FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000907546> ?p ?o ?g. }

• W2000907546 endingPage "32930" @default.
• W2000907546 startingPage "32925" @default.
• W2000907546 abstract "The PCD1 nudix hydrolase gene ofSaccharomyces cerevisiae has been cloned and the Pcd1p protein characterized as a diphosphatase (pyrophosphatase) with specificity for coenzyme A and CoA derivatives. Oxidized CoA disulfide is preferred over CoA as a substrate with K m andk cat values of 24 μm and 5.0 s−1, respectively, compared with values for CoA of 280 μm and 4.6 s−1respectively. The products of CoA hydrolysis were 3′-phosphoadenosine 5′-monophosphate and 4′-phosphopantetheine. F− ions inhibited the activity with an IC50 of 22 μm. The sequence of Pcd1p contains a potential PTS2 peroxisomal targeting signal. When fused to the N terminus of yeast-enhanced green fluorescent protein, Pcd1p was shown to locate to peroxisomes by confocal microscopy. It was also shown to co-localize with peroxisomal thiolase by immunofluorescence microscopy. N-terminal sequence analysis of the expressed protein revealed the loss of 7 or 8 amino acids, suggesting processing of the proposed PTS2 signal after import. The function of Pcd1p may be to remove potentially toxic oxidized CoA disulfide from peroxisomes in order to maintain the capacity for β-oxidation of fatty acids. The PCD1 nudix hydrolase gene ofSaccharomyces cerevisiae has been cloned and the Pcd1p protein characterized as a diphosphatase (pyrophosphatase) with specificity for coenzyme A and CoA derivatives. Oxidized CoA disulfide is preferred over CoA as a substrate with K m andk cat values of 24 μm and 5.0 s−1, respectively, compared with values for CoA of 280 μm and 4.6 s−1respectively. The products of CoA hydrolysis were 3′-phosphoadenosine 5′-monophosphate and 4′-phosphopantetheine. F− ions inhibited the activity with an IC50 of 22 μm. The sequence of Pcd1p contains a potential PTS2 peroxisomal targeting signal. When fused to the N terminus of yeast-enhanced green fluorescent protein, Pcd1p was shown to locate to peroxisomes by confocal microscopy. It was also shown to co-localize with peroxisomal thiolase by immunofluorescence microscopy. N-terminal sequence analysis of the expressed protein revealed the loss of 7 or 8 amino acids, suggesting processing of the proposed PTS2 signal after import. The function of Pcd1p may be to remove potentially toxic oxidized CoA disulfide from peroxisomes in order to maintain the capacity for β-oxidation of fatty acids. nucleoside diphosphate linked to another moiety, X 5′-ADP, 3′-phosphoadenosine 5′-monophosphate coenzyme A disulfide mixed disulfide of coenzyme A and 4′-phosphopantetheine dithiothreitol yeast-enhanced green fluorescent protein open reading frame synthetic complete medium without uracil polymerase chain reaction The nudix1 hydrolases are members of a phylogenetically widespread enzyme family that hydrolyze predominantly the diphosphate (pyrophosphate) linkage in a variety of nucleoside triphosphates, dinucleoside polyphosphates, nucleotide sugars, and related compounds having the general structure of a nucleoside diphosphate linked to another moiety, X (1Bessman M.J. Frick D.N. O'Handley S.F. J. Biol. Chem. 1996; 271: 25059-25062Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar, 2McLennan A.G. Int. J. Mol. Med. 1999; 4: 79-89PubMed Google Scholar). They all possess the nudix box sequence signature motif GX 5EX 5(UA)XRE(UA)XEEXGU (where U is a hydrophobic amino acid), formerly known as the MutT motif (1Bessman M.J. Frick D.N. O'Handley S.F. J. Biol. Chem. 1996; 271: 25059-25062Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar, 3Koonin E.V. Nucleic Acids Res. 1993; 21: 4847Crossref PubMed Scopus (99) Google Scholar). The functions proposed for members of this protein family are to cleanse the cell of potentially deleterious endogenous nucleotide metabolites and to modulate the accumulation of metabolic intermediates by diverting them into alternative pathways in response to biochemical need (1Bessman M.J. Frick D.N. O'Handley S.F. J. Biol. Chem. 1996; 271: 25059-25062Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar). Genome sequencing studies show that the number of nudix hydrolases varies from 0 in Mycoplasma genitalium (4Fraser C.M. Gocayne J.D. White O. Adams M.D. Clayton R.A. Fleischmann R.D. Bult C.J. Kerlavage A.R. Sutton G. Kelley J.M. Fritchman J.L. Weidman J.F. Small K.V. Sandusky M. Fuhrmann J. Nguyen D. Utterback T.R. Saudek D.M. Phillips C.A. Merrick J.M. Tomb J.F. Dougherty B.A. Bott K.F. Hu P.C. Lucier T.S. Peterson S.N. Smith H.O. Hutchison C.A. Venter J.C. Science. 