FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2000923801> ?p ?o ?g. }

• W2000923801 endingPage "48922" @default.
• W2000923801 startingPage "48913" @default.
• W2000923801 abstract "Recent studies have suggested a possible role for presenilin proteins in apoptotic cell death observed in Alzheimer's disease. The mechanism by which presenilin proteins regulate apoptotic cell death is not well understood. Using the yeast two-hybrid system, we previously isolated a novel protein, presenilin-associated protein (PSAP) that specifically interacts with the C terminus of presenilin 1 (PS1), but not presenilin 2 (PS2). Here we report that PSAP is a mitochondrial resident protein sharing homology with mitochondrial carrier protein. PSAP was detected in a mitochondria-enriched fraction, and PSAP immunofluorescence was present in a punctate pattern that colocalized with a mitochondrial marker. More interestingly, overexpression of PSAP caused apoptotic death. PSAP-induced apoptosis was documented using multiple independent approaches, including membrane blebbing, chromosome condensation and fragmentation, DNA laddering, cleavage of the death substrate poly(ADP-ribose) polymerase, and flow cytometry. PSAP-induced cell death was accompanied by cytochrome c release from mitochondria and caspase-3 activation. Moreover, the general caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone, which blocked cell death, did not block the release of cytochrome c from mitochondria caused by overexpression of PSAP, indicating that PSAP-induced cytochrome c release was independent of caspase activity. The mitochondrial localization and proapoptotic activity of PSAP suggest that it is an important regulator of apoptosis. Recent studies have suggested a possible role for presenilin proteins in apoptotic cell death observed in Alzheimer's disease. The mechanism by which presenilin proteins regulate apoptotic cell death is not well understood. Using the yeast two-hybrid system, we previously isolated a novel protein, presenilin-associated protein (PSAP) that specifically interacts with the C terminus of presenilin 1 (PS1), but not presenilin 2 (PS2). Here we report that PSAP is a mitochondrial resident protein sharing homology with mitochondrial carrier protein. PSAP was detected in a mitochondria-enriched fraction, and PSAP immunofluorescence was present in a punctate pattern that colocalized with a mitochondrial marker. More interestingly, overexpression of PSAP caused apoptotic death. PSAP-induced apoptosis was documented using multiple independent approaches, including membrane blebbing, chromosome condensation and fragmentation, DNA laddering, cleavage of the death substrate poly(ADP-ribose) polymerase, and flow cytometry. PSAP-induced cell death was accompanied by cytochrome c release from mitochondria and caspase-3 activation. Moreover, the general caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone, which blocked cell death, did not block the release of cytochrome c from mitochondria caused by overexpression of PSAP, indicating that PSAP-induced cytochrome c release was independent of caspase activity. The mitochondrial localization and proapoptotic activity of PSAP suggest that it is an important regulator of apoptosis. Alzheimer's disease (AD), 1The abbreviations used are: AD, Alzheimer's disease; FAD, familial Alzheimer's disease; APP, amyloid precursor protein; PS, presenilin; PSAP, PS1-associated protein; PARP, poly(ADP-ribose) polymerase; BH, Bcl-2 homology; LacZ, β-galactosidase; GFP, green fluorescence protein; z-VAD-fmk, benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone; PBS, phosphate-buffered saline; DAPI, 4,6-diamidino-2- phenylindole. 