FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000863691> ?p ?o ?g. }

• W2000863691 endingPage "1285" @default.
• W2000863691 startingPage "1285" @default.
• W2000863691 abstract "The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013." @default.
• W2000863691 created "2016-06-24" @default.
• W2000863691 creator A5009190097 @default.
• W2000863691 creator A5013170420 @default.
• W2000863691 creator A5028711141 @default.
• W2000863691 creator A5036829927 @default.
• W2000863691 creator A5045275188 @default.
• W2000863691 creator A5051286713 @default.
• W2000863691 creator A5068329199 @default.
• W2000863691 creator A5076838041 @default.
• W2000863691 date "2014-09-01" @default.
• W2000863691 modified "2023-10-14" @default.
• W2000863691 title "The First Report of <i>Tomato chlorotic spot virus</i> (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic" @default.
• W2000863691 doi "https://doi.org/10.1094/pdis-04-14-0348-pdn" @default.
• W2000863691 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30699639" @default.
• W2000863691 hasPublicationYear "2014" @default.
• W2000863691 type Work @default.
• W2000863691 sameAs 2000863691 @default.
• W2000863691 citedByCount "12" @default.
• W2000863691 countsByYear W20008636912016 @default.
• W2000863691 countsByYear W20008636912017 @default.
• W2000863691 countsByYear W20008636912018 @default.
• W2000863691 countsByYear W20008636912019 @default.
• W2000863691 countsByYear W20008636912022 @default.
• W2000863691 crossrefType "journal-article" @default.
• W2000863691 hasAuthorship W2000863691A5009190097 @default.
• W2000863691 hasAuthorship W2000863691A5013170420 @default.
• W2000863691 hasAuthorship W2000863691A5028711141 @default.
• W2000863691 hasAuthorship W2000863691A5036829927 @default.
• W2000863691 hasAuthorship W2000863691A5045275188 @default.
• W2000863691 hasAuthorship W2000863691A5051286713 @default.
• W2000863691 hasAuthorship W2000863691A5068329199 @default.
• W2000863691 hasAuthorship W2000863691A5076838041 @default.
• W2000863691 hasBestOaLocation W20008636911 @default.
• W2000863691 hasConcept C109110057 @default.
• W2000863691 hasConcept C144027150 @default.
• W2000863691 hasConcept C159047783 @default.
• W2000863691 hasConcept C2522874641 @default.
• W2000863691 hasConcept C2776242653 @default.
• W2000863691 hasConcept C2776411976 @default.
• W2000863691 hasConcept C2779553184 @default.
• W2000863691 hasConcept C2780504191 @default.
• W2000863691 hasConcept C2780757758 @default.
• W2000863691 hasConcept C2780781446 @default.
• W2000863691 hasConcept C2910476756 @default.
• W2000863691 hasConcept C3018930857 @default.
• W2000863691 hasConcept C59822182 @default.
• W2000863691 hasConcept C86803240 @default.
• W2000863691 hasConceptScore W2000863691C109110057 @default.
• W2000863691 hasConceptScore W2000863691C144027150 @default.
• W2000863691 hasConceptScore W2000863691C159047783 @default.
• W2000863691 hasConceptScore W2000863691C2522874641 @default.
• W2000863691 hasConceptScore W2000863691C2776242653 @default.
• W2000863691 hasConceptScore W2000863691C2776411976 @default.
• W2000863691 hasConceptScore W2000863691C2779553184 @default.
• W2000863691 hasConceptScore W2000863691C2780504191 @default.
• W2000863691 hasConceptScore W2000863691C2780757758 @default.
• W2000863691 hasConceptScore W2000863691C2780781446 @default.
• W2000863691 hasConceptScore W2000863691C2910476756 @default.
• W2000863691 hasConceptScore W2000863691C3018930857 @default.
• W2000863691 hasConceptScore W2000863691C59822182 @default.
• W2000863691 hasConceptScore W2000863691C86803240 @default.
• W2000863691 hasIssue "9" @default.
• W2000863691 hasLocation W20008636911 @default.
• W2000863691 hasLocation W20008636912 @default.
• W2000863691 hasOpenAccess W2000863691 @default.
• W2000863691 hasPrimaryLocation W20008636911 @default.
• W2000863691 hasRelatedWork W1590611070 @default.
• W2000863691 hasRelatedWork W2000863691 @default.
• W2000863691 hasRelatedWork W2001279500 @default.
• W2000863691 hasRelatedWork W2060628600 @default.
• W2000863691 hasRelatedWork W2062698316 @default.
• W2000863691 hasRelatedWork W2067470244 @default.
• W2000863691 hasRelatedWork W2073139669 @default.
• W2000863691 hasRelatedWork W2080064023 @default.
• W2000863691 hasRelatedWork W2583598778 @default.
• W2000863691 hasRelatedWork W4220951442 @default.
• W2000863691 hasVolume "98" @default.
• W2000863691 isParatext "false" @default.
• W2000863691 isRetracted "false" @default.
• W2000863691 magId "2000863691" @default.
• W2000863691 workType "article" @default.