FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2002022705> ?p ?o ?g. }

• W2002022705 endingPage "4034" @default.
• W2002022705 startingPage "4021" @default.
• W2002022705 abstract "Glucocorticoids (GCs) have a long history of use as therapeutic agents for numerous skin diseases. Surprisingly, their specific molecular effects are largely unknown. To characterize GC action in epidermis, we compared the transcriptional profiles of primary human keratinocytes untreated and treated with dexamethasone (DEX) for 1, 4, 24, 48, and 72 h using large scale microarray analyses. The majority of genes were found to be regulated only after 24 h and remained regulated throughout treatment. In addition to regulation of the expected pro-inflammatory genes, we found that GCs regulate cell fate, tissue remodeling, cell motility, differentiation, and metabolism. GCs suppress the expression of essentially all IFNγ-regulated genes, including IFNγ receptor and STAT-1, an effect that was previously unknown. GCs also block STAT-1 activation and nuclear translocation. Unexpectedly, GCs induce the expression of anti-apoptotic genes and repress pro-apoptotic ones, preventing UV-induced keratinocyte apoptosis. Consequently, treatment with GCs blocked UV-induced apoptosis of keratinocytes. GCs have profound effect on wound healing by inhibiting cell motility and the expression of the proangiogenic factor, vascular endothelial growth factor. They play an important role in tissue remodeling and scar formation by suppressing the expression of TGFβ1 and -2 and MMP1, -2, -9, and -10 and inducing TIMP-2. Finally, GCs promote terminal epidermal differentiation while simultaneously inhibiting early stage differentiation. These results provide new insights into the beneficial and adverse effects of GCs in the epidermis, defining the participating genes and mechanisms that coordinate the cellular responses important for GC-based therapies. Glucocorticoids (GCs) have a long history of use as therapeutic agents for numerous skin diseases. Surprisingly, their specific molecular effects are largely unknown. To characterize GC action in epidermis, we compared the transcriptional profiles of primary human keratinocytes untreated and treated with dexamethasone (DEX) for 1, 4, 24, 48, and 72 h using large scale microarray analyses. The majority of genes were found to be regulated only after 24 h and remained regulated throughout treatment. In addition to regulation of the expected pro-inflammatory genes, we found that GCs regulate cell fate, tissue remodeling, cell motility, differentiation, and metabolism. GCs suppress the expression of essentially all IFNγ-regulated genes, including IFNγ receptor and STAT-1, an effect that was previously unknown. GCs also block STAT-1 activation and nuclear translocation. Unexpectedly, GCs induce the expression of anti-apoptotic genes and repress pro-apoptotic ones, preventing UV-induced keratinocyte apoptosis. Consequently, treatment with GCs blocked UV-induced apoptosis of keratinocytes. GCs have profound effect on wound healing by inhibiting cell motility and the expression of the proangiogenic factor, vascular endothelial growth factor. They play an important role in tissue remodeling and scar formation by suppressing the expression of TGFβ1 and -2 and MMP1, -2, -9, and -10 and inducing TIMP-2. Finally, GCs promote terminal epidermal differentiation while simultaneously inhibiting early stage differentiation. These results provide new insights into the beneficial and adverse effects of GCs in the epidermis, defining the participating genes and mechanisms that coordinate the cellular responses important for GC-based therapies. GCs 5The abbreviations used are: GC, glucocorticoid; ECM, extracellular matrix; GR, glucocorticoid receptor; TNF, tumor necrosis factor; STAT, signal transducers and activators of transcription; DEX, dexamethasone; RT, reverse transcription; TUNEL, terminal dUTP nick end labeling; MMP, matrix metalloproteinase; TGF, transforming growth factor; IFNγ, interferon-γ; IL, interleukin; C/EBP, CCAAT enhancer-binding protein; ERK, extracellular signal regulated kinase. 