1995; 270: 397-403Crossref PubMed Scopus (2119) Google Scholar) to 24 inDeinococcus radiodurans (5White O. Eisen J.A. Heidelberg J.F. Hickey E.K. Peterson J.D. Dodson R.J. Haft D.H. Gwinn M.L. Nelson W.C. Richardson D.L. Moffat K.S. Qin H.Y. Jiang L.X. Pamphile W. Crosby M. Shen M. Vamathevan J.J. Lam P. McDonald L. Utterback T. Zalewski C. Makarova K.S. Aravind L. Daly M.J. Minton K.W. Fleischmann R.D. Ketchum K.A. Nelson K.E. Salzberg S. Smith H.O. Venter J.C. Fraser C.M. Science. 1999; 286: 1571-1577Crossref PubMed Scopus (797) Google Scholar), whereas cDNA sequencing reveals at least 15 family members in mammalian cells. The budding yeast Saccharomyces cerevisiae has genes for five nudix hydrolases. YSA1 (ORF YBR111C) encodes a 26-kDa ADP-sugar diphosphatase 2The term “diphosphatase” is used here instead of “pyrophosphatase” in line with the expected recommendation of the IUPAC-IUB Commission on Biochemical Nomenclature. (1Bessman M.J. Frick D.N. O'Handley S.F. J. Biol. Chem. 1996; 271: 25059-25062Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar),NPY1 (ORF YGL067W) encodes a 43.5- kDa NADH diphosphatase 3S. R. Abdel Raheim and A. G. McLennan, unpublished observations. (6Xu W. Dunn C.A. Bessman M.J. Biochem. Biophys. Res. Commun. 2000; 273: 753-758Crossref PubMed Scopus (35) Google Scholar),PSU1 (DCP2, ORF YNL118C) encodes a 109-kDa protein with an N-terminal nudix hydrolase domain whose enzymic activity is as yet undetermined but which may be involved in both transcriptional activation (7Gaudon C. Chambon P. Losson R. EMBO J. 1999; 18: 2229-2240Crossref PubMed Scopus (33) Google Scholar) and mRNA decapping (8Dunckley T. Parker R. EMBO J. 1999; 18: 5411-5422Crossref PubMed Scopus (270) Google Scholar), whileDDP1 (ORF YOR163W) encodes a 21.5-kDa enzyme that is a member of a unique subgroup of nudix hydrolases that can hydrolyze both diadenosine polyphosphates and non-nudix diphosphoinositol polyphosphate substrates (9Cartwright J.L. McLennan A.G. J. Biol. Chem. 1999; 274: 8604-8610Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 10Safrany S.T. Ingram S.W. Cartwright J.L. Falck J.R. McLennan A.G. Barnes L.D. Shears S.B. J. Biol. Chem. 1999; 274: 21735-21740Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Here we show that the fifth S. cerevisiae nudix hydrolase gene, PCD1 (ORF YLR151C) on chromosome XII, encodes a protein with an entirely new enzyme activity: a peroxisomal coenzyme Adiphosphatase, Pcd1p, that cleaves 3′-phosphoadenosine 5′-monophosphate (3′,5′-ADP) from coenzyme A and CoA derivatives. Oxidized CoA disulfide (CoASSCoA) is preferred to CoA as a substrate. Pcd1p also appears to be only the second documented S. cerevisiae protein to have an N-terminal PTS2 peroxisomal targeting signal. S. cerevisiae strain INVSc1 (MATα, his3-D1, leu2, trp1–289, ura3–52) was from Invitrogen. All nucleotides and nucleotide derivatives were from Sigma. Calf intestinal alkaline phosphatase, yeast inorganic pyrophosphatase, and restriction enzymes were from Roche Molecular Biochemicals. The Escherichia coli expression vector, pET 17b(+) was from Novagen, and the pPGY1 yeast centromere vector was a gift from L.D. Barnes. Rhodamine B hexyl ester was from Molecular Probes. Rhodamine-conjugated goat anti-rabbit IgG was from Santa Cruz Biotechnology. The yeast-enhanced green fluorescent protein (yEGFP) fusion vectors pUG35 and pUG36 were a gift from J. H. Hegemann. A rabbit polyclonal antibody to yeast 3-oxoacyl-CoA thiolase (Fox3p) was kindly donated by W.-H Kunau. The PCD1 coding region was amplified from genomic DNA using the polymerase chain reaction and the 36-mer oligonucleotide forward and reverse primers d(AGAAAAGAATTCATGATATTAAGTCAGAGGAGGATG) and d(ATCTCTCTCGAGTATTGTTAGGCAACGCATTATACC). The synthesized primers provided an EcoRI restriction site at the start of the amplified ORF and a XhoI site at the end. After amplification with Pfu DNA polymerase (Stratagene), the DNA was recovered by phenol/chloroform extraction, digested withEcoRI and XhoI, and the gel-purified restriction fragment ligated between the EcoRI and XhoI sites of both pET17b(+) and pPGY1. The resulting pET151C construct (from pET17b) yielded an N-terminal fusion of the T7 tag sequence and Pcd1p under the control of the T7 promoter while the pPGY151C construct (from pPGY1) generated the ATG initiator downstream of GAL1p, a galactose-inducible promoter, and yielded native Pcd1p when expressed in yeast. Both plasmids were used to transform E. coliXL1-Blue cells for propagation. E. coli strain BL21(DE3) was transformed with pET151C. A single colony was picked from an LB agar plate containing 60 μg/ml ampicillin and inoculated into 10 ml of LB medium containing 60 μg/ml ampicillin. After overnight growth, the cells were transferred to 1 liter LB medium containing 60 μg/ml ampicillin and grown to anA 600 of 0.6. Isopropyl-1-thio-β-d-galactopyranoside was added to 0.4 mm and the cells induced for 4 h. The induced cells (4.2 g) were harvested, washed, and resuspended in 50 ml of sonication buffer (50 mm Tris-HCl, pH 8.0, 2 mm