FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000799608> ?p ?o ?g. }

• W2000799608 endingPage "5359" @default.
• W2000799608 startingPage "5353" @default.
• W2000799608 abstract "Myosin-binding protein-C (MyBP-C) is a component of all striated-muscle sarcomeres, with a well established structural role and a possible function for force regulation. Multiple mutations within the gene for cardiac MyBP-C, one of three known isoforms, have been linked to familial hypertrophic cardiomyopathy. Here we generated a knock-in mouse model that carries N-terminal-shortened cardiac MyBP-C. The mutant protein was designed to have a similar size as the skeletal MyBP-C isoforms, whereas known myosin and titin binding sites as well as the phosphorylatable MyBP-C motif were not altered. We have shown that mutant cardiac MyBP-C is readily incorporated into the sarcomeres of both heterozygous and homozygous animals and can still be phosphorylated by cAMP-dependent protein kinase. Although histological characterization of wild-type and mutant hearts did not reveal obvious differences in phenotype, left ventricular fibers from homozygous mutant mice exhibited an increased Ca2+ sensitivity of force development, particularly at lower Ca2+concentrations, whereas maximal active force levels remained unchanged. The results allow us to propose a model of how cMyBP-C may affect myosin-head mobility and to rationalize why N-terminal mutations of the protein in some cases of familial hypertrophic cardiomyopathy could lead to a hypercontractile state. Myosin-binding protein-C (MyBP-C) is a component of all striated-muscle sarcomeres, with a well established structural role and a possible function for force regulation. Multiple mutations within the gene for cardiac MyBP-C, one of three known isoforms, have been linked to familial hypertrophic cardiomyopathy. Here we generated a knock-in mouse model that carries N-terminal-shortened cardiac MyBP-C. The mutant protein was designed to have a similar size as the skeletal MyBP-C isoforms, whereas known myosin and titin binding sites as well as the phosphorylatable MyBP-C motif were not altered. We have shown that mutant cardiac MyBP-C is readily incorporated into the sarcomeres of both heterozygous and homozygous animals and can still be phosphorylated by cAMP-dependent protein kinase. Although histological characterization of wild-type and mutant hearts did not reveal obvious differences in phenotype, left ventricular fibers from homozygous mutant mice exhibited an increased Ca2+ sensitivity of force development, particularly at lower Ca2+concentrations, whereas maximal active force levels remained unchanged. The results allow us to propose a model of how cMyBP-C may affect myosin-head mobility and to rationalize why N-terminal mutations of the protein in some cases of familial hypertrophic cardiomyopathy could lead to a hypercontractile state. myosin-binding protein-C polymerase chain reaction reverse transcriptase PCR thymidine kinase embryonic stem cell familial hypertrophic cardiomyopathy kilobases Myosin-binding protein-C (MyBP-C)1 (1Offer G. Moos C. Starr R. J. Mol. Biol. 1973; 74: 653-676Crossref PubMed Scopus (494) Google Scholar, 2Yamamoto K. Moos C. J. Biol. Chem. 1983; 258: 8395-8401Abstract Full Text PDF PubMed Google Scholar) is a myofibrillar protein that contributes to the structural integrity of the sarcomere and possibly is involved in the regulation of contraction (3Winegrad S. Circ. Res. 1999; 84: 1117-1126Crossref PubMed Scopus (129) Google Scholar). Three different isoforms of MyBP-C have been identified: skeletal (sMyBP-C), fast and slow, and a cardiac-specific variant (cMyBP-C, see Fig. 1 A), each of these being coded for by a distinct gene (4Weber F.E. Vaughan K.T. Okagaki T. Reinach F.C. Fischman D.A. Eur. J. Biochem. 1993; 216: 661-669Crossref PubMed Scopus (102) Google Scholar, 5Carrier L. Bonne G. Bahrend E., Yu, B. Richard P. Niel F. Hainque B. Cruaud C. Gary F. Labeit S. Bouhour J.B. Dubourg O. Desnos M. Hagege A.A. Trent R.J. Komajda M. Fiszman M. Schwartz K. Circ. Res. 1997; 80: 427-434Crossref PubMed Scopus (219) Google Scholar). All isoforms interact at the C terminus with the rod portion of myosin (e.g. Ref. 6Alyonycheva T.N. Mikawa T. Reinach F.C. Fischman D.A. J. Biol. Chem. 1997; 272: 20866-20872Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar), as well as with titin (e.g. Ref. 7Freiburg A. Gautel M. Eur. J. Biochem. 