5The abbreviations used are: GC, glucocorticoid; ECM, extracellular matrix; GR, glucocorticoid receptor; TNF, tumor necrosis factor; STAT, signal transducers and activators of transcription; DEX, dexamethasone; RT, reverse transcription; TUNEL, terminal dUTP nick end labeling; MMP, matrix metalloproteinase; TGF, transforming growth factor; IFNγ, interferon-γ; IL, interleukin; C/EBP, CCAAT enhancer-binding protein; ERK, extracellular signal regulated kinase. play a key role in regulating diverse physiological processes, such as metabolism, salt, and water balance, cell proliferation, differentiation, inflammation, and immune response. Because of their systemic effects on multiple targets, GCs affect many tissues differentially. They are widely used for their anti-inflammatory effects in treating asthma, systemic lupus erythematosus, rheumatoid arthritis, transplant patients, psoriasis, etc., but the mechanism of their action in skin has not been fully understood. Topical GC therapy was introduced by Sulzberger and Witten in 1952 (see Ref. 1Baumann L. Kerdel F. Freedberg I.M. Eisen A.Z. Wolff K. Austen F.K. Goldsmith L.A. Katz S.I. Fitzpatrick T.B. Fitzpatrick's Dermatology in General Medicine. 2. McGraw-Hill Inc., New York1999: 2713-2717Google Scholar) and has been used since in the treatment of many dermatological diseases, including psoriasis, atopic and seborrheic dermatitis, intertrigo, and eczema. The side effects of systemic GC therapy have been identified for many tissues and organs, including skin, and may result in what was clinically described as Cushing's syndrome (2Fehm H.L. Voigt K.H. Pathobiol. Annu. 1979; 9: 225-255PubMed Google Scholar). Corticosteroids with higher potency may cause severe side effects after topical application, including irreversible striae, skin atrophy, steroid acne, and perioral and periocular dermatitis. Delayed wound healing following steroid therapy is a well known side effect (3Wicke C. Halliday B. Allen D. Roche N.S. Scheuenstuhl H. Spencer M.M. Roberts A.B. Hunt T.K. Arch. Surg. 2000; 135: 1265-1270Crossref PubMed Scopus (244) Google Scholar). Most of the known effects of GCs are thought to be dermal, including suppression of fibroblast proliferation, collagen turnover, and other ECM components (4Schacke H. Docke W.D. Asadullah K. Pharmacol. Ther. 2002; 96: 23-43Crossref PubMed Scopus (1353) Google Scholar, 5Autio P. Karjalainen J. Risteli L. Risteli J. Kiistala U. Oikarinen A. Am. J. Respir. Crit. Care Med. 1996; 153: 1172-1175Crossref PubMed Scopus (47) Google Scholar, 6Ekblom M. Fassler R. Tomasini-Johansson B. Nilsson K. Ekblom P. J. Cell Biol. 1993; 123: 1037-1045Crossref PubMed Scopus (68) Google Scholar, 7Fassler R. Sasaki T. Timpl R. Chu M.L. Werner S. Exp. Cell Res. 1996; 222: 111-116Crossref PubMed Scopus (87) Google Scholar, 8Perez P. Page A. Bravo A. Del Rio M. Gimenez-Conti I. Budunova I. Slaga T.J. Jorcano J.L. FASEB J. 2001; 15: 2030-2032Crossref PubMed Scopus (70) Google Scholar, 9Sarnstrand B. Brattsand R. Malmstrom A. J. Invest. Dermatol. 1982; 79: 412-417Abstract Full Text PDF PubMed Scopus (33) Google Scholar). Epidermal keratinocytes also have important immunologic functions (10Kupper T.S. J. Invest. Dermatol. 1990; 94: 146S-150SAbstract Full Text PDF PubMed Scopus (178) Google Scholar, 11Kondo S. J. Investig. Dermatol. Symp. Proc. 1999; 4: 177-183Abstract Full Text PDF PubMed Scopus (87) Google Scholar, 12Steinhoff M. Brzoska T. Luger T.A. Curr. Opin. Allergy Clin. Immunol. 2001; 1: 469-476Crossref PubMed Scopus (72) Google Scholar), many of which are affected by GCs (for a review, see Ref. 13Lee B. Tomic-Canic M. Krstic-Demonacos M. Demonacos C. Molecular Mechanisms of Action of Steroid Hormone Receptors. Research Signpost, Kerala, India2002: 1-25Google Scholar). At the molecular level, GCs act through “pluripotent” glucocorticoid receptors (GRs) that may be active in various cellular compartments: membrane, cytoplasm, and nucleus (13Lee B. Tomic-Canic M. Krstic-Demonacos M. Demonacos C. Molecular Mechanisms of Action of Steroid Hormone Receptors. Research Signpost, Kerala, India2002: 1-25Google Scholar, 14Yudt M.R. Cidlowski J.A. Mol. Endocrinol. 2001; 15: 1093-1103Crossref PubMed Scopus (122) Google Scholar, 15Watson C.S. Lange C.A. EMBO Rep. 2005; 6: 116-119Crossref PubMed Scopus (17) Google Scholar). In addition to operating as a transcription factor that directly binds promoter elements, GR also interacts with and affects the activity of a variety of transcription factors, thus affecting transcriptional potency of many signaling pathways, such as TNFα or epidermal growth factor (16Zhou J. Cidlowski J.A. Steroids. 