EDTA, 0.1m NaCl). The cell suspension was sonicated and the inclusion bodies recovered by centrifugation at 10,000 ×g for 20 min. After washing by resuspension in sonication buffer containing 2.5 m urea, the inclusion bodies were dispersed in 27 ml of 25 mm Tris-HCl, pH 8.0, 8m urea, 10 mm dithiothreitol (DTT) and the extract centrifuged at 100,000 × g for 1 h. The supernatant was applied in 1-ml aliquots to a Mono Q HR 5/5 anion exchange column (Amersham Pharmacia Biotech) previously equilibrated in Buffer A (25 mm Tris-HCl, pH 8.0, 6 m urea) and the protein eluted with a linear gradient from 0 to 0.5 mNaCl in Buffer A. Homogeneous Pcd1p eluted at 0.27 m NaCl. Fractions containing the protein were dialyzed extensively against phosphate-buffered saline and used to generate a rabbit anti-Pcd1p polyclonal antiserum by standard procedures. S. cerevisiae strain INVScI was transformed with pPGY151C. A single colony was picked from an SC-Ura (synthetic complete medium without uracil) agar plate and inoculated into 40 ml of SC-Ura medium supplemented with 5% glucose. After 36 h the cells were harvested by centrifugation and resuspended in 4 liters of SC-Ura + 5% glucose and grown for another 24 h. The cells were again recovered by centrifugation, resuspended in 4 liters of SC-Ura + 2% galactose, 1% raffinose, and grown for 24 h to fully induce expression of Pcd1p. The induced cells (26.84 g) were harvested, washed, and resuspended in 50 ml of breakage buffer (50 mm Tris-HCl, pH 7.5, 2 mm EDTA, 50 mm NaCl, 10 mm2-mercaptoethanol, 1 mm phenylmethylsulfonyl fluoride, 5 μm trans-epoxysuccinyl-l-leucylamido-(4-guanidino)butane, 1 mm benzamidine). The cells were disrupted in a French pressure cell and a crude soluble extract recovered by centrifugation at 100,000 × g, 4 °C for 1 h. The extract was then dialyzed against Buffer B (25 mm Tris-HCl, pH 7.5, 25 mm NaCl, 10 mm 2-mercaptoethanol) before application at 1.5 ml/min to a 25 × 250-mm column of DEAE-Sephacel (Amersham Pharmacia Biotech). After removal of unbound protein, a 450-ml linear gradient from 0 to 0.5 m NaCl in Buffer B was applied. Fractions containing Pcd1p were identified by immunoblotting and pooled (67 ml). Solid (NH4)2SO4 was added to the pooled fraction to a final concentration of 1 m and the sample was loaded at 1.5 ml/min on to a 15 × 50-mm column of Phenyl-Sepharose CL-4B (Amersham Pharmacia Biotech) previously equilibrated in Buffer C (50 mm Tris-HCl, pH 7.5, 5 mm 2-mercaptoethanol) containing 1 m(NH4)2SO4. After removal of unbound protein, a 100-ml reverse linear gradient from 1 to 0 m(NH4)2SO4 in Buffer C was applied. Fractions containing Pcd1p were identified by immunoblotting and pooled (52 ml) before dialysis against 10 mm sodium phosphate, pH 6.8, 10 μm CaCl2. The dialysate was applied at 1 ml/min to a 100 × 7.8-mm Bio-Gel HPHT column (Bio-Rad) and the protein eluted with a 30-ml linear gradient from 10 to 350 mm sodium phosphate, pH 6.8, containing 10 μm CaCl2. Homogenous Pcd1p eluted at 300 mm sodium phosphate, and fractions containing the pure protein were dialyzed extensively against 25 mmTris-HCl, pH 7.5, 50 mm NaCl prior to assay. Expression plasmids encoding C-terminal and N-terminal fusions of Pcd1p to yEGFP (11Cormack B.P. Bertram B. Egerton M. Gow N.A.R. Falkow S. Brown A.J.P. Microbiology. 1997; 143: 303-311Crossref PubMed Scopus (498) Google Scholar) were constructed by amplification of the PCD1 coding region from genomic DNA using the polymerase chain reaction and either the 36-mer oligonucleotide primers described above to give PCR product C, or the 36-mer forward and reverse primers d(AGAAAAGAATTCATGATATTAAGTCAGAGGAGGATG) and d(CAGTTTCTCGAGCCAAAGCGAGCGGCACTCCAGCAG) to give product N. After amplification with Pfu DNA polymerase, both DNA products were recovered by phenol/chloroform extraction and digested withEcoRI and XhoI. The digested and gel-purified PCR product C was ligated between the EcoRI and XhoI sites of pUG36 to give pyEGFP-PCD1 while PCR product N was ligated between the EcoRI and SalI sites of pUG35 to give pPCD1-yEGFP. Both plasmids were propagated by transformation ofE. coli XL1-Blue cells. For microscopy, S. cerevisiae strain INVScI was transformed with either pyEGFP-PCD1 or pPCD1-yEGFP and grown in liquid or solid SC-Ura medium containing 2% glucose. For staining of mitochondria in living cells, cultures of exponentially growing transformed INVScI were resuspended in 10 mm HEPES, pH 7.4, 5% (w/v) glucose, 100 nm rhodamine B hexyl ester and incubated at 20 °C for 30 min. For immunofluorescence microscopy, INVScI cells transformed with pPCD1-yEGFP were first grown in SC-Ura + 2% glucose to mid log phase followed by growth for 18 h in SC-Ura + 0.1% oleic acid, 0.02% Tween 40. Fixation and immunocytochemical staining were as described (12Erdmann R. Yeast. 