1The abbreviations used are: AD, Alzheimer's disease; FAD, familial Alzheimer's disease; APP, amyloid precursor protein; PS, presenilin; PSAP, PS1-associated protein; PARP, poly(ADP-ribose) polymerase; BH, Bcl-2 homology; LacZ, β-galactosidase; GFP, green fluorescence protein; z-VAD-fmk, benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone; PBS, phosphate-buffered saline; DAPI, 4,6-diamidino-2- phenylindole. the most common form of senile dementia, is pathologically characterized by the deposition of amyloid β-peptide (Aβ), the formation of neurofibrillary tangles, and massive neuronal cell loss in the brain (1Selkoe D.J. J. Biol. Chem. 1996; 271: 18295-18298Google Scholar). A subset of AD cases is familial AD (FAD), which occurs as an inherited autosomal dominant disease caused by defects in any of three genes: presenilin 1 (PS1) on chromosome 14, presenilin 2 (PS2) on chromosome 1, and the amyloid precursor protein (APP) on chromosome 21 (for review, see Ref. 2Tanzi R.E. Kovacs D.M. Kim T.W. Moir R.D. Guenette S.Y. Wasco W. Neurobiol. Dis. 1996; 3: 159-168Google Scholar). The majority of FAD cases have been associated with mutations in PS1 and PS2 (2Tanzi R.E. Kovacs D.M. Kim T.W. Moir R.D. Guenette S.Y. Wasco W. Neurobiol. Dis. 1996; 3: 159-168Google Scholar). It has been shown that FAD-associated mutations in PS1 and PS2 affect the processing of APP, leading to an increased production of the more amyloidogenic Aβ peptide, both in vivo and in vitro (3Borchelt D.R. Thinakaran G. Eckman C.B. Lee M.K. Davenport F. Ratovitsky T. Prada C.M. Kim G. Seekins S. Yager D. Slunt H.H. Wang R. Seeger M. Levey A.I. Gandy S.E. Copeland N.G. Jenkins N.A. Price D.L. Younkin S.G. Sisodia S.S. Neuron. 1996; 17: 1005-1013Google Scholar, 4Citron M. Westaway D. Xia W. Carlson G. Diehl T. Levesque G. Johnson-Wood K. Lee M. Seubert P. Davis A. Kholodenko D. Motter R. Sherrington R. Perry B. Yao H. Strome R. Lieberburg I. Rommens J. Kim S. Schenk D. Fraser P. St George Hyslop P. Selkoe D.J. Nat. Med. 1997; 3: 67-72Google Scholar, 5Duff K. Eckman C. Zehr C. Yu X. Prada C.M. Perez-tur J. Hutton M. Buee L. Harigaya Y. Yager D. Morgan D. Gordon M.N. Holcomb L. Refolo L. Zenk B. Hardy J. Younkin S. Nature. 1996; 383: 710-713Google Scholar, 6Scheuner D. Eckman C. Jensen M. Song X. Citron M. Suzuki N. Bird T.D. Hardy J. Hutton M. Kukull W. Larson E. Levy-Lahad E. Viitanen M. Peskind E. Poorkaj P. Schellenberg G. Tanzi R. Wasco W. Lannfelt L. Selkoe D. Younkin S. Nat. Med. 1996; 2: 864-870Google Scholar). In addition to their roles in APP processing, roles for PS1 and PS2 in programmed cell death or apoptosis have also been reported in several studies. It has been shown that overexpression of a C-terminal fragment of PS2 protects neural cells against apoptosis (7Vito P. Ghayur T. D'Adamio L. J. Biol. Chem. 1997; 272: 28315-28320Google Scholar). It was also reported that overexpression of a C-terminal fragment of PS1 delays anti-Fas-induced apoptosis in Jurkat cells (8Vezina J. Tschopp C. Andersen E. Muller K. Neurosci. Lett. 1999; 263: 65-68Google Scholar). A role for PS1 and PS2 in apoptosis is also supported by studies demonstrating that overexpression of PS1 or PS2 bearing FAD mutations results in increased sensitivity to apoptotic insults (9Keller J.N. Guo Q. Holtsberg F.W. Bruce-Keller A.J. Mattson M.P. J. Neurosci. 1998; 18: 4439-4450Google Scholar, 10Mattson M.P. Zhu H. Yu J. Kindy M.S. J. Neurosci. 2000; 20: 1358-1364Google Scholar, 11Weihl C.C. Ghadge G.D. Kennedy S.G. Hay N. Miller R.J. Roos R.P. J. Neurosci. 1999; 19: 5360-5369Google Scholar, 12Wolozin B. Alexander P. Palacino J. Neurobiol. Aging. 1998; 19: S23-S27Google Scholar, 13Wolozin B. Iwasaki K. Vito P. Ganjei J.K. Lacana E. Sunderland T. Zhao B. Kusiak J.W. Wasco W. D'Adamio L. Science. 1996; 274: 1710-1713Google Scholar). These studies suggest that mutant PS1 and PS2 may be directly involved in neuronal cell death found in the AD brain by regulating the apoptotic cascades. Apoptosis has been implicated as a mechanism of cell death in AD, and the involvement in apoptotic cell death has been reported for all of the three known Alzheimer genes, PS1, PS2, and APP (for review, see Ref.14Czech C. Tremp G. Pradier L. Prog. Neurobiol. 2000; 60: 363-384Google Scholar). However, the exact mechanisms by which these molecules are involved in apoptosis are not well understood. Very recently, by using a yeast two-hybrid system, we isolated a novel protein, designated presenilin-associated protein (PSAP), which interacts with the C terminus of PS1 (15Xu X. Shi Y. Wu X. Gambetti P. Sui D. Cui M.Z. J. Biol. Chem. 1999; 274: 32543-32546Google Scholar). We now report that PSAP is a proapoptotic molecule that causes apoptotic cell death when it is overexpressed. Our results also indicate that PSAP-induced apoptosis involves caspase activation. Inhibition of caspase activity blocked apoptosis but had no effect on PSAP-induced cytochrome c release from mitochondria, indicating that cytochrome c release