2005; 70: 407-417Crossref PubMed Scopus (302) Google Scholar). We have shown previously that GR represses the expression of epidermal keratin genes. This transcriptional regulation is mediated through a unique molecular mechanism that involves four GR monomers (17Jho S.H. Radoja N. Im M.J. Tomic-Canic M. J. Biol. Chem. 2001; 276: 45914-45920Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 18Radoja N. Komine M. Jho S.H. Blumenberg M. Tomic-Canic M. Mol. Cell Biol. 2000; 20: 4328-4339Crossref PubMed Scopus (79) Google Scholar). In this conformation and DNA context, β-catenin and arginine methyltransferase (CARM-1), act as co-repressors of GR (19Stojadinovic O. Brem H. Vouthounis C. Lee B. Fallon J. Stallcup M. Merchant A. Galiano R.D. Tomic-Canic M. Am. J. Pathol. 2005; 167: 59-69Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar). We found GR inhibition to be dominant over epidermal growth factor receptor activation, leading to inhibition of keratinocyte migration and contributing to the inhibition of wound healing (20Lee B. Vouthounis C. Stojadinovic O. Brem H. Im M. Tomic-Canic M. J. Mol. Biol. 2005; 345: 1083-1097Crossref PubMed Scopus (50) Google Scholar). The complex mechanism involving the transcriptional regulation of epidermal genes by GR is derived from the structure and the sequence of the response element, the conformation of the receptor and its modifications, the availability and the type of the interaction with co-regulators, and histone-modifying enzymes. To identify the tissue-specific transcriptional effects of GCs on epidermis, we utilized a large scale microarray. We found that the initial response of keratinocytes to treatment with GCs (1-4 h) involved a small number of regulated genes and focused only on three processes: transcription/signaling, cell fate, and metabolism. After the first 24 h, the response is expanded to multiple functional groups of genes, and many cellular processes are affected, including inflammation, apoptosis, cell migration, metabolism, and differentiation. Specifically, GCs inhibit keratinocyte proliferation, migration, and early stages of differentiation while inducing late differentiation. Unexpectedly, GCs seem to have an anti-apoptotic effect on keratinocytes by inducing anti-apoptotic genes and suppressing proapoptotic genes. Another surprising finding regards the potent inhibition of the IFNγ response, resulting in suppression of IFNγ expression, the IFNγ receptor, and both expression and activation of STAT-1. To the best of our knowledge, such a profound effect of GCs on the IFNγ pathway has not previously been reported in any other tissue. Taken together, these results indicate that GCs affect a wide range of processes that include not only anti-inflammatory responses but also epidermal differentiation, remodeling, metabolism and cell fate, all of which have important clinical implications in treating dermatologic disorders. Human Keratinocyte Cultures—Keratinocytes were maintained as previously published (20Lee B. Vouthounis C. Stojadinovic O. Brem H. Im M. Tomic-Canic M. J. Mol. Biol. 2005; 345: 1083-1097Crossref PubMed Scopus (50) Google Scholar), in serum-free keratinocyte medium with epidermal growth factor (Gibco), bovine pituitary extract (Gibco), and antibiotic-antimycotic (Gibco) both in the presence and absence of 0.1 μm DEX (Sigma). This hormone concentration has been shown to saturate the receptor and have a potent transcriptional effect on keratinocytes (18Radoja N. Komine M. Jho S.H. Blumenberg M. Tomic-Canic M. Mol. Cell Biol. 2000; 20: 4328-4339Crossref PubMed Scopus (79) Google Scholar, 20Lee B. Vouthounis C. Stojadinovic O. Brem H. Im M. Tomic-Canic M. J. Mol. Biol. 2005; 345: 1083-1097Crossref PubMed Scopus (50) Google Scholar). The experiment was repeated twice using newly generated cultures. A paired set of treated and untreated cells was harvested for each time point, 1, 4, 24, 48, and 72 h, using 0.4% trypsin (Gibco) and stored in RNAlater (Ambion). Total RNA Isolation—Total RNA was isolated using RNeasy (Qiagen). Northern blot analysis was done to assess the quality of mRNA isolated. 