1994; 10: 935-944Crossref PubMed Scopus (59) Google Scholar) using anti-3-oxoacyl-CoA thiolase (dilution 1:3000) followed by rhodamine-conjugated goat anti-rabbit IgG (1:50). Cells were viewed by conventional and confocal fluorescence microscopy on a Zeiss LSM510 confocal microscope with a 100 × 1.4 numeric aperture objective. Potential substrates were screened by measuring the Pi released by co-incubation of nucleotides with Pcd1p and either inorganic pyrophosphatase or alkaline phosphatase as described previously (9Cartwright J.L. McLennan A.G. J. Biol. Chem. 1999; 274: 8604-8610Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar,13Gasmi L. Cartwright J.L. McLennan A.G. Biochem. J. 1999; 344: 331-337Crossref PubMed Google Scholar). Reaction products generated from substrates were identified by high performance anion-exchange chromatography. Reaction mixtures (100 μl) containing 50 mm 1, 3-bis[tris(hydroxymethyl)methylamino]propane-HCl, pH 7.0, 5 mm MgCl2, 0.5 mm substrate, and 0.125 μg of Pcd1p were incubated for up to 10 min at 37 °C and applied to a 1-ml Resource-Q column (Amersham Pharmacia Biotech) at 2 ml/min in 5% buffer E. The elution system comprised Buffer D (0.045m CH3COONH4, adjusted to pH 4.6 with H3PO4) and Buffer E (0.5 mNaH2PO4, adjusted to pH 2.7 with CH3COOH) (14Kim J.S. Kim W.Y. Rho H.W. Park J.W. Park B.H. Han M.K. Kim U.H. Kim H.R. Int. J. Biochem. Cell Biol. 1998; 30: 629-638Crossref PubMed Scopus (21) Google Scholar), with a gradient of 5–70% Buffer E over 10 min. Substrates requiring reducing conditions (CoA and 3′-dephospho-CoA) were pre-incubated for 5 min at 37 °C with DTT before addition to the assay. The final assay concentration of DTT was 1 mm. Peaks were identified with the aid of standards and quantified by area integration for kinetic analysis. Immunoblotting was performed as described previously (9Cartwright J.L. McLennan A.G. J. Biol. Chem. 1999; 274: 8604-8610Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Protein concentrations were estimated by the Coomassie Blue binding method (15Peterson G.L. Methods Enzymol. 1982; 91: 95-119Crossref Scopus (1142) Google Scholar). The intronless PCD1 gene contains an open reading frame, YLR151C, that potentially encodes a 39,758-Da protein containing a nudix box (Fig. 1 A). Initial and various attempts to express soluble Pcd1p to a high level inE. coli were unsuccessful, with all the recombinant protein being found in inclusion bodies. Resolubilization of this material also failed to produce protein with discernible enzyme activity. It was therefore decided to use the protein isolated from inclusion bodies to raise a polyclonal rabbit antibody that could then be used in an immunoassay for the purification of the overexpressed protein from yeast. The YLR151C ORF was amplified by PCR from genomic DNA and the PCR product inserted into the yeast centromere vector, pPGY1. The resulting plasmid, pPGY151C, was transformed into S. cerevisiae strain INVScI and expression of the insert induced by growth on galactose. By following the major immunoreactive species on Western blots of chromatographic fractions, the protein product ofPCD1 was purified to homogeneity from extracts of the induced cells. The purified protein had a molecular mass of 38 kDa according to SDS-PAGE (Fig. 1 B). Throughout the purification, the immunoblots revealed more clearly than the gels that the overexpressed Pcd1p actually comprised two species of very similar size (Fig. 1 C). N-terminal sequencing of the two bands excised from these blots showed the upper and lower species to have the sequences MLSSKQLI and LSSKQLI, respectively, suggesting that Pcd1p may have undergone some N-terminal processing with the loss of either 7 or 8 amino acids (Fig. 1 A). Nucleotides were tested as potential substrates for Pcd1p using a spectrophotometric assay. No activity was found with the following compounds: (deoxy)nucleoside 5′-triphosphates, nucleoside 5′-di- or monophosphates, diadenosine polyphosphates, nucleoside 5′-diphosphosugars, cytidine 5′-diphosphoalcohols, NAD+, NADH, or FAD. However, substantial activity was found with CoA and some CoA derivatives (Table I). HPLC analysis of the products of CoA hydrolysis showed that the enzyme was a CoA diphosphatase, cleaving the diphosphate linkage in CoA to give 3′,5′-ADP and 4′-phosphopantetheine (Fig.2 A). Pcd1p is the first nudix hydrolase to be described with such a substrate specificity. TheK m and k cat for CoA were 280 μm and 4.6 s−1, respectively, while the corresponding values for oxidized CoA disulfide (CoASSCoA) were 24 μm and 5.0 s−1, respectively. Thus, the enzyme has a 13-fold higherk cat/K m ratio for CoASSCoA compared with CoA. These kinetic parameters were calculated by non-linear regression analysis of the data in Fig.3 A. The reciprocal plots in Fig. 3 B clearly show that the enzyme follows Michaelis-Menten kinetics with