1996; 235: 317-323Crossref PubMed Scopus (226) Google Scholar), and thus help maintain an ordered thick-filament structure (reviewed in Ref. 3Winegrad S. Circ. Res. 1999; 84: 1117-1126Crossref PubMed Scopus (129) Google Scholar). MyBP-Cs are modular polypeptides that belong to the intracellular immunoglobulin (Ig) superfamily. Whereas the skeletal variants consist of 10 globular domains of the Ig-like or fibronectin-type-III-like fold (4Weber F.E. Vaughan K.T. Okagaki T. Reinach F.C. Fischman D.A. Eur. J. Biochem. 1993; 216: 661-669Crossref PubMed Scopus (102) Google Scholar), cMyBP-C contains an additional N-terminal Ig module termed C0 (5Carrier L. Bonne G. Bahrend E., Yu, B. Richard P. Niel F. Hainque B. Cruaud C. Gary F. Labeit S. Bouhour J.B. Dubourg O. Desnos M. Hagege A.A. Trent R.J. Komajda M. Fiszman M. Schwartz K. Circ. Res. 1997; 80: 427-434Crossref PubMed Scopus (219) Google Scholar). Between the Ig domains C1 and C2, MyBP-Cs also contain a stretch of about 100 residues, the MyBP-C motif (see Fig. 1 A), which in cardiac muscle can be phosphorylated at three sites by cAMP-dependent protein kinase (8Gautel M. Zuffardi O. Freiburg A. Labeit S. EMBO J. 1995; 14: 1952-1960Crossref PubMed Scopus (330) Google Scholar). The MyBP-C motif was shown to bind to the S-2 segment of myosin, close to the lever arm domain of the myosin head (9Gruen M. Gautel M. J. Mol. Biol. 1999; 286: 933-949Crossref PubMed Scopus (201) Google Scholar). Interestingly, this interaction is dynamically regulated by phosphorylation/dephosphorylation of the MyBP-C motif (10Gruen M. Prinz H. Gautel M. FEBS Lett. 1999; 453: 254-259Crossref PubMed Scopus (161) Google Scholar). Moreover, the controlled interaction with the myosin hinge region appears to affect the contractile behavior of muscle fibers (11Kunst G. Kress K.R. Gruen M. Uttenweiler D. Gautel M. Fink R.H.A. Circ. Res. 2000; 86: 51-58Crossref PubMed Scopus (181) Google Scholar) and thus, could represent a potential regulatory mechanism of contractility (12Winegrad S. Circ. Res. 2000; 86: 6-7Crossref PubMed Scopus (42) Google Scholar). These insights notwithstanding, direct evidence for a role of cMyBP-C in force regulation has been difficult to obtain. Uncovering the functions of cMyBP-C is interesting from a clinical point of view as the protein is involved in the pathophysiology of familial hypertrophic cardiomyopathy (FHC, Refs. 13Watkins H. Conner D. Thierfelder L. Jarcho J.A. MacRae C. McKenna W.J. Maron B.J. Seidman J.G. Seidman C.E. Nat. Genet. 1995; 11: 434-437Crossref PubMed Scopus (479) Google Scholar, 14Bonne G. Carrier L. Richard P. Hainque B. Schwartz K. Circ. Res. 1998; 83: 580-593Crossref PubMed Scopus (304) Google Scholar). This inherited disease occurs in autosomal-dominant fashion and affects ∼0.2% of the general population. FHC is known to be a disease of the sarcomere; mutations in at least eight different sarcomeric protein genes have been identified as yet (14Bonne G. Carrier L. Richard P. Hainque B. Schwartz K. Circ. Res. 1998; 83: 580-593Crossref PubMed Scopus (304) Google Scholar, 15Mogensen J. Klausen I.C. Pedersen A.K. Egeblad H. Bross P. Kruse T.A. Gregersen N. Hansen P.S. Baandrup U. Borglum A.D. J. Clin. Invest. 1999; 103: R39-43Crossref PubMed Scopus (344) Google Scholar). Mutations incMYBPC account for ∼15–20% of genetically defined FHC cases, but the cMyBP-C-linked types of FHC present as relatively benign phenotypes with mild hypertrophy at mid-life (16Niimura H. Bachinski L.L. Sangwatanaroj S. Watkins H. Chudley A.E. McKenna W. Kristinsson A. Roberts R. Sole M. Maron B.J. Seidman J.G. Seidman C.E. N. Engl. J. Med. 1998; 338: 1248-1257Crossref PubMed Scopus (617) Google Scholar, 17Charron P. Dubourg O. Desnos M. Bennaceur M. Carrier L. Camproux A.C. Isnard R. Hagege A. Langlard J.M. Bonne G. Richard P. Hainque B. Bouhour J.B. Schwartz K. Komajda M. Circulation. 1998; 97: 2230-2236Crossref PubMed Scopus (215) Google Scholar). Most cMyBP-C lesions show C-terminal truncated polypeptides lacking either the myosin or myosin and titin binding sites, but some lesions are also caused by missense mutations occurring in more N-terminal regions of the protein (16Niimura H. Bachinski L.L. Sangwatanaroj S. Watkins H. Chudley A.E. McKenna W. Kristinsson A. Roberts R. Sole M. Maron B.J. Seidman J.G. Seidman C.E. N. Engl. J. Med. 1998; 338: 1248-1257Crossref PubMed Scopus (617) Google Scholar). Genetical engineering approaches have been used to generate transgenic mice lacking variable numbers of C-terminal domains of cMyBP-C (18Yang Q. Sanbe A. Osinska H. Hewett T.E. Klevitsky R. Robbins J. J. Clin. Invest. 