5 μg of total RNA was reverse-transcribed, amplified, and labeled according to the protocol (21Li D. Turi T.G. Schuck A. Freedberg I.M. Khitrov G. Blumenberg M. FASEB J. 2001; 15: 2533-2535Crossref PubMed Scopus (111) Google Scholar). Labeled cRNA was hybridized to HGU95Av2 arrays (Affymetrix), and arrays were washed and stained with anti-biotin streptavidinphycoerythin-labeled antibody using an Affymetrix fluidics station and then scanned using the Agilent GeneArray Scanner system (Hewlett-Packard). Microarray—Microarray Suite 5.0 (Affymetrix) was used for data extraction and for further analysis. Data mining tool 3.0 (Affymetrix) and GeneSpring™ software 5.1 (Silicon Genetics) were used for normalization, -fold change calculations, and clustering. To compare data from multiple arrays, the signal of each probe array was scaled to the same target intensity value. The microarray experiments were repeated with high reproducibility Fig. 1. -Fold changes obtained from the first and second experiments were averaged. Genes were considered regulated if expression levels differed more than 2-fold relative to untreated control at any time point. Using GeneSpring™, clustering was performed based on experiments or the expression profiles of individual genes. Functional annotation of regulated genes was performed as before (22Banno T. Adachi M. Mukkamala L. Blumenberg M. Antivir. Ther. 2003; 8: 541-554PubMed Google Scholar, 23Gazel A. Ramphal P. Rosdy M. De Wever B. Tornier C. Hosein N. Lee B. Tomic-Canic M. Blumenberg M. J. Invest. Dermatol. 2003; 121: 1459-1468Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). The L2L program was used to identify the biological processes, molecular functions, and cell components of differentially expressed genes (24Newman J.C. Weiner A.M. Genome Biol. 2005; 6: 81-98Crossref PubMed Google Scholar). The parameters of the program were calibrated using a set of identified NFκB-regulated genes (25Banno T. Gazel A. Blumenberg M. J. Biol. Chem. 2005; 280: 18973-18980Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). RT-PCR—RNA isolation and purification was performed using Triazol (Invitrogen) extraction and subsequent Qiagen RNeasy kit column purification (Qiagen), followed by Northern blot as described (18Radoja N. Komine M. Jho S.H. Blumenberg M. Tomic-Canic M. Mol. Cell Biol. 2000; 20: 4328-4339Crossref PubMed Scopus (79) Google Scholar). Reverse transcription was performed using the SuperScript™ first strand synthesis system for RT-PCR (Invitrogen). Primer sequences were as follows: TTCTCTCCCTTCCTCTCTCC (Bak1-fw), ACTCCCTACTCCTTTTCCC (Bak1-rev), TGTCTACACTTAGCCTCTATCC (IκB-fw), ATCAGCCCCACATTCAAC (IκB-rev), TTGATAGAGTGTGGGGTGGG (TRADD-fw), ATCATTGCTTAACATTCGGGG (TRADD-rev), CCAACCTGAAAACCCACAC (BCL6-fw), ACGAAAGCATCAACACTCC (BCL6-rev), TCTCTGCCCACAGTCTTTCC (SFRP1-fw), TCACCCAATTTCACAATTCACC (SFRP1-rev), GACAGCAAAAATGACCCACC (EEF1A1-fw), ACAGCAAAGCGACCCAAAG (EEF1A1-rev), ACACCTCGTCAAACTCCTC (STAT1-rev), ACTTTCTGCTGTTACTTTCCC (STAT1-fw), GAGCAAACACATCTGACCTAC (MMP1-fw), CAAAATGAGCATCCCCTCC (MMP1-rev), CACTACTGTGCCTTTGAGTCC (MMP9-), ATCGCCAGTACTTCCCATCC (MMP9-revfw), TGCCCACAAAATCTGTTCC (MMP10-fw), and AACCTGCTTGTACCTCATTTC (MMP10-rev). Reverse transcription and amplification were carried out by incubation at 50 °C for 50 min. Initial PCR denaturation took place at 94 °C for 15 min, followed by 24-30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, initial polymerization at 72 °C for 1 min, and a final polymerization at 72 °C for 7 min. The numbers of cycles of amplification (24Newman J.C. Weiner A.M. Genome Biol. 2005; 6: 81-98Crossref PubMed Google Scholar, 27Dale B.A. Holbrook K.A. Kimball J.R. Hoff M. Sun T.T. J. Cell Biol. 1985; 101: 1257-1269Crossref PubMed Scopus (225) Google Scholar, and 30Baeuerle P.A. Baltimore D. Science. 