these two substrates. The initial products of CoASSCoA hydrolysis were 3′,5′-ADP and what is presumed to be CoASSP, the mixed disulfide of CoA and 4′-phosphopantetheine,i.e. CoASSCoA lacking a single 3′,5′-ADP moiety (Fig.2 B). Significant accumulation of this product was observed with time before it too was degraded, presumably to 3′,5′-ADP and the dimer of 4′-phosphopantetheine, suggesting that CoASSP is not as efficient a substrate as CoASSCoA. When measured at a single fixed substrate concentration, moderate activity was also obtained with several short chain acyl-CoA esters while 3′-dephospho-CoA was a very poor substrate (Table I). Thus, the 3′ phosphate on the adenosine moiety appears to be important for substrate recognition. Attempts to demonstrate enzyme activity in crude yeast extracts proved impossible due to 3′ dephosphorylation of the CoA substrates. The mixed CoA-glutathione disulfide, which may exist in vivo but which is more usually found as an extraction artifact (16King M.T. Reiss P.D. Anal. Biochem. 1985; 146: 173-179Crossref PubMed Scopus (79) Google Scholar, 17Jackowski S. Rock C.O. J. Bacteriol. 1986; 166: 866-871Crossref PubMed Scopus (64) Google Scholar), was also a relatively poor substrate. Therefore, recognition of CoASSCoA as a good substrate must involve more than just the disulfide bond.Table ISubstrate utilization by Pcd1pSubstrateActivity%CoASSCoA100.0CoA63.9Succinyl-CoA20.53-Hydroxymethylglutaryl-CoA16.3Acetyl-CoA14.3CoA-glutathione disulfide6.13′-Dephospho-CoA0.8Activity with CoA and CoA derivatives was determined by high performance liquid chromatography at a fixed substrate concentration of 0.5 mm as described under “Experimental Procedures.” Results are expressed as percentage of degradation rate obtained with CoASSCoA determined from progress curves with incubation times up to 10 min. 100% represents a rate of 7.5 μmol·min−1·mg−1. Open table in a new tab Figure 3Michaelis-Menten (A) and Lineweaver-Burk (B) plots for the hydrolysis of CoA (●) and CoASSCoA (○) by Pcd1p. Enzyme assays were performed and product peak areas quantified by ion-exchange chromatography as described under “Experimental Procedures.”View Large Image Figure ViewerDownload Hi-res image Download (PPT) Activity with CoA and CoA derivatives was determined by high performance liquid chromatography at a fixed substrate concentration of 0.5 mm as described under “Experimental Procedures.” Results are expressed as percentage of degradation rate obtained with CoASSCoA determined from progress curves with incubation times up to 10 min. 100% represents a rate of 7.5 μmol·min−1·mg−1. Pcd1p was optimally active at pH 7.0 with 5 mmMg2+ ions. Mn2+ at 300 μmsupported 83% of the activity observed with 5 mmMg2+ ions. Like all other nudix hydrolases tested, Pcd1p was very sensitive to inhibition by fluoride ions with an IC50 of 22 μm using CoASSCoA as substrate (data not shown). A likely subcellular location for an enzyme with the properties described would be the mitochondria or peroxisomes, as these contain the major cellular CoA pools. The latter organelle is the sole site of fatty acid β-oxidation in yeast. The N-terminal 30–40 amino acids of Pcd1p are rich in Lys, Arg, Ser, and Thr, suggesting they may comprise a mitochondrial targeting signal (Fig. 1 A) (18Hartl F.U. Pfanner N. Nicholson D.W. Neupert W. Biochim. Biophys. Acta. 1989; 988: 1-45Crossref PubMed Scopus (547) Google Scholar). Indeed, the PSORT algorithm suggests a possible mitochondrial location (19Nakai K. Kanehisa M. Genomics. 1992; 14: 897-911Crossref PubMed Scopus (1367) Google Scholar) while a hydrophobic transmembrane segment following the potential leader sequence that could anchor the imported protein in the inner mitochondrial membrane is predicted by the TMpred (20Hofmann K. Stoffel W. Biol. Chem. Hoppe-Seyler. 1993; 347: 166-174Google Scholar) and TMHMM (21Sonnhammer E.L.L. von Heijne G. Krogh A. Glasgow J. Littlejohn T. Major F. Lathrop R. Sankoff D. Sensen C. Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology. AAAI Press, Menlo Park, CA1998: 175-185Google Scholar) algorithms (Fig. 1 A). The sequence of Pcd1p does not contain a typical C-terminal tripeptide peroxisomal targeting signal (PTS1) (22de Hoop M.J. Ab G. Biochem. J. 1992; 286: 657-669Crossref PubMed Scopus (188) Google Scholar); however, the sequence RRMLSSKQL in the N-terminal region (Fig. 1 A) is a close match to the PTS2 N-terminal peroxisomal matrix targeting signal consensus (R/K)(L/V/I)X 5(Q/H)(L/A) (22de Hoop M.J. Ab G. Biochem. J. 1992; 286: 657-669Crossref PubMed Scopus (188) Google Scholar, 23Subramani S. Physiol. Rev. 1998; 78: 171-188Crossref PubMed Scopus (284) Google Scholar). Thus, Pcd1p could be either mitochondrial or peroxisomal. The similarity in peroxisomal and mitochondrial N-terminal targeting signals has been noted before (24Osumi T. Tsukamoto T. Hata S. Biochem. Biophys. Res. Commun. 