is an earlier event in PSAP-induced apoptosis. To explore the biological function of this newly identified molecule, its subcellular localization was also investigated. Our results demonstrate that PSAP is localized in mitochondria. These results indicate that PSAP is a novel mitochondrial protein that may be an important mediator of PS1-regulated apoptotic cell death cascades. Growth medium, fetal bovine serum, and other supplements were purchased from Invitrogen. The general caspase inhibitor, benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (z-VAD-fmk), was purchased from R&D Systems. Unless stated otherwise, the routine chemicals, proteinase inhibitors, propidium iodide, and bovine serum albumin were obtained from Sigma. For wild type PSAP, PSAP cDNA was amplified with primer pair BHK-PSAP+ (5′-GGATCCAAGCTTGCCACCATGGCGGG AGCCGGAGCTGGAGCCGG-3′) andXbaI-PSAP− (5′-TCTAGACTCCAGGGCAAA GCATGATCCTG-3′). DNA fragments generated by using these primer pairs contained a Kozak sequence, GCCACC (16Kozak M. J. Biol. Chem. 1991; 266: 19867-19870Google Scholar), followed by an ATG codon and aXbaI site at the 3′ end, which allowed insertion of the DNA fragments into the pcDNA3.1/myc-His expression vector (Invitrogen) in frame. The polymerase chain reaction (PCR) product was first cloned into TOPOTM TA cloning vector, pCR®2.1-TOPO (Invitrogen), and the fidelity of the DNA sequence was confirmed by DNA sequencing. The inserted DNA was then digested withHindIII/XbaI restriction enzymes and subcloned into pcDNA3.1/myc-His expression vector in frame. Thus, the PSAP was expressed as a myc-tagged polypeptide with the myc-His tag at the C terminus. The plasmid pcDNA3.1/LacZ-myc-His, which expresses LacZ protein with a myc tag, was provided in the pcDNA3.1/myc-His vector package by the vendor (Invitrogen). To generate the construct expressing PSAP-green fluorescence protein (GFP) fusion protein, PSAP cDNA was amplified with primer pair BHK-PSAP+ (5′-GGATCCAAGCTTGCCACCATGGCGGGAGCCGGAGCTGGAGCCGG-3′)/BamHI-PSAP− (5′-GGATCCCCTCCAGGGCAAAGCATGAT-3′). The resulting DNA fragment encodes the full-length PSAP in which the stop codon TAA was destroyed and replaced with a BamHI restriction site. The PCR product was cloned into pCR2.1-TOPO vector, and the fidelity of the DNA sequence was confirmed by sequencing. The inserted DNA was then digested with HindIII/BamHI restriction enzymes and subcloned into HindIII/BamHI sites of the pEGFP-N2 vector (Clontech) in frame with the GFP coding sequence. Thus, PSAP was expressed as a fusion protein fused to the N terminus of GFP. For construction of the plasmid expressing wild type PS1 (PS1wt), PS1 cDNA was amplified by a pair of primers, BHKFPS1+, which encoded the Flag epitope and the N-terminal eight amino acids of PS1 preceded by a HindIII site (GGATCCAAGCTTGCCACCATGGACTATAAGGACGACGACGACAAGACAGAGTTACCTGCACCGTTGTC) and BEPS1−, which is complementary to 3′-end of PS1 cDNA and contains a BamHI site (GGATCCGAATTCCTAGATATAAAATTGATGG). The PCR product was first cloned into the pCR2.1-TOPO vector, confirmed for its fidelity by sequencing, and subcloned intoHindIII/BamHI sites of the pCDNA3.1 vector (Invitrogen). Thus, PS1 will be expressed with an N-terminal FLAG tag. To generate the D385A mutant PS1(D385A), the flag-tagged PS1wt cDNA in pCR2.1-TOPO vector was amplified with complementary oligonucleotide primers D385A-S (5′-AACTTGGATTGGGAGCTTTCATTTTCTACAGTGT-3′) and D385A-AS (5′-ACACTGTAGAAAATGAAAGCTCCCAATCCAAGTT-3′), which contain the substitution of a single nucleotide indicated by a bold letter, using the QuikChange® XL site-directed mutagenesis kit (Stratagene). For mutant PS1(D257A), the flag-tagged PS1wt cDNA in pCR2.1-TOPO vector was amplified with oligonucleotide pairs D257A-S (5′-GTGATTTCAGTATATGCTTTAGTGGCTGTTTTGT-3′) and D257A-AS (5′-ACAAAACAGCCACTAAAGCATATACTGAAATCAC-3′) using the QuikChange® XL site-directed mutagenesis kit. The fidelity of the sequence has been confirmed by DNA sequencing. The mutant PS1(D385A) and PS1(D257A) cDNAs, in which an aspartate residue was replaced by alanine at position 385 and 257, respectively, were then subcloned into the pcDNA3.1 vector as described above. The double mutant, PS1(D257A/D385A), was constructed by taking advantage of the unique restriction site DraII between codon 257 and codon 385 of the PS1 gene. Both PS1(D257A) and