1988; 242: 540-546Crossref PubMed Scopus (1682) Google Scholar) were selected to detect amplified products in the exponential phase. Samples were separated by electrophoresis on 2% agarose gels containing 0.5 μg/ml of ethidium bromide (Sigma) and were visualized under UV light. Quantitative RT-PCR—Total RNA was reverse transcribed with SuperScript II reverse transcriptase (Invitrogen). The cDNA was amplified using SYBR-Green PCR Master Mix (Applied Biosystems) in an ABI 7900HT sequence detection system (Applied Biosystems). The primers used for PCR analysis were as follows: JAG1 (AATACATGTGGCCATTTCTGC, TGATTTCCTTGATCGGGTTC), TIMP1 (ACACTGTTGGCTGTGAGGAA, GTTTGCAGGGGATGGATAAA), IL-4R (GGGTCACAGTGGGAGAAGC, CAGGGCAAGAGCTTGGTAAG), LAMC2 (ACACATTAGACGGCCTCCTG, CCAGCCCCTCTTCATCTACA), FLNA (CAGTAGACTGCAGCAAAGCAG, ATGAACCCCCACCAGCAG), S100A7 (GGAGAACTTCCCCAACTTCC, ACATCGGCGAGGTAATTTGT), and EEF1A1 (CAAGCCCATGTGTGTTGAGA, CCACCGCAACTGTCTGTCT). The relative changes of gene expression were estimated and normalized to EEF1A1 by using the 2-ΔΔCT method (26Livak K. Schmittgen T. Methods. 2001; 25: 402-408Crossref PubMed Scopus (121088) Google Scholar). Histology and Immunocytochemistry—Keratinocytes were grown on coverslips to 70% confluence. Cells were incubated for 24 h in a basal serum-free medium (custom made without hydrocortisone) and treated as follows: 0.1 μm DEX (Sigma), INF-γ 100 ng/ml (Sigma), DEX and INF-γ simulatneously for 72 h, pretreated with DEX for 24 h, and treated with INF-γ for the next 48 h or pretreated with INF-γ for 24 h and treated with DEX for 72 h. Cells were fixed in acetone-methanol (1:1) for 2 min, permeabilized with 0.1% Triton X-100 for 10 min, and stained using STAT-1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Human skin specimens were obtained from reduction mammoplasty following an approved protocol and treated for 24, 48, and 72 h as previously described (20Lee B. Vouthounis C. Stojadinovic O. Brem H. Im M. Tomic-Canic M. J. Mol. Biol. 2005; 345: 1083-1097Crossref PubMed Scopus (50) Google Scholar). After incubation, skin biopsies were embedded in OCT compound (Tissue Tek) and frozen in liquid nitrogen. Five-micrometer-thick skin sections were cut with a cryostat (Jung Frigocut 28006; Leica) and stored at -80 °C. Slides containing frozen sections were fixed in a cold acetone and blocked with 3% bovine serum albumin diluted in 1× phosphate-buffered saline for 30 min. The following primary antibodies were as follows: monoclonal antibody against Filaggrin 1:1000 (Gift from Dr. Sun) (27Dale B.A. Holbrook K.A. Kimball J.R. Hoff M. Sun T.T. J. Cell Biol. 1985; 101: 1257-1269Crossref PubMed Scopus (225) Google Scholar) and Involucrin 1:400 (NeoMarkers) and polyclonal antibody against STAT-1 (1:500; Santa Cruz Biotechnology). These were used for overnight incubation at +4 °C. Signal was visualized using secondary fluorescein isothiocyanate anti-mouse or anti-rabbit secondary antibody 1:200 (Molecular Probes). Slides were mounted with mounting medium containing propidium iodide (Vector Laboratories). For staining with p65 antibody, 1:100 (Santa Cruz Biotechnology) skin samples treated with 0.1 μm DEX or 100 ng/ml TNFα (Sigma) or pretreated with DEX for 24 h and treated with TNFα for the next 24 h were embedded in paraffin and stained following a previously published protocol (19Stojadinovic O. Brem H. Vouthounis C. Lee B. Fallon J. Stallcup M. Merchant A. Galiano R.D. Tomic-Canic M. Am. J. Pathol. 2005; 167: 59-69Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar). All negative controls were prepared by substitution of the primary antibody with phosphate-buffered saline. Staining was analyzed using a Carl Zeiss microscope, and digital images were collected using the Adobe TWAIN_32 program. Three laboratory members blinded for the experiment performed quantification of the nuclei positive for STAT-1. The average and the S.D. values were calculated. All experiments were performed in triplicates, where 3-5 images/condition/time point were quantified. Western Blotting—Keratinocytes were incubated with or without DEX (0.1 μm) for 0, 1, 24, 48, and 72 h, and total protein extracts were obtained for each time point using a standard protocol (28Szell M. Bata-Csorgo Z. Koreck A. Pivarcsi A. Polyanka H. Szeg C. Gaal M. Dobozy A. Kemeny L. J. Invest. Dermatol. 2004; 123: 537-546Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). 