1998; 102: 1292-1300Crossref PubMed Scopus (155) Google Scholar, 19Yang Q. Sanbe A. Osinska H. Hewett T.E. Klevitsky R Robbins J. Circ. Res. 1999; 85: 841-847Crossref PubMed Scopus (83) Google Scholar, 20McConnell B.K. Jones K.A. Fatkin D. Arroyo L.H. Lee R.T. Aristizabal O. Turnbull D.H. Georgakopoulos D. Kass D. Bond M. Niimura H. Schoen F.J. Conner D. Fischman D.A. Seidman C.E. Seidman J.G. J. Clin. Invest. 1999; 104: 1235-1244Crossref PubMed Scopus (200) Google Scholar). These model systems have demonstrated the importance of the C terminus of cMyBP-C for a regular sarcomeric structure and normal contractility of the heart. In the present study we used knock-out/knock-in technology to generate mice (hereafter termed knock-in mice) with N-terminal deletion of a region of cMyBP-C comprising one Ig domain and a linker sequence next to the MyBP-C motif. The shortened cMyBP-C (see Fig. 1 A) thus has a domain structure similar to that of sMyBP-C. Notably, within the region affected by the knock-in, a missense mutation has been described for a family of FHC patients exhibiting a distinct phenotype (16Niimura H. Bachinski L.L. Sangwatanaroj S. Watkins H. Chudley A.E. McKenna W. Kristinsson A. Roberts R. Sole M. Maron B.J. Seidman J.G. Seidman C.E. N. Engl. J. Med. 1998; 338: 1248-1257Crossref PubMed Scopus (617) Google Scholar). We show that the cMyBP-C deletion variant is expressed in both homozygous and heterozygous mice at the protein level and is readily incorporated into the sarcomere. Animals carrying the deletion are viable, show no significant ultrastructural changes of the heart, and appear to have a normal life span. Mutated cMyBP-C could still be phosphorylated by cAMP-dependent protein kinase, but skinned muscle fibers from homozygous mutant hearts revealed a leftward shift in the force-pCa curve and a decreased slope of that curve. The increased Ca2+ sensitivity may result from decreased steric hindrance of myosin-head mobility caused by the expression of the shorter cMyBP-C. We discuss the possibility that the additional N-terminal Ig domain present in cardiac versus skeletal MyBP-C could be included by nature to aid force regulation at the cross-bridge level in the heart. Our findings also provide a starting point to explain the development of hypertrophied cardiac tissue in FHC cases with N-terminal mutations of cMyBP-C. A P1 clone containing the murine cardiac MYBP-C sequence was obtained from a mouse 129 P1 genomic library (Genome Systems, St. Louis, MO). A 9.1-kb Eco RI fragment from the P1 clone was isolated and subcloned and found to contain the 5′-end of the gene from exon 1–20 (Fig. 1 B). A 1.7-kbStu I/Eco RV fragment (including exon 2) located upstream of exon 3 and a 5.3-kb NsiI/Eco RI fragment (including exon 7–20) located downstream of exon 6 were used as the 5′ and 3′ homology units. The targeting vector was constructed by standard recombinant techniques. A genomic fragment of the MYBP-C gene (1.3 kb) including exons 3–6 was deleted and replaced by a neomycin resistance gene (Fig. 1 B). The vector contained a herpes simplex thymidine kinase cassette for negative selection of single recombinant embryonic stem (ES) cell clones. Also, the vector included a uniqueCla I restriction site for linearization of the plasmid. Homologous recombination between targeting vector and cognate cMyBP-C locus deleted exons 3–6. Colony selection and target clone identification were done as described elsewhere (21Schmidt C. Bladt F. Goedecke S. Brinkmann V. Zschiesche W. Sharpe M. Gherardi E. Birchmeier C. Nature. 1995; 373: 699-702Crossref PubMed Scopus (1231) Google Scholar). Targeting vector (20 μg) was introduced into 1.2 × 107 ES cells by electroporation. Genomic DNA was prepared as described (22Ramirez-Solis R. Rivera-Perez J. Wallace J.D. Wims M. Zheng H. Bradley A. Anal. Biochem. 