PS1(D385A) in the pcDNA3.1 vector were digested with DraII. The 3′ endDraII fragment, which contained the D385A mutation from PS1(D385A), was used to replace the 3′ end DraII fragment of PS1(D257A). HEK293 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 50 units/ml penicillin, and 50 μg/ml streptomycin. Transfection was performed using LipofectAMINE Plus transfection reagent (Invitrogen). Cells were transiently transfected with the PSAP expression vector. Twenty-four h after transfection, both floating cells and adherent cells, which were detached by trypsinization, were collected, washed twice with ice-cold phosphate-buffered saline (PBS), and fixed in 90% methanol on ice for 15 min. Cells were collected by centrifugation at 1000 rpm for 2 min, washed twice with cold PBS, suspended in 200 μl of PBS, and incubated with RNase A (Sigma, 20 μg/ml final concentration) at 37 °C for 30 min. The cells were chilled on ice for 10 min, stained with 100 μg/ml propidium iodide (Calbiochem) for 1 h, and analyzed by fluorescence-activated cell sorting using an Elite ESP flow cytometer, as described previously (17Sramkoski R.M. Wormsley S.W. Bolton W.E. Crumpler D.C. Jacobberger J.W. Cytometry. 1999; 35: 274-283Google Scholar). Morphological changes such as cell rounding and membrane blebbing were examined by microscopic inspection of cells under differential interference contrast. Nuclear changes such as chromatin condensation and nuclear fragmentation were analyzed by staining with acridine orange or DAPI. All of the observations, including those of the GFP fluorescence images, were acquired using an Olympus BX-51 fluorescence microscope equipped with the necessary filters and a digital camera. Nuclear morphological changes of cells transfected with PSAP or LacZ without GFP were examined by acridine orange staining as described previously (18Agrawal S. Agarwal M.L. Chatterjee-Kishore M. Stark G.R. Chisolm G.M. Mol. Cell. Biol. 2002; 22: 1981-1992Google Scholar). Briefly, 24 h after transfection, cells were trypsinized and harvested by centrifugation at 1000 rpm, washed once with PBS, resuspended in 200 μl of PBS, and stained with an acridine orange and ethidium bromide dye mixture (final concentration, 10 μg/ml for each) immediately before quantification. A minimum of 200 cells/coverslip was scored under a fluorescence microscope for apoptotic morphology. Nuclear morphological changes of cells transfected with PSAP-GFP were examined by DAPI staining according to the protocol provided by the vender (Roche Molecular Biochemicals). Briefly, cells were plated on poly-l-lysine-coated coverslips. On the next day, cells were transfected with 1 μg of plasmid DNA (pPSAP-GFP or pEGFP-N2 as a control) using LipofectAMINE Plus transfection reagent (Invitrogen). Medium was removed 24 h after transfection, and cells were washed once with DAPI-methanol (1 μg/ml) and incubated with DAPI-methanol for 15 min at 37 °C. After washing once with methanol, coverslips were placed on microslides and the cells were mounted using Vectashield mounting medium for fluorescence (Vector Laboratories, Inc.). HEK293 cells were plated on poly-l-lysine-coated coverslips. Two days later, the medium was replaced with pre-warmed Dulbecco's modified Eagle's medium containing 25 nm MitoTracker Red (Molecular Probes) and incubated for 15 min to label the mitochondria. For labeling the endogenous PSAP, cells were then fixed with 3.7% formaldehyde in PBS for 20 min, followed by permeabilization with 0.2% Triton X-100 for 4 min. The fixed cells were washed four times with PBS and blocked in 1% bovine serum albumin and 5% normal goat serum. The coverslips were incubated with a rabbit polyclonal anti-PSAP antibody (1:200), which was raised against a peptide corresponding to amino acids 270–283 of PSAP, for 3 h and rinsed with PBS four times. After incubation with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG secondary antibody (1:200, Santa Cruz Biotechnology) for 1 h, the coverslips were washed with PBS and mounted with Vectashield mounting medium (Vector Laboratories, Inc.). Images were acquired using a confocal laser microscope (Leica TCS SP2). For cells transfected with PSAP-GFP or GFP alone, the mitochondria were labeled with MitoTracker as described above. The green fluorescence produced by PSAP-GFP or GFP alone was directly observed by