25 μg of each protein extract was electrophoresed in a 7.5% SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane (BioScience). The membrane was then incubated with Abs to STAT-1 (Santa Cruz Biotechnology) and β-tubulin (Santa Cruz Biotechnology). After the incubation with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology), the immune complexes were visualized using Super Signal West Pico Chemiluminescent substrate (Pierce) and exposed on x-ray film (Eastman Kodak Co. Bio Max MR-Film) according to the manufacturer's instructions. Proliferation Assay—Keratinocytes were seeded in 0.75-cm2 dishes at a concentration of 1100 cells/well and incubated in the keratinocyte basal media without hydorcortizone (Invitrogen) 24 h prior to treatment. Keratinocytes were incubated in the presence or absence of 0.1 μm DEX (Sigma) for 24, 48, and 72 h and harvested by trypsinization. Growth curves were established from triplicate experiments by three laboratory members blinded to the experiment by counting cell numbers per cm2 at the each time point using a hemocytometer (Hausser Scientific). Statistical significance was determined using a standard t test. Keratinocyte Treatment and TUNEL Assay—Cells were incubated for 24 h in a basal serum-free medium (custom made without hydrocortisone) before the experiment. On the day of the experiment, cells were incubated in the presence or absence of 0.1 μm DEX (Sigma) for 24 h (for the pretreatment condition), medium was removed from the cell cultures, and keratinocytes were irradiated with UVB irradiation (8 mJ/cm2) (Stratagene 2000 illuminator, UV Stratalinker 24000) (21Li D. Turi T.G. Schuck A. Freedberg I.M. Khitrov G. Blumenberg M. FASEB J. 2001; 15: 2533-2535Crossref PubMed Scopus (111) Google Scholar). Cells were then incubated for 48 h in the basal keratinocyte medium and fixed for the TUNEL assay. The TUNEL assay was performed following a commercial protocol for the in situ cell death detection kit (TMR red) (Roche Applied Science). Cells were then mounted on slides using Dako flourescent mounting medium (DAKO Corp.) and examined using a microscope (Carl Zeiss) and Adobe Photoshop TWAIN_32 program. All experiments were performed in triplicates. Three laboratory members blinded to the experiment counted apoptotic cells in 3-5 images/condition, and S.D. values were calculated. Global Transcriptional Changes after Glucocorticoid Treatment of Primary Human Keratinocytes—To identify the effects of GCs in epidermis, we treated primary human keratinocytes with 0.1 μm DEX for 1, 4, 24, 48, and 72 h, isolated and labeled mRNA, and hybridized it to Affymetrix HU95A chips. Of 12,653 total analyzed genes, 6,285 were found expressed in skin (49.7%). This is in agreement with results from other laboratories (21Li D. Turi T.G. Schuck A. Freedberg I.M. Khitrov G. Blumenberg M. FASEB J. 2001; 15: 2533-2535Crossref PubMed Scopus (111) Google Scholar, 29Iyer V.R. Eisen M.B. Ross D.T. Schuler G. Moore T. Lee J.C. Trent J.M. Staudt L.M. Hudson Jr., J. Boguski M.S. Lashkari D. Shalon D. Botstein D. Brown P.O. Science. 1999; 283: 83-87Crossref PubMed Scopus (1718) Google Scholar). The majority of the GC-regulated genes were suppressed rather than induced. Of the 394 genes that were consistently regulated (6.3% of the total expressed in skin), 128 genes were induced, and 266 genes were suppressed. To compare experiments at different time points, cluster analysis was performed using Genespring™ 5.1, with each time point being a separate experiment. We found striking similarities among the 24, 48, and 72-h regulated genes. The most extensive regulation occurred at 24 h, where 172 genes were regulated. Most genes regulated by GCs at 24 h remained regulated until 72 h; after 48 h, only 15 of the 172 genes were not regulated, and 157 of these remained regulated even at 72 h of treatment. In addition, 125 and 74 new genes were regulated at 48 and 72 h, respectively. Very few genes were affected at 1 and 4 h. GCs affected only 23 genes at 1 h; signal transduction, cell fate, and metabolism were the predominant functional gene groups regulated. Inhibitor of κB (NFKBIA) was one of the earliest induced genes at 1 h. The same functional groups were regulated at 4 h, yet the number of regulated genes increased to a total of 64 (Table 1).TABLE 1List of genes regulated by GCs in the first 4 h of treatment Open table in a new tab To understand how GCs regulate cellular processes in keratinocytes, we summarized the microarray data in such a way that genes are clustered by their cellular functions (see below). Furthermore, we grouped several cellular functions into cellular processes, which resulted in the