1992; 201: 331-335Crossref PubMed Scopus (176) Google Scholar). Correct targeting of G418-resistant clones was analyzed by Southern blotting. Clones were subsequently tested by long PCR assay (Combi Pol/InViTek, Berlin-Buch). To check for the occurrence of new recognition sites on the amplificates, Southern blotting was employed. Correctly targeted clones were microinjected into C57/BL 6 blastocysts, which were implanted into pseudo-pregnant CB6 mice bred to produce heterozygous or homozygous mutant animals. MyBP-C mRNA was assessed by nucleotide sequence analysis of RT-PCR-amplified DNA fragments according to standard protocols. The following primer pairs were used: CF 198, GGCTGAGACGGAGCGGTCAGGCG; CR 558, GTCATCAGGGGCTCCCTGATGCTCTGCAGC; CF 198, GGCTGAGACGGAGCGGTCAGGCG; CR1134, CGAAGGTCTGTGACTCCGTGCTGG; CF3923, CAGGATGGCTCCCCAGAGATGGCT; and CR4195, GCTCCTACACAATGAGCCAGCCAG. Northern blotting of cardiac/skeletal-muscle RNA was performed as described previously (23Krämer J. Aguirre-Arteta A.M. Thiel C. Gross M. Dietz R. Cardoso M.C. Leonhardt H. J. Mol. Med. 1999; 77: 294-298Crossref PubMed Scopus (49) Google Scholar). Excised hearts were rinsed in 4% paraformaldehyde and weighed, and cardiac tissue was examined for pathological alterations (24McKenna W.J. Stewart J.T. Nihoyannopoulos P. McGinty F. Davies M.J. Br. Heart J. 1990; 63: 287-290Crossref PubMed Scopus (137) Google Scholar). Examined parameters included heart weight, left ventricular wall thickness and cavity size, and myocyte nuclear size (measured by outlining the nucleus in 150 cardiac cells cut in their long axis). Bundles of myofibrils prepared from left ventricle essentially as described (25Linke W.A. Rudy D.E. Centner T. Gautel M. Witt C. Labeit S. Gregorio C.C. J. Cell Biol. 1999; 146: 631-644Crossref PubMed Scopus (198) Google Scholar) were examined under a Zeiss Axiovert 135 microscope. MyBP-C was visualized by using antibodies against the MyBP-C motif (25Linke W.A. Rudy D.E. Centner T. Gautel M. Witt C. Labeit S. Gregorio C.C. J. Cell Biol. 1999; 146: 631-644Crossref PubMed Scopus (198) Google Scholar). Freshly excised mouse hearts were perfused retrogradely through the aorta with 4 °C rigor buffer (mM: NaCl, 132; KCl, 5; MgCl2, 1; glucose, 7;N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid, 10; pH 7.0; EGTA, 5; leupeptin, 0.1; and 2,3-butanedione monoxime (BDM, Ref. 20McConnell B.K. Jones K.A. Fatkin D. Arroyo L.H. Lee R.T. Aristizabal O. Turnbull D.H. Georgakopoulos D. Kass D. Bond M. Niimura H. Schoen F.J. Conner D. Fischman D.A. Seidman C.E. Seidman J.G. J. Clin. Invest. 1999; 104: 1235-1244Crossref PubMed Scopus (200) Google Scholar) for 2 min. Papillary muscles or trabeculae from left ventricle were dissected, tied to thin glass rods, and skinned overnight in ice-cold relaxing solution (mM: imidazole, 20; pH 6.8; ATP, 7.5; MgCl2, 10; NaN3, 1; EGTA, 4; leupeptin, 0.1; BDM, 20; total ionic strength, 130) containing 0.25–0.5% Triton X-100 (26Dohet C. Al-Hillawi E. Trayer I.P. Rüegg J.C. FEBS Lett. 1995; 377: 131-134Crossref PubMed Scopus (42) Google Scholar). A relatively low buffer pH used in skinned fiber mechanical studies was reported to be beneficial for the functional preservation of the regulatory system (27Herzig J.W. Köhler G. Pfitzer G. Rüegg J.C. Wölffle G. Pflügers Arch. 1981; 391: 208-212Crossref PubMed Scopus (49) Google Scholar). After washes with fresh relaxing buffer, fiber bundles 150–200 μm thin and 3–4 mm long were mounted isometrically between a position-controlled rigid post and a force transducer (AME AE 801, Horten Electronics, Norway) with nitroacetate glue (26Dohet C. Al-Hillawi E. Trayer I.P. Rüegg J.C. FEBS Lett. 1995; 377: 131-134Crossref PubMed Scopus (42) Google Scholar). Sarcomere length was adjusted to 2.2 μm by laser diffractometry. After removal of BDM and addition of an ATP-regenerating system (creatine phosphate, 10 mm; creatine kinase, 150 units/ml) to the solution, fibers were activated by transfer from relaxing to activating buffer, in which EGTA was substituted by Ca2+-EGTA. The desired Ca2+concentration was calculated as described (26Dohet C. Al-Hillawi E. Trayer I.P. Rüegg J.C. FEBS Lett. 1995; 377: 131-134Crossref PubMed Scopus (42) Google Scholar). Experiments were carried out at room temperature. The normalized force-pCa relationships, in which force was expressed relative to the maximum force usually developed at pCa 4.34, were fitted to the Hill equation,f/fmax=[Ca2+]HC/(Kc+[Ca2+]HC)Equation 1 where HC (the Hill coefficient, a measure of