1992; 186: 811-818Crossref PubMed Scopus (27) Google Scholar). In order to determine the true subcellular location of Pcd1p, yeast cells were transformed with expression vectors encoding Pcd1p fused to either the C terminus (pyEGFP-PCD1) or the N terminus (pPCD1-yEGFP) of yeast-enhanced green fluorescent protein (yEGFP) (11Cormack B.P. Bertram B. Egerton M. Gow N.A.R. Falkow S. Brown A.J.P. Microbiology. 1997; 143: 303-311Crossref PubMed Scopus (498) Google Scholar) and then examined by confocal microscopy. Cells transformed with pyEGFP-PCD1 showed a diffuse cytoplasmic fluorescence with no clear subcellular localization (Fig. 4, A and B) while cells transformed with pPCD1-yEGFP showed a clear punctate fluorescence characteristic of peroxisomes (Fig. 4 C). The same cells stained with the mitochondrial-specific dye rhodamine B hexyl ester revealed a quite distinct pattern of mitochondrial staining (Fig. 4 D). Superimposition of the latter two images showed only limited coincidence of green and red emissions due to physical overlap of some organelles (Fig. 4 E). The structural integrity of the cells was apparent under bright field conditions (Fig.4 F). The peroxisomal location of Pcd1p in cells transformed with pPCD1-yEGFP (Fig. 4 G) was confirmed by indirect immunofluorescence microscopy using an antibody to 3-oxoacyl-CoA thiolase (Fox3p), a known peroxisomal enzyme (12Erdmann R. Yeast. 1994; 10: 935-944Crossref PubMed Scopus (59) Google Scholar, 25Erdmann R. Kunau W.-H. Yeast. 1994; 10: 1173-1182Crossref PubMed Scopus (41) Google Scholar), and a rhodamine-conjugated second antibody (Fig. 4 H). Both signals were clearly coincident (Fig. 4 I). These results show that the N-terminal sequence of Pcd1p directs the enzyme to peroxisomes, most probably via the PTS2-like sequence RRMLSSKQL, but not to the mitochondria. Thus, Pcd1p is only the second protein identified inS. cerevisiae to be imported into peroxisomes by virtue of a PTS2 signal, the first being Fox3p (26Geraghty M.T. Bassett D. Morrell J.C. Gatto G.J. Bai J.W. Geisbrecht B.V. Hieter P. Gould S.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2937-2942Crossref PubMed Scopus (49) Google Scholar). Interestingly, purified Fox3p has been reported to lack its 5 N-terminal amino acids (25Erdmann R. Kunau W.-H. Yeast. 1994; 10: 1173-1182Crossref PubMed Scopus (41) Google Scholar) while purified Pcd1p appears to have lost 7 or 8 amino acids from its predicted sequence. This would lend support to the suggestion that the PTS2 signal in yeast may undergo specific proteolytic processing after import into the peroxisomes (25Erdmann R. Kunau W.-H. Yeast. 1994; 10: 1173-1182Crossref PubMed Scopus (41) Google Scholar). Structure 1 shows the possible sites of proteolytic processing (arrowed) within the putative PTS2 sequences of Fox3p and Pcd1p (boxed).Figure 4Subcellular localization of Pcd1p by fluorescence confocal microscopy. A, yEGFP fluorescence of cells transformed with pyEGFP-PCD1; B, as panel A but superimposed on a bright field picture; C, yEGFP fluorescence of cells transformed with pPCD1-yEGFP; D, fluorescence of same cells as in panel C stained with rhodamine B hexyl ester; E, superimposition of panels C and D; F, bright field picture of cells inpanels C–E; G, yEGFP fluorescence of cells transformed with pPCD1-yEGFP; H, fluorescence of cells inpanel G incubated with an antibody to peroxisomal Fox3p and a rhodamine-conjugated second antibody; I, superimposition of panels G and H.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In addition to the nudix box, the sequence of Pcd1p contains a second, contiguous signature motif to the N-terminal side identified in the PROSITE data bank as UPF0035 (Fig.5). This motif has the sequence LLTXR(SA)X 3RX 3GX 3FPGG and is present in a variety of related bacterial, fungal, animal, and plant putative protein sequences in the GenBank™/EMBL non-redundant and expressed sequence tag data bases, some examples of which are shown in Fig. 5. Animals (mouse, rat, human, and Caenorhabditis elegans) have pairs of related sequences. The mouse gene sequences, Nudt7 and Nudt8, encode two 26-kDa proteins that share 34% sequence identity with each other and 26% and 20% sequence identity with Pcd1p, respectively. The Nudt7gene product is also a peroxisomal CoA diphosphatase with a C-terminal tripeptide targeting signal, SKL. 4L. Gasmi, J. L. Cartwright, and A. G. McLennan, unpublished observations. Therefore, the UPF0035 motif may be a determinant of CoA substrate specificity among the nudix hydrolases. Since it overlaps with the predicted transmembrane segment, the latter may not be genuine. An additional sequence feature is the substitution of the usual glutamate residue in the nudix box (marked with * in Fig. 5) by either aspartate or glutamine and the inclusion of an extra amino acid in several cases between this residue and the invariant alanine (marked with † in Fig. 5). Thus, the consensus nudix box in this family of potential CoA diphosphatases is GX 5DX 6AXREXXEEXGU. Pcd1p represents a new class of nudix hydrolase and a new class of enzyme. The existence of such an activity has been inferred previously but it has not been isolated. In E. coli, and presumably in other cells, regulation of the concentration of CoA includes turnover to form 3′,5′-ADP and 4′-phosphopantetheine, the latter being formed directly or by transfer to and removal from acyl carrier protein (27Vallari D.S. Jackowski S. J. Bacteriol. 