specific hierarchal tables summarized in Table 2. Overall, we found the genes that are involved in apoptosis, cell cycle, cornified envelope, cytoskeleton, DNA repair, ECM, interferon signaling, junctions, kinases, membrane protein, proteolysis, receptor, RNA metabolism, and secretion to be predominantly suppressed. We also found that genes involved in transcriptional regulation are among those induced by GC treatment (supplemental Tables 4-8).TABLE 2Summary list of GC-regulated genes after treatment for 24-72 h Open table in a new tab We performed real time RT-PCR to evaluate the results obtained from microarrays and found that data generated by both methods are in agreement for all of the genes tested (Fig. 2). As expected, results obtained by real time RT-PCR followed the pattern of the microarray data but were more pronounced, a predictable result, considering the more sensitive method of mRNA detection. Comparison of the lists of differentially expressed genes with their assigned ontology functions confirms the above analysis (Table 3). This is particularly apparent in the biological process category, where GCs induced the regulators of transcription, whereas they suppressed immune response and related processes. Similarly, the molecular functions overrepresented in the induced genes contain transcription factors and signaling proteins, whereas among suppressed genes the proteolysis inhibitors are significantly overrepresented. Correspondingly, the nuclear components are predominant in the induced set, whereas the extracellular matrix genes are suppressed by GCs.TABLE 3Ontological categories of GC-regulated genes Open table in a new tab We have described here the expression changes that glucocorticoid treatment exerts on the principal cellular components of epidermal tissue, primary human keratinocytes, thus providing a comprehensive view of the set of genes and cellular processes that are affected by GC treatment. Furthermore, we have described novel actions of GCs in epidermal keratinocytes, since we discovered a wide spectrum of genes affecting additional cellular processes that have not been associated previously with GCs. Specifically, we found that GCs inhibit apoptosis and block antigen presentation, tissue repair and remodeling, metabolism, keratinocyte migration and proliferation, differentiation, and cell fate control. Below, we focused on the analyses of specific gene groups and cellular processes regulated by GC treatment. Inflammation and Innate Immunity—GCs are known as major anti-inflammatory agents, and this served as a control for our experiments. A summary of microarray results is presented in supplemental Table 4. We found that within the first1hof treatment and throughout all time points, GCs induce the expression of IkB, suggesting early effects on NFκB inhibition (30Baeuerle P.A. Baltimore D. Science. 1988; 242: 540-546Crossref PubMed Scopus (1682) Google Scholar). We did not find either NFκB components (such as p65 or p50) or TNFα ligand and receptor to be regulated. The inhibitory effects of GCs on pro-inflammatory processes include repression of interleukin signaling, specifically the expression of IL-1β, IL-4 receptor, and IL-11 genes after 24 h. It was surprising that other than inducing IκB, GCs did not regulate transcription of other TNFα signaling molecules. There are several molecular mechanisms through which GR-mediated inhibition of NFκB may be accomplished, reflecting tissue-specific effects (31De Bosscher K. Vanden Berghe W. Haegeman G. J. Neuroimmunol. 2000; 109: 16-22Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 32Doucas V. Shi Y. Miyamoto S. West A. Verma I. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11893-11898Crossref PubMed Scopus (101) Google Scholar, 33Yamamoto Y. Gaynor R.B. J. Clin. Invest. 2001; 107: 135-142Crossref PubMed Scopus (1340) Google Scholar, 34Auphan N. DiDonato J" @default.
• W2002022705 created "2016-06-24" @default.
• W2002022705 creator A5024159607 @default.
• W2002022705 creator A5046301485 @default.
• W2002022705 creator A5053553963 @default.
• W2002022705 creator A5055229535 @default.
• W2002022705 creator A5065595754 @default.
• W2002022705 creator A5068471387 @default.
• W2002022705 creator A5082310998 @default.
• W2002022705 creator A5085430923 @default.