cooperativity) and Kc are constants. Fiber bundles prepared as described above were washed with relaxing solution (ATP, 4 mm). Specimens were incubated with the catalytic subunit of protein kinase A (Sigma, 500 units/ml relaxing buffer) in the presence of [γ-32P]ATP (specific activity, 250 μCi/μm) for 45 min at room temperature (26Dohet C. Al-Hillawi E. Trayer I.P. Rüegg J.C. FEBS Lett. 1995; 377: 131-134Crossref PubMed Scopus (42) Google Scholar, 28Venema R.C. Kuo J.F. J. Biol. Chem. 1993; 268: 2705-2711Abstract Full Text PDF PubMed Google Scholar). Proteins were then denatured, dissolved, and electrophoresed on 8% SDS-polyacrylamide gels. Major myofibrillar proteins were identified by Coomassie staining. 32P incorporation was visualized by autoradiography, using a 4–12-h exposure time with standard Kodak x-ray film (28Venema R.C. Kuo J.F. J. Biol. Chem. 1993; 268: 2705-2711Abstract Full Text PDF PubMed Google Scholar, 29Hofmann P.A. Lange J.H. Circ. Res. 1994; 74: 718-726Crossref PubMed Scopus (83) Google Scholar). To target theMYBP-C gene, a 9.1-kb fragment of the murine cardiac MYBP-C locus encompassing exons 1–20 was isolated and subcloned (Fig.1 B). The targeting construct was designed to selectively remove exons 3–6 (1.3 kb) thus producing a deletion of the Ig domain C1 and the linker region between domains C0 and C1 of cMyBP-C (Fig. 1 A). Fig. 1 B illustrates the cardiac MYBP-C locus and the gene-targeting construct containing a neomycin (NEO) resistance gene and a herpes simplex thymidine kinase cassette (TK) to allow for negative selection. Fig. 1 B (bottom) depicts the cMyBP-C deletion mutant obtained after electroporation of the linearized plasmid into ES cells and homologous recombination between the targeting vector and the cognate MYBP-C locus. Ninety-six G418-resistant ES cell clones were analyzed, and genomic Southern blotting of DNA from ES cell clones was performed to detect the targeting event. Correct targeting was found in 6 clones. As shown in Fig. 2 A, a band corresponding to a 9.1-kb fragment was detected as the wild-type allele, and a band corresponding to a 2.7-kb fragment as the targeted allele. Correctly targeted clones were used for blastocyst-mediated transgenesis and production of chimeric animals. Appropriate breeding produced mice either homozygous or heterozygous for the cMyBP-C deletion. These mice were fertile, produced normal litter sizes, and survived for >1 year. We also tested the correctly targeted clones in a long PCR assay. Primers were designed such that a 2.2-kb fragment was produced specific for the wild-type allele and a 1.9-kb fragment specific for the targeted allele (data not shown). Additionally, a PCR was done with a 4.8-kb product (Fig. 1 B, top). The analysis showed that the restriction enzyme Eco RI cut the amplificate only of the targeted allele into a 2.8 and a 2.0 kb fragment (Fig. 2 B), indicating the introduction of a new recognition site. To determine the expression of cMyBP-C transcripts in mutant mice, we performed RT-PCR analysis with various primer pairs from different regions of heart cDNA (Fig. 2 C). With a primer pair encompassing domains C0 to C1, a signal was obtained only for cDNA from wild-type or heterozygous mice, whereas in homozygous mutant animals, RNA encoding the C1 domain plus N-terminal adjacent linker was not expressed (Fig. 2 C,panel a). This observation is consistent with the results of Northern blot analyses (Fig. 2 D). No signal was detected when total RNA, isolated from homozygous hearts, was hybridized with a C1+linker probe. By contrast, a signal was detectable in heterozygous hearts. In comparison, when skeletal-muscle RNA was used, no signal was present (Fig. 2 D). Hybridization with a probe of the MyBP-C motif revealed a normal signal for heart RNA in all types of animals, but none for skeletal-muscle RNA. Controls with a GAPDH probe showed a signal in all lanes. By RT-PCR, using primer pairs encompassing the C0 domain and the MyBP-C motif, we detected the expected deletion of 474 base pairs (Fig.2 C, panel b). Cloning and sequencing of the products highlighted by the asterisks (Fig. 2 C) revealed that the upper band corresponds to the wild-type DNA sequence, whereas the lower band product has the same flanking sequence but contains the predicted deletion. We note that in competitive PCR, a shorter product