confocal laser microscopy. For examination of cytochrome c release, the cytosolic extracts and mitochondria-containing fractions were prepared by permeabilization of cells with streptolysin O using the method described previously by Mosser et al. (19Mosser D.D. Caron A.W. Bourget L. Meriin A.B. Sherman M.Y. Morimoto R.I. Massie B. Mol. Cell. Biol. 2000; 20: 7146-7159Google Scholar) with slight modification. Briefly, cells (106) were washed with PBS, collected by centrifugation, and resuspended in 10 μl of streptolysin O buffer (20 mmHEPES, pH 7.5, 250 mm sucrose, 10 mm KCl, 1.5 mm MgCl2, 1 mm EDTA, 1 mm EGTA, 1 mm dithiothreitol, 0.1 mm phenylmethylsulfonyl fluoride, and 1× protease inhibitor mixture) containing 60 units of streptolysin O (Sigma). After incubation at 37 °C for 30 min, the permeabilization of cells was monitored by trypan blue staining. At the time when 95% cells were stained, permeabilized cells were pelleted by centrifugation at 16,000 × g for 15 min at 4 °C. The supernatant was collected as the cytosolic fraction and subjected to SDS-polyacrylamide gel electrophoresis (10–14%) followed by Western blotting using anti-cytochrome c antibody (PharMingen). For purification of mitochondria, cells were washed once in 10 volumes of Swell Buffer A (10.0 mm Hepes, pH 7.9, 1.5 mm MgCl2, 10.0 mm KCl, 0.5 mm dithiothreitol) and pelleted at 200 × gfor 5 min at 4 °C. The cell pellet was then resuspended in 10 volumes of Swell Buffer A and ruptured with two or three strokes in a Dounce homogenizer using a tight-fitting pestle (pestle B). Sucrose (from a 60% stock solution) was added to a final concentration of 250 mm and centrifuged at 960 × g for 5 min at 4 °C to remove unbroken cells, nuclei, and connective tissue fibers. The resulting supernatant was centrifuged at 8,600 × gfor 15 min at 4 °C to pellet the crude mitochondrial fraction. Mitochondria were further purified on sucrose gradient. The pellet containing the crude mitochondria was resuspended in 4 ml of buffer B (250 mm sucrose, 10 mm Tris-HCl, pH 7.4, and 1 mm EDTA) and layered on top of the sucrose gradients of 35, 40, 43, 46, 50, and 60% of sucrose in 5 ml of TE buffer (10 mm Tris-HCl, pH 7.4, and 1 mm EDTA). After centrifugation at 60,000 × g using a Beckman SW 28.1 rotor for 45 min at 4 °C, the gradients were fractionated with a 20-gauge/1.5 needle and washed once with three volumes of distilled water at 9600 × g at 4 °C for 15 min to dilute the sucrose. The pellet was resuspended in Buffer C (250 mmsucrose, 10 mm Tris-HCl, pH 7.4) and subjected to Western blot analysis. For analysis of poly(ADP-ribose) polymerase (PARP) cleavage, caspase-3 processing, and the ectopic expression of PS1 and PSAP, combined floating and attached cells were lysed by sonication for 20 s on ice in Western blot lysis buffer (50 mm Tris-HCl, pH 6.8, 8 m urea, 5% β-mercaptoethanol, 2% SDS, and protease inhibitors). After addition of 4× SDS sample buffer and incubation at 65 °C for 15 min, samples were subjected to SDS-polyacrylamide gel (10% for PARP and PSAP or 10–14% for caspase-3, cytochrome c, and PS1) electrophoresis and transferred to a polyvinylidene fluoride membrane (Immobilon-P, Millipore). The membranes were then probed with monoclonal antibodies against epitope myc (Invitrogen), flag (Sigma), PARP (7D3–6, BD PharMingen), caspase-3 (PharMingen), cytochromec (PharMingen), anti-PSAP or anti-PS1L and visualized by ECL-Plus (Amersham Biosciences) as described previously (15Xu X. Shi Y. Wu X. Gambetti P. Sui D. Cui M.Z. J. Biol. Chem. 1999; 274: 32543-32546Google Scholar). For immunoprecipitation, cells or purified mitochondria were lysed in immunoprecipitation lysis buffer (10 mm Tris-HCl, pH 8.0, 150 mm NaCl, 5 mm EDTA, 1.0% Triton X-100, and 1.0% Nonidet P-40) supplemented with 1 mm dithiothreitol and protease inhibitor mixture (Roche Molecular Biochemicals) on ice for 30 min. The total cell lysates or lysed mitochondria, obtained as an 18,000 × g supernatant, were incubated with anti-myc (Invitrogen), anti-PSAP, or anti-PS1L and protein A-Sepharose overnight at 4 °C. After washing three times with washing buffer (10 mm Tris-HCl, pH 8.0, 150 mm NaCl, 0.5% Triton X-100, 5 mm EDTA), the immunoprecipitates were separated by SDS-PAGE and probed with the appropriate antibodies. In an attempt to establish a cell line stably expressing PSAP, we