1988; 170: 3961-3966Crossref PubMed Google Scholar). The former route would require a CoA diphosphatase. CoA diphosphatase has also been proposed as an activity associated with the 400-kDa CoA synthesizing protein complex from S. cerevisiae in which it forms part of an alternative pathway for CoA biosynthesis that differs from the principal route of 3′-dephospho-CoA and CoA synthesis by this complex (28Bucovaz E.T. Macleod R.M. Morrison J.C. Whybrew W.D. Biochimie. 1997; 79: 787-798Crossref PubMed Scopus (18) Google Scholar). This CoA/4′-phosphopantetheine cycle also includes hydrolysis of CoA to 3′,5′-ADP and 4′-phosphopantetheine, which then reacts with ATP to give 3′-dephospho-CoA, and then CoA. At the moment we do not know if Pcd1p is responsible for this activity. A recent comprehensive two-hybrid analysis of protein-protein interactions inS. cerevisiae revealed no interacting partners for Pcd1p (29Uetz P. Giot L. Cagney D. Mansfield T.A. Judson R.S. Knight J.R. Lockshon D. Narayan V. Srinivasan M. Pochart P. Qureshi-Emili A. Li Y. Godwin B. Conover D. Kalbfleisch T. Vijayadamodar G. Yang M. Johnston M. Fields S. Rothberg J.M. Nature. 2000; 403: 623-627Crossref PubMed Scopus (3915) Google Scholar). However, stable interactions requiring three or more partners would not have been detected. Alternatively, the high activity of Pcd1p toward oxidized CoA disulfide and its peroxisomal location suggest a function that may be more in keeping with the proposal that a major role of the nudix hydrolases is the elimination of toxic nucleotides. Oxidative stress generates increased levels of several of the substrates for nudix hydrolases,e.g. 8-oxo-dGTP for the MutT protein (30Sekiguchi M. Genes Cells. 1996; 1: 139-145Crossref PubMed Scopus (62) Google Scholar), diadenosine tetraphosphate (Ap4A) for Ap4A hydrolase (31Bochner B.R. Lee P.C. Wilson S.W. Cutler C.W. Ames B.N. Cell. 1984; 37: 225-232Abstract Full Text PDF PubMed Scopus (206) Google Scholar,32Thorne N.M.H. Hankin S. Wilkinson M.C. Nuñez C. Barraclough R. McLennan A.G. Biochem. J. 1995; 311: 717-721Crossref PubMed Scopus (59) Google Scholar), and ADP-ribose for ADP-sugar diphosphatases (13Gasmi L. Cartwright J.L. McLennan A.G. Biochem. J. 1999; 344: 331-337Crossref PubMed Google Scholar). Many of the oxidative reactions in peroxisomes generate hydrogen peroxide and the resultant oxidizing environment would be expected to increase the CoA disulfide/CoA ratio (cf. the oxidized glutathione/glutathione ratio). Indeed, some organisms such asStaphylococcus aureus use a thiol/disulfide redox system based on CoA, CoA disulfide, and a CoA disulfide reductase instead of the more common glutathione system to maintain a reducing environment (33delCardayré S.B. Davies J.E. J. Biol. Chem. 1998; 273: 5752-5757Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). In the probable absence of a specific CoA disulfide reductase to regenerate CoA within the yeast peroxisomes (33delCardayré S.B. Davies J.E. J. Biol. Chem. 1998; 273: 5752-5757Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), accumulation of CoA disulfide could lead to a reduction in the ability to oxidize fatty acids, hence the need for Pcd1p. Since the S. cerevisiae NPY1 NADH diphosphatase is also peroxisomal,3 both enzymes may participate in the maintenance and protection of essential nucleotide pools for β-oxidation. Although preliminary experiments with a yeast strain disrupted for PCD1 have failed to show any substantial deficiency in growth on oleic acid,3 more detailed investigations are under way to determine the precise function of Pcd1p and the consequences of PCD1 disruption. In conclusion, a nudix hydrolase with a previously undescribed enzyme activity has been characterized in yeast. It is the first nudix hydrolase to be shown to be peroxisomal and only the second protein known in S. cerevisiae to be targeted by a PTS2 signal sequence. It will be of interest to determine if a deficiency in the human orthologue is associated with impaired peroxisomal function and disease. We thank M. C. Wilkinson for N-terminal sequencing and L. D. Barnes, J. H. Hegemann, and W.-H Kunau for the generous gift of materials." @default.