tends to show a larger signal than a longer product, as seen in Fig. 2 C, panel b. This figure, as well as the RT-PCR at the 3′-untranslated region (Fig. 2 C,panel c), demonstrate that the transgenic RNA is stable and well expressed; no degradation or lowered expression was detectable. Thus, regulation at the transcription level seems unlikely. Both homozygous and heterozygous mice were found to express the deletion mutant also at the protein level. Western blot analyses with muscle protein obtained from all types of animals revealed a distinct band stained by a polyclonal antibody against the MyBP-C motif (Fig.3 A). Moreover, cardiac myofibrils labeled with fluorophore-marked α-MyBP-C antibodies exhibited the expected staining pattern in the sarcomeric A-band; no obvious difference in staining intensity or regularity of labeling was found between wild-type and homozygous mutant animals (Fig.3 B). Thus, mutant mice stably expressed the shortened cMyBP-C protein. Hearts from several months (up to ∼1 year) old animals (n = 7, for each animal type) were examined for histological and morphological abnormalities (Table I). None of the parameters investigated differed between animal types in a statistically significant manner, although one homozygous mutant heart revealed an abnormal phenotype with strongly increased values for all four parameters. In general, however, no evidence was found for cardiac hypertrophy, myocyte loss or inflammation. Thus, the histological appearance of heterozygous or homozygous mutant hearts appeared to be normal.Table ISummary of results of morphological measurementsHeart weightLV wall thicknessLV cavityMyocyte nuclear sizegmmmmμm2WT0.255 ± 0.0491.09 ± 0.304.09 ± 0.4448.71 ± 15.18+/−0.289 ± 0.0481.17 ± 0.214.49 ± 0.7944.00 ± 14.14−/−0.274 ± 0.0491.16 ± 0.354.31 ± 0.4252.57 ± 13.88Data are presented as mean ± S.D. n = 7 for wildtype (WT), heterozygous mutant (+/−), and homozygous mutant (−/−) hearts. Open table in a new tab Data are presented as mean ± S.D. n = 7 for wildtype (WT), heterozygous mutant (+/−), and homozygous mutant (−/−) hearts. Left ventricular muscle strips obtained from wild-type and mutant, litter-matched, animals were probed for their contractile properties by measuring the active force of skinned fiber bundles as a function of the Ca2+ concentration. Because the Ca2+sensitivity varies with sarcomere length, laser diffractometry was used to set this length to 2.2 μm in all experiments. A typical example demonstrating the force rise with increasing [Ca2+] (i.e. decreasing pCa) is shown in Fig.4, inset. Fibers from 5 wild-type, 2 cMyBP-C(+/−), and 6 cMyBP-C(−/−) mice were included in the analysis, and 5–7 fiber bundles per animal were investigated. A summary of results is presented in Fig. 4. Fibers from wild-type and heterozygous mutant mice exhibited a similar Ca2+ sensitivity of force development, with pCa50 values (pCa at half-maximum force) of 5.19 ± 0.01 S.E. and 5.18 ± 0.01 S.E. and Hill coefficients of 3.14 ± 0.06 S.E. and 3.00 ± 0.05 S.E., respectively. In contrast, homozygous mutant mice showed a statistically significant increase in Ca2+ sensitivity (pCa50 = 5.26 ± 0.02) and a decreased slope of the force-pCa curve (Hill coefficient, 2.32 ± 0.20). Thus, the Ca2+ sensitivity of force generation was particularly increased at low to modest physiological [Ca2+], the concentrations relevant to normally working cardiac muscle. No statistically significant difference was found between animal types with regard to the (absolute) maximum active force levels (p > 0.05 in unpaired Student's t test). This indicates that the increase in relative force observed in the cMyBP-C(−/−) fibers mainly at lower [Ca2+] is not offset by a change in the maximum force level. To find out whether the altered Ca2+ sensitivity could be related to an altered response of the mutant cMyBP-C to activation by cAMP-dependent protein kinase (because the deletion is close to the MyBP-C motif), we tested the ability of the protein to be phosphorylated by this kinase (see Refs. 28Venema R.C. Kuo J.F. J. Biol. Chem. 1993; 268: 2705-2711Abstract Full Text PDF PubMed Google Scholar, 30Hartzell H.C. Glass D.B. J. Biol. Chem. 1984; 259: 15587-15596Abstract Full Text PDF PubMed Google Scholar, 31Schlender K.K. Bean L.J. J. Biol. Chem. 1991; 266: 2811-2817Abstract Full Text PDF PubMed Google