found that, after transfection with PSAP cDNA, massive cell death occurred in the absence of the selection drugs. This suggested that PSAP could cause cell death and prompted us to examine the nature of cell death caused by overexpression of PSAP. Cells can die by either of two major mechanisms: necrosis or apoptosis. Several well established methods can be employed to reveal the observable morphological and biochemical differences between necrosis and apoptosis. We first examined the profile of DNA content using flow cytometry. HEK293 cells were transiently transfected with an expression construct, pcDNA3.1/myc-His/PSAP, which expresses a PSAP-myc fusion protein or control plasmid, pcDNA3.1/myc-His/LacZ, which encodes LacZ with a C-terminal myc tag. Twenty-four h after transfection, the expression of these transgenes was confirmed by Western blot analysis with the anti-myc antibody (Fig. 1A) and the DNA hypodiploid assays were performed by flow cytometry after DNA staining with propidium iodide. As shown in the upper panel of Fig. 1B, a significant portion of cells transfected with PSAP displayed reduced DNA content, as demonstrated by the appearance of the hypodiploid DNA peak, sub-G1 peak (indicated as peak B), at the left of the G1 peak. Cells with lighter DNA staining than that of G1 cells have been considered apoptotic (20McCarthy N.J. Evan G.I. Curr. Top. Dev. Biol. 1998; 36: 259-278Google Scholar). The percentage of cells associated with the sub-G1 peak was 18% in PSAP-transfected cells and less than 2% in LacZ-transfected cells or in cells transfected with vector only. Early observations of apoptosis revealed that cells entering apoptosis from non-mitotic parts of the cell cycle showed marked and characteristic changes in nuclear shape and organization. We next examined the effect of transient expression of PSAP on the nuclear morphological change in HEK293 cells. As shown in the lower panel of Fig. 1B, fluorescent microscopic analysis by acridine orange staining revealed that a certain number of cells exhibited nuclear condensation and fragmentation, the typical indicator of cells undergoing apoptosis (21Wyllie A.H. Nature. 1980; 284: 555-556Google Scholar). This nuclear morphology change was at the background level among cells transfected with LacZ cDNA with a myc tag. The percentage of cells with apoptotic morphology was ∼20% in cells transfected with PSAP and less than 2% in control cells transfected with LacZ cDNA (Fig. 1C). This observation is consistent with the result of the flow cytometric analysis. A similar result was observed when cell viability was determined by CellTiter 96 AQueous Assay (Promega, data not shown). The cytotoxicity of PSAP was not caused by the myc tag that was expressed as a part of the fusion protein, nor was it the result of a toxic effect of our overexpression system, because overexpression of myc-tagged LacZ protein did not induce apoptotic DNA loss or nuclear morphological change. The percentage of apoptotic cells observed (∼20%) may reflect the limitation of the efficiency of the transient transfection method used in our experiments. The transfection efficiency was determined to be 20–30% by transfecting cells with pCMV-βGal followed by a colorimetric assay (data not shown). Controlled fragmentation of genomic DNA is another hallmark of apoptosis. We further examined PSAP-induced apoptosis using a DNA laddering assay. As shown in Fig. 1D, analysis of DNA from PSAP-transfected cells demonstrated the generation of the typical nucleosomal-sized ladders of DNA fragments (lane 3). There was no detectable DNA laddering after electrophoresis of DNA from cells transfected with a negative control plasmid expressing myc-tagged LacZ protein (lane 2). To further confirm that the apoptotic cell death is caused by overexpression of PSAP, cells were transfected with a plasmid that expresses PSAP-GFP fusion protein. The expression of PSAP-GFP and the morphological change on individual cells were monitored as described under “Materials and Methods.” The expression of PSAP-GFP and GFP alone in transfected cells was also determined by Western blot analysis using a GFP-specific antibody from Clontech (data not shown). As shown in Fig. 2, only the cells expressing PSAP-GFP, but not the cells transfected with GFP alone, displayed blebbed membranes, condensed chromatin, and