317684 @default.
• W2000795897 hasConceptScore W2000795897C111357860 @default.
• W2000795897 hasConceptScore W2000795897C121332964 @default.
• W2000795897 hasConceptScore W2000795897C121745418 @default.
• W2000795897 hasConceptScore W2000795897C12554922 @default.
• W2000795897 hasConceptScore W2000795897C129312508 @default.
• W2000795897 hasConceptScore W2000795897C14228908 @default.
• W2000795897 hasConceptScore W2000795897C178790620 @default.
• W2000795897 hasConceptScore W2000795897C185592680 @default.
• W2000795897 hasConceptScore W2000795897C192468462 @default.
• W2000795897 hasConceptScore W2000795897C2778301229 @default.
• W2000795897 hasConceptScore W2000795897C2778951431 @default.
• W2000795897 hasConceptScore W2000795897C41625074 @default.
• W2000795897 hasConceptScore W2000795897C512185932 @default.
• W2000795897 hasConceptScore W2000795897C552990157 @default.
• W2000795897 hasConceptScore W2000795897C55493867 @default.
• W2000795897 hasConceptScore W2000795897C62520636 @default.
• W2000795897 hasConceptScore W2000795897C71240020 @default.
• W2000795897 hasConceptScore W2000795897C75473681 @default.
• W2000795897 hasConceptScore W2000795897C86803240 @default.
• W2000795897 hasConceptScore W2000795897C91881484 @default.
• W2000795897 hasIssue "1" @default.
• W2000795897 hasLocation W20007958971 @default.
• W2000795897 hasLocation W20007958972 @default.
• W2000795897 hasOpenAccess W2000795897 @default.
• W2000795897 hasPrimaryLocation W20007958971 @default.
• W2000795897 hasRelatedWork W1970032998 @default.
• W2000795897 hasRelatedWork W1990704226 @default.
• W2000795897 hasRelatedWork W2008627400 @default.
• W2000795897 hasRelatedWork W2012600810 @default.
• W2000795897 hasRelatedWork W2026289228 @default.
• W2000795897 hasRelatedWork W2045183561 @default.
• W2000795897 hasRelatedWork W2088314087 @default.

• next