Scholar). As shown in Fig.5, autoradiography of SDS-polyacrylamide gels of left ventricular tissue incubated with the catalytic subunit of cAMK in the presence of [γ-32P]ATP revealed that both wild-type and the homozygous mutant cMyBP-C are phosphorylated to a similar degree (arrowheads in lanes d–g). Thus, the knock-in did not affect the phosphorylation of cMyBP-C, suggesting that the β-adrenergic pathway for this protein based on phosphorylation/dephosphorylation of the MyBP-C motif may still be intact. The structural role of MyBP-C in both skeletal and cardiac myofibrils is well established (1Offer G. Moos C. Starr R. J. Mol. Biol. 1973; 74: 653-676Crossref PubMed Scopus (494) Google Scholar, 2Yamamoto K. Moos C. J. Biol. Chem. 1983; 258: 8395-8401Abstract Full Text PDF PubMed Google Scholar, 3Winegrad S. Circ. Res. 1999; 84: 1117-1126Crossref PubMed Scopus (129) Google Scholar, 4Weber F.E. Vaughan K.T. Okagaki T. Reinach F.C. Fischman D.A. Eur. J. Biochem. 1993; 216: 661-669Crossref PubMed Scopus (102) Google Scholar, 5Carrier L. Bonne G. Bahrend E., Yu, B. Richard P. Niel F. Hainque B. Cruaud C. Gary F. Labeit S. Bouhour J.B. Dubourg O. Desnos M. Hagege A.A. Trent R.J. Komajda M. Fiszman M. Schwartz K. Circ. Res. 1997; 80: 427-434Crossref PubMed Scopus (219) Google Scholar, 6Alyonycheva T.N. Mikawa T. Reinach F.C. Fischman D.A. J. Biol. Chem. 1997; 272: 20866-20872Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 7Freiburg A. Gautel M. Eur. J. Biochem. 1996; 235: 317-323Crossref PubMed Scopus (226) Google Scholar); the C terminus of the protein, providing binding sites for myosin and titin, is essential for the formation and regular structure of thick filaments. Accordingly, C-terminal truncations of cardiac MyBP-C result in severe changes in heart ultrastructure and impaired cardiac mechanical performance, both in transgenic mouse models (18Yang Q. Sanbe A. Osinska H. Hewett T.E. Klevitsky R. Robbins J. J. Clin. Invest. 1998; 102: 1292-1300Crossref PubMed Scopus (155) Google Scholar, 19Yang Q. Sanbe A. Osinska H. Hewett T.E. Klevitsky R Robbins J. Circ. Res. 1999; 85: 841-847Crossref PubMed Scopus (83) Google Scholar, 20McConnell B.K. Jones K.A. Fatkin D. Arroyo L.H. Lee R.T. Aristizabal O. Turnbull D.H. Georgakopoulos D. Kass D. Bond M. Niimura H. Schoen F.J. Conner D. Fischman D.A. Seidman C.E. Seidman J.G. J. Clin. Invest. 1999; 104: 1235-1244Crossref PubMed Scopus (200) Google Scholar) and in FHC-affected humans (14Bonne G. Carrier L. Richard P. Hainque B. Schwartz K. Circ. Res. 1998; 83: 580-593Crossref PubMed Scopus (304) Google Scholar,16Niimura H. Bachinski L.L. Sangwatanaroj S. Watkins H. Chudley A.E. McKenna W. Kristinsson A. Roberts R. Sole M. Maron B.J. Seidman J.G. Seidman C.E. N. Engl. J. Med. 1998; 338: 1248-1257Crossref PubMed Scopus (617) Google Scholar). It is perhaps not surprising that, of the about 30 mutations in the gene for cMyBP-C (MYBPC3) so far described in families with FHC, the majority locates to C-terminal domains (14Bonne G. Carrier L. Richard P. Hainque B. Schwartz K. Circ. Res. 1998; 83: 580-593Crossref PubMed Scopus (304) Google Scholar). On the other hand, some mutations also occur in N-terminal regions of the molecule, but in these cases the mechanisms leading to FHC are more difficult to understand. A possibility is that N-terminal domains of cMyBP-C contribute to the regulation of cardiac-muscle contraction. The knock-in mouse model presented here was generated in an attempt to uncover a possible (patho)physiological function of some of the N-terminal cMyBP-C domains. The knock-in was made bearing in mind that the cardiac isoform of MyBP-C is distinguished from the skeletal isoforms by two main features: (i) cMyBP-C contains an additional Ig domain, the C0 module (4Weber F.E. Vaughan K.T. Okagaki T. Reinach" @default.
• W2000799608 created "2016-06-24" @default.
• W2000799608 creator A5010210013 @default.
• W2000799608 creator A5020673249 @default.
• W2000799608 creator A5024193480 @default.
• W2000799608 creator A5045764263 @default.
• W2000799608 creator A5068650860 @default.
• W2000799608 creator A5072697496 @default.
• W2000799608 date "2001-02-01" @default.
• W2000799608 modified "2023-10-16" @default.
• W2000799608 title "Hypercontractile Properties of Cardiac Muscle Fibers in a Knock-in Mouse Model of Cardiac Myosin-binding Protein-C" @default.