fragmented nuclei as indicated by arrowheads in panels A, B, and C of Fig. 2. This one-to-one correlation holds for all of the microscopic fields observed in all of three replicated experiments. These results strongly argue that only, and all of, the cells transfected with PSAP undergo apoptosis. Because cleavage of the death substrate, PARP, by activated caspase is another prominent indicator of apoptosis (22Dubrez L. Savoy I. Hamman A. Solary E. EMBO J. 1996; 15: 5504-5512Google Scholar), we also performed a time-course experiment to analyze the cleavage of PARP upon overexpression of PSAP. HEK293 cells were transfected with PSAP. At various time points, equal numbers of cells were harvested and the cleavage of PARP and the expression of PSAP were analyzed by Western blot. As shown in the top panel of Fig. 3, 8 h after transfection with PSAP, the 85-kDa fragment of PARP, which is a characteristic of apoptosis, became detectable. Similar results were also observed in HeLa cells and the human neuroblastoma cell line M17 (data not shown). The maximum cleavage of PARP was observed within 24 h after transfection. The time course of PARP cleavage is in good agreement with the time course of PSAP expression (middle panel of Fig. 3). A similar time course was also observed by flow cytometric analysis; the proportion of cells displaying sub-G1 DNA content reached a peak at 24 h after transfection (data not shown). The key effectors of apoptotic cell death are caspases, a family of cysteine proteases activated by proteolytic processing upon induction of apoptosis (23Utz P.J. Anderson P. Cell Death Differ. 2000; 7: 589-602Google Scholar). To determine whether PSAP-induced apoptosis involves caspase activation, HEK293 cells were transfected with plasmids expressing PSAP or LacZ and incubated in medium with or without the general caspase inhibitor z-VAD-fmk (100 μm, “Material and Methods”). z-VAD-fmk is a specific tetrapeptide pseudosubstrate for several caspases, including caspase-3, which could irreversibly block the caspase proteolytic cascade (24Nicholson D.W. Thornberry N.A. Trends Biochem. Sci. 1997; 22: 299-306Google Scholar). Twenty-four h after transfection, expression of myc-targeted PSAP and LacZ was detected by anti-myc antibody (panel A of Fig. 4). PSAP-induced apoptosis was evaluated by analyzing the cleavage of PARP. As shown in panel B of Fig. 4, the typical apoptotic 85-kDa fragment of PARP was detected in PSAP-transfected cells maintained in the absence of z-VAD-fmk (lane 2). The apoptotic morphological change of the PSAP-transfected cells was also observed by microscopy (data not shown). In contrast, no PARP cleavage was detected in PSAP-transfected cells maintained in the presence of z-VAD-fmk (lane 3), indicating PSAP-induced apoptosis is caspase-dependent and can be blocked by a general caspase inhibitor. As expected, cleavage of PARP was not detected in the control cells transfected with LacZ (lane 1) or untransfected cells (lane 4). To test whether PSAP-induced cell death involves activation of effector caspases, such as caspase-3, lysates from cells transfected with PSAP or LacZ were analyzed by Western blot using an antibody that recognizes both pro- and activated caspase-3. As shown in panel C of Fig. 4, the active forms of caspase-3, as indicated byarrowheads, were indeed detected in PSAP-transfected cells maintained in the absence of z-VAD-fmk (lane 2), but not in the LacZ-transfected cells (lane 1). It is notable that the active forms of caspase-3 were not detectable in PSAP-transfected cells maintained in the presence of z-VAD-fmk (lane 3). Taken together, these data suggest that PSAP-induced cell death was mediated by caspase activation. As caspase-3 is one of the main effector caspases and is activated in response to both intracellular and extracellular death signals, its activation also provided additional evidence that" @default.
• W2000923801 created "2016-06-24" @default.
• W2000923801 creator A5013977026 @default.
• W2000923801 creator A5019920561 @default.
• W2000923801 creator A5037787297 @default.
• W2000923801 creator A5041282316 @default.
• W2000923801 creator A5044246398 @default.
• W2000923801 creator A5051282646 @default.
• W2000923801 creator A5059777512 @default.
• W2000923801 creator A5062624262 @default.
• W2000923801 creator A5090642719 @default.