• W2000907546 created "2016-06-24" @default.
• W2000907546 creator A5001561535 @default.
• W2000907546 creator A5040757424 @default.
• W2000907546 creator A5059601244 @default.
• W2000907546 creator A5084431379 @default.
• W2000907546 date "2000-10-01" @default.
• W2000907546 modified "2023-10-03" @default.
• W2000907546 title "The Saccharomyces cerevisiae PCD1 Gene Encodes a Peroxisomal Nudix Hydrolase Active toward Coenzyme A and Its Derivatives" @default.
• W2000907546 cites W1573664132 @default.
• W2000907546 cites W1747057328 @default.
• W2000907546 cites W1969362797 @default.
• W2000907546 cites W1992246409 @default.
• W2000907546 cites W1994704939 @default.
• W2000907546 cites W2001047773 @default.
• W2000907546 cites W2007264707 @default.
• W2000907546 cites W2018643446 @default.
• W2000907546 cites W2023537767 @default.
• W2000907546 cites W2023910328 @default.
• W2000907546 cites W2034588677 @default.
• W2000907546 cites W2040390369 @default.
• W2000907546 cites W2041652393 @default.
• W2000907546 cites W2064433587 @default.
• W2000907546 cites W2065304353 @default.
• W2000907546 cites W2065699737 @default.
• W2000907546 cites W2068778722 @default.
• W2000907546 cites W2073515768 @default.
• W2000907546 cites W2074215445 @default.
• W2000907546 cites W2075095457 @default.
• W2000907546 cites W2079326336 @default.
• W2000907546 cites W2098772291 @default.
• W2000907546 cites W2115027228 @default.
• W2000907546 cites W2117952648 @default.
• W2000907546 cites W2122886986 @default.
• W2000907546 cites W2130652548 @default.
• W2000907546 cites W2144011606 @default.
• W2000907546 cites W2165914529 @default.
• W2000907546 cites W2229995226 @default.
• W2000907546 cites W2688325281 @default.
• W2000907546 doi "https://doi.org/10.1074/jbc.m005015200" @default.
• W2000907546 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10922370" @default.
• W2000907546 hasPublicationYear "2000" @default.
• W2000907546 type Work @default.
• W2000907546 sameAs 2000907546 @default.
• W2000907546 citedByCount "69" @default.
• W2000907546 countsByYear W20009075462012 @default.
• W2000907546 countsByYear W20009075462013 @default.
• W2000907546 countsByYear W20009075462014 @default.
• W2000907546 countsByYear W20009075462016 @default.
• W2000907546 countsByYear W20009075462017 @default.
• W2000907546 countsByYear W20009075462018 @default.
• W2000907546 countsByYear W20009075462019 @default.
• W2000907546 countsByYear W20009075462020 @default.
• W2000907546 countsByYear W20009075462021 @default.
• W2000907546 countsByYear W20009075462022 @default.
• W2000907546 countsByYear W20009075462023 @default.
• W2000907546 crossrefType "journal-article" @default.
• W2000907546 hasAuthorship W2000907546A5001561535 @default.
• W2000907546 hasAuthorship W2000907546A5040757424 @default.
• W2000907546 hasAuthorship W2000907546A5059601244 @default.
• W2000907546 hasAuthorship W2000907546A5084431379 @default.
• W2000907546 hasBestOaLocation W20009075461 @default.
• W2000907546 hasConcept C104317684 @default.
• W2000907546 hasConcept C127078168 @default.
• W2000907546 hasConcept C185592680 @default.
• W2000907546 hasConcept C2777576037 @default.
• W2000907546 hasConcept C55493867 @default.
• W2000907546 hasConcept C86803240 @default.
• W2000907546 hasConceptScore W2000907546C104317684 @default.
• W2000907546 hasConceptScore W2000907546C127078168 @default.
• W2000907546 hasConceptScore W2000907546C185592680 @default.
• W2000907546 hasConceptScore W2000907546C2777576037 @default.
• W2000907546 hasConceptScore W2000907546C55493867 @default.
• W2000907546 hasConceptScore W2000907546C86803240 @default.
• W2000907546 hasIssue "42" @default.
• W2000907546 hasLocation W20009075461 @default.
• W2000907546 hasOpenAccess W2000907546 @default.
• W2000907546 hasPrimaryLocation W20009075461 @default.
• W2000907546 hasRelatedWork W1972561620 @default.
• W2000907546 hasRelatedWork W2079481813 @default.
• W2000907546 hasRelatedWork W2105986482 @default.
• W2000907546 hasRelatedWork W2115749200 @default.
• W2000907546 hasRelatedWork W2129055382 @default.
• W2000907546 hasRelatedWork W2141613369 @default.
• W2000907546 hasRelatedWork W2161223616 @default.
• W2000907546 hasRelatedWork W2171277769 @default.
• W2000907546 hasRelatedWork W2791263336 @default.
• W2000907546 hasRelatedWork W4211092013 @default.
• W2000907546 hasVolume "275" @default.
• W2000907546 isParatext "false" @default.
• W2000907546 isRetracted "false" @default.
• W2000907546 magId "2000907546" @default.
• W2000907546 workType "article" @default.