• W2002022705 date "2007-02-01" @default.
• W2002022705 modified "2023-10-18" @default.
• W2002022705 title "Novel Genomic Effects of Glucocorticoids in Epidermal Keratinocytes" @default.
• W2002022705 cites W1497205269 @default.
• W2002022705 cites W1513329088 @default.
• W2002022705 cites W1522773084 @default.
• W2002022705 cites W1582124530 @default.
• W2002022705 cites W1717444875 @default.
• W2002022705 cites W1890219806 @default.
• W2002022705 cites W1948304169 @default.
• W2002022705 cites W1969769042 @default.
• W2002022705 cites W1970259819 @default.
• W2002022705 cites W1973378885 @default.
• W2002022705 cites W1973716228 @default.
• W2002022705 cites W1977093178 @default.
• W2002022705 cites W1985176515 @default.
• W2002022705 cites W1987822574 @default.
• W2002022705 cites W1990491312 @default.
• W2002022705 cites W1997103341 @default.
• W2002022705 cites W1999918470 @default.
• W2002022705 cites W2000011436 @default.
• W2002022705 cites W2000464317 @default.
• W2002022705 cites W2002435934 @default.
• W2002022705 cites W2003274919 @default.
• W2002022705 cites W2005699555 @default.
• W2002022705 cites W2005803418 @default.
• W2002022705 cites W2006308125 @default.
• W2002022705 cites W2006526127 @default.
• W2002022705 cites W2007290197 @default.
• W2002022705 cites W2008781112 @default.
• W2002022705 cites W2013755857 @default.
• W2002022705 cites W2023817599 @default.
• W2002022705 cites W2028189849 @default.
• W2002022705 cites W2035498695 @default.
• W2002022705 cites W2040501397 @default.
• W2002022705 cites W2056582616 @default.
• W2002022705 cites W2058971952 @default.
• W2002022705 cites W2061903251 @default.
• W2002022705 cites W2064923609 @default.
• W2002022705 cites W2067772036 @default.
• W2002022705 cites W2068294371 @default.
• W2002022705 cites W2069259364 @default.
• W2002022705 cites W2077135228 @default.
• W2002022705 cites W2078517814 @default.
• W2002022705 cites W2082213952 @default.
• W2002022705 cites W2085013529 @default.
• W2002022705 cites W2086189875 @default.
• W2002022705 cites W2087582614 @default.
• W2002022705 cites W2107277218 @default.
• W2002022705 cites W2108408244 @default.
• W2002022705 cites W2109970232 @default.
• W2002022705 cites W2111110563 @default.
• W2002022705 cites W2116597301 @default.
• W2002022705 cites W2123101763 @default.
• W2002022705 cites W2129684968 @default.
• W2002022705 cites W2135160692 @default.
• W2002022705 cites W2135681724 @default.
• W2002022705 cites W2139666950 @default.
• W2002022705 cites W2147641426 @default.
• W2002022705 cites W2148930555 @default.
• W2002022705 cites W2151468131 @default.
• W2002022705 cites W2154837406 @default.
• W2002022705 cites W2155653297 @default.
• W2002022705 cites W2158110584 @default.
• W2002022705 cites W2159984968 @default.
• W2002022705 cites W2165787609 @default.
• W2002022705 cites W2167146326 @default.
• W2002022705 cites W2170812873 @default.
• W2002022705 doi "https://doi.org/10.1074/jbc.m606262200" @default.
• W2002022705 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17095510" @default.
• W2002022705 hasPublicationYear "2007" @default.
• W2002022705 type Work @default.
• W2002022705 sameAs 2002022705 @default.
• W2002022705 citedByCount "164" @default.
• W2002022705 countsByYear W20020227052012 @default.
• W2002022705 countsByYear W20020227052013 @default.
• W2002022705 countsByYear W20020227052014 @default.
• W2002022705 countsByYear W20020227052015 @default.
• W2002022705 countsByYear W20020227052016 @default.
• W2002022705 countsByYear W20020227052017 @default.
• W2002022705 countsByYear W20020227052018 @default.
• W2002022705 countsByYear W20020227052019 @default.
• W2002022705 countsByYear W20020227052020 @default.
• W2002022705 countsByYear W20020227052021 @default.
• W2002022705 countsByYear W20020227052022 @default.
• W2002022705 countsByYear W20020227052023 @default.
• W2002022705 crossrefType "journal-article" @default.
• W2002022705 hasAuthorship W2002022705A5024159607 @default.

• next