• W2000923801 date "2002-12-01" @default.
• W2000923801 modified "2023-09-27" @default.
• W2000923801 title "The Novel Presenilin-1-associated Protein Is a Proapoptotic Mitochondrial Protein" @default.
• W2000923801 cites W107210068 @default.
• W2000923801 cites W1265747563 @default.
• W2000923801 cites W1526586150 @default.
• W2000923801 cites W1534001036 @default.
• W2000923801 cites W1546570611 @default.
• W2000923801 cites W1605460006 @default.
• W2000923801 cites W1611341694 @default.
• W2000923801 cites W1689925871 @default.
• W2000923801 cites W1799837960 @default.
• W2000923801 cites W185991631 @default.
• W2000923801 cites W1950983788 @default.
• W2000923801 cites W1967566501 @default.
• W2000923801 cites W1969810313 @default.
• W2000923801 cites W1973109581 @default.
• W2000923801 cites W1979995768 @default.
• W2000923801 cites W1987942848 @default.
• W2000923801 cites W1994021407 @default.
• W2000923801 cites W1996599959 @default.
• W2000923801 cites W2005681172 @default.
• W2000923801 cites W2010710842 @default.
• W2000923801 cites W2016777985 @default.
• W2000923801 cites W2019850921 @default.
• W2000923801 cites W2025242397 @default.
• W2000923801 cites W2026512409 @default.
• W2000923801 cites W2028409421 @default.
• W2000923801 cites W2032336829 @default.
• W2000923801 cites W2034796667 @default.
• W2000923801 cites W2035176443 @default.
• W2000923801 cites W2038114873 @default.
• W2000923801 cites W2038681771 @default.
• W2000923801 cites W2041148032 @default.
• W2000923801 cites W2041685210 @default.
• W2000923801 cites W2049110705 @default.
• W2000923801 cites W2049130898 @default.
• W2000923801 cites W2053156705 @default.
• W2000923801 cites W2054959963 @default.
• W2000923801 cites W2055804951 @default.
• W2000923801 cites W2062807784 @default.
• W2000923801 cites W2062853648 @default.
• W2000923801 cites W2072277566 @default.
• W2000923801 cites W2077674018 @default.
• W2000923801 cites W2077987011 @default.
• W2000923801 cites W2081733923 @default.
• W2000923801 cites W2081998222 @default.
• W2000923801 cites W2084609653 @default.
• W2000923801 cites W2095745901 @default.
• W2000923801 cites W2101077392 @default.
• W2000923801 cites W2113999599 @default.
• W2000923801 cites W2119683782 @default.
• W2000923801 cites W2124784466 @default.
• W2000923801 cites W2128738810 @default.
• W2000923801 cites W2136825556 @default.
• W2000923801 cites W2144558114 @default.
• W2000923801 cites W2156292819 @default.
• W2000923801 cites W2158398965 @default.
• W2000923801 cites W2158714788 @default.
• W2000923801 cites W2165451456 @default.
• W2000923801 cites W2168601768 @default.
• W2000923801 cites W2169152986 @default.
• W2000923801 doi "https://doi.org/10.1074/jbc.m209613200" @default.
• W2000923801 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12377771" @default.
• W2000923801 hasPublicationYear "2002" @default.
• W2000923801 type Work @default.
• W2000923801 sameAs 2000923801 @default.
• W2000923801 citedByCount "57" @default.
• W2000923801 countsByYear W20009238012012 @default.
• W2000923801 countsByYear W20009238012013 @default.
• W2000923801 countsByYear W20009238012015 @default.
• W2000923801 countsByYear W20009238012016 @default.
• W2000923801 countsByYear W20009238012017 @default.
• W2000923801 countsByYear W20009238012019 @default.
• W2000923801 countsByYear W20009238012020 @default.
• W2000923801 countsByYear W20009238012021 @default.
• W2000923801 countsByYear W20009238012022 @default.
• W2000923801 countsByYear W20009238012023 @default.
• W2000923801 crossrefType "journal-article" @default.
• W2000923801 hasAuthorship W2000923801A5013977026 @default.
• W2000923801 hasAuthorship W2000923801A5019920561 @default.
• W2000923801 hasAuthorship W2000923801A5037787297 @default.
• W2000923801 hasAuthorship W2000923801A5041282316 @default.
• W2000923801 hasAuthorship W2000923801A5044246398 @default.
• W2000923801 hasAuthorship W2000923801A5051282646 @default.
• W2000923801 hasAuthorship W2000923801A5059777512 @default.
• W2000923801 hasAuthorship W2000923801A5062624262 @default.

• next