FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2002184487> ?p ?o ?g. }

• W2002184487 endingPage "3926" @default.
• W2002184487 startingPage "3923" @default.
• W2002184487 abstract "The smallest known intein, found in the ribonucleoside diphosphate reductase gene of Methanobacterium thermoautotrophicum (Mth RIR1 intein), was found to splice poorly in Escherichia coli with the naturally occurring proline residue adjacent to the N-terminal cysteine of the intein. Splicing proficiency increased when this proline was replaced with an alanine residue. However, constructs that displayed efficient N- and C-terminal cleavage were created by replacing either the C-terminal asparagine or N-terminal cysteine of the intein, respectively, with an alanine. Furthermore, these constructs were used to specifically generate complementary reactive groups on protein sequences for use in ligation reactions. Reaction between an intein-generated C-terminal thioester on E. colimaltose-binding protein (43 kDa) and an intein-generated cysteine at the N terminus of either T4 DNA ligase (56 kDa) or thioredoxin (12 kDa) resulted in the ligation of the proteins through a native peptide bond. Thus the smallest of the known inteins is capable of splicing and its unique properties extend the utility of intein-mediated protein ligation to include the in vitro fusion of large, bacterially expressed proteins. The smallest known intein, found in the ribonucleoside diphosphate reductase gene of Methanobacterium thermoautotrophicum (Mth RIR1 intein), was found to splice poorly in Escherichia coli with the naturally occurring proline residue adjacent to the N-terminal cysteine of the intein. Splicing proficiency increased when this proline was replaced with an alanine residue. However, constructs that displayed efficient N- and C-terminal cleavage were created by replacing either the C-terminal asparagine or N-terminal cysteine of the intein, respectively, with an alanine. Furthermore, these constructs were used to specifically generate complementary reactive groups on protein sequences for use in ligation reactions. Reaction between an intein-generated C-terminal thioester on E. colimaltose-binding protein (43 kDa) and an intein-generated cysteine at the N terminus of either T4 DNA ligase (56 kDa) or thioredoxin (12 kDa) resulted in the ligation of the proteins through a native peptide bond. Thus the smallest of the known inteins is capable of splicing and its unique properties extend the utility of intein-mediated protein ligation to include the in vitro fusion of large, bacterially expressed proteins. Inteins (1Perler F.B. Davis E.O. Dean G.E. Gimble F.S. Jack W.E. Neff N. Noren C.J. Thorner J. Belfort M. Nucleic Acids Res. 1994; 22: 1125-1127Crossref PubMed Scopus (315) Google Scholar), the protein equivalent of the self-splicing RNA introns, catalyze their own excision from a precursor protein with the concomitant fusion of the flanking protein sequences, known as exteins (reviewed in Refs. 2Perler F.B. Xu M.-Q. Paulus H. Curr. Opin. Chem. Biol. 1997; 1: 292-299Crossref PubMed Scopus (138) Google Scholar, 3Perler F.B. Cell. 1998; 92: 1-4Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 4Xu M.-Q. Perler F.B. EMBO J. 1996; 15: 5146-5153Crossref PubMed Scopus (251) Google Scholar). Almost 100 inteins have been identified (5Perler F.B. Nucleic Acids Res. 1999; (in press): 27Google Scholar) 1See also the InBase website:http://www.neb.com/neb/inteins/intein_intro.html.1See also the InBase website:http://www.neb.com/neb/inteins/intein_intro.html. and can be grouped into three classes: 1) the inteins containing a homing endonuclease between the two splicing domains, 2) the mini-inteins, which lack the homing endonuclease, and 3) a newly described trans-splicing intein (6Wu H. Hu Z. Liu X.Q. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9226-9231Crossref PubMed Scopus (319) Google Scholar). Of the mini-inteins, the smallest is the 