• W2000799608 cites W1233659682 @default.
• W2000799608 cites W1496726033 @default.
• W2000799608 cites W1511283545 @default.
• W2000799608 cites W1561692129 @default.
• W2000799608 cites W1795664126 @default.
• W2000799608 cites W1860649637 @default.
• W2000799608 cites W1951189692 @default.
• W2000799608 cites W1965042960 @default.
• W2000799608 cites W1966093898 @default.
• W2000799608 cites W1966368724 @default.
• W2000799608 cites W1968266981 @default.
• W2000799608 cites W1975576902 @default.
• W2000799608 cites W1986889750 @default.
• W2000799608 cites W2006502789 @default.
• W2000799608 cites W2012739369 @default.
• W2000799608 cites W2022527563 @default.
• W2000799608 cites W2032852179 @default.
• W2000799608 cites W2034972644 @default.
• W2000799608 cites W2062047859 @default.
• W2000799608 cites W2067013195 @default.
• W2000799608 cites W2067777371 @default.
• W2000799608 cites W2074732853 @default.
• W2000799608 cites W2083577578 @default.
• W2000799608 cites W2084087656 @default.
• W2000799608 cites W2084747396 @default.
• W2000799608 cites W2088660764 @default.
• W2000799608 cites W2092771760 @default.
• W2000799608 cites W2126747143 @default.
• W2000799608 cites W2129357784 @default.
• W2000799608 cites W2134986256 @default.
• W2000799608 cites W2140233227 @default.
• W2000799608 cites W2144060453 @default.
• W2000799608 cites W2158081637 @default.
• W2000799608 cites W2160424655 @default.
• W2000799608 cites W2160900044 @default.
• W2000799608 cites W2164108161 @default.
• W2000799608 cites W2169223381 @default.
• W2000799608 cites W2189307575 @default.
• W2000799608 cites W259174617 @default.
• W2000799608 doi "https://doi.org/10.1074/jbc.m008691200" @default.
• W2000799608 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11096095" @default.
• W2000799608 hasPublicationYear "2001" @default.
• W2000799608 type Work @default.
• W2000799608 sameAs 2000799608 @default.
• W2000799608 citedByCount "68" @default.
• W2000799608 countsByYear W20007996082012 @default.
• W2000799608 countsByYear W20007996082013 @default.
• W2000799608 countsByYear W20007996082014 @default.
• W2000799608 countsByYear W20007996082015 @default.
• W2000799608 countsByYear W20007996082016 @default.
• W2000799608 countsByYear W20007996082018 @default.
• W2000799608 countsByYear W20007996082019 @default.
• W2000799608 countsByYear W20007996082021 @default.
• W2000799608 countsByYear W20007996082022 @default.
• W2000799608 countsByYear W20007996082023 @default.
• W2000799608 crossrefType "journal-article" @default.
• W2000799608 hasAuthorship W2000799608A5010210013 @default.
• W2000799608 hasAuthorship W2000799608A5020673249 @default.
• W2000799608 hasAuthorship W2000799608A5024193480 @default.
• W2000799608 hasAuthorship W2000799608A5045764263 @default.
• W2000799608 hasAuthorship W2000799608A5068650860 @default.
• W2000799608 hasAuthorship W2000799608A5072697496 @default.
• W2000799608 hasBestOaLocation W20007996081 @default.
• W2000799608 hasConcept C104317684 @default.
• W2000799608 hasConcept C105702510 @default.
• W2000799608 hasConcept C12554922 @default.
• W2000799608 hasConcept C153911025 @default.
• W2000799608 hasConcept C182704531 @default.
• W2000799608 hasConcept C185592680 @default.
• W2000799608 hasConcept C2778996579 @default.
• W2000799608 hasConcept C55493867 @default.
• W2000799608 hasConcept C6997183 @default.
• W2000799608 hasConcept C86803240 @default.
• W2000799608 hasConcept C95444343 @default.
• W2000799608 hasConceptScore W2000799608C104317684 @default.
• W2000799608 hasConceptScore W2000799608C105702510 @default.
• W2000799608 hasConceptScore W2000799608C12554922 @default.
• W2000799608 hasConceptScore W2000799608C153911025 @default.
• W2000799608 hasConceptScore W2000799608C182704531 @default.
• W2000799608 hasConceptScore W2000799608C185592680 @default.
• W2000799608 hasConceptScore W2000799608C2778996579 @default.
• W2000799608 hasConceptScore W2000799608C55493867 @default.
• W2000799608 hasConceptScore W2000799608C6997183 @default.
• W2000799608 hasConceptScore W2000799608C86803240 @default.
• W2000799608 hasConceptScore W2000799608C95444343 @default.
• W2000799608 hasIssue "7" @default.
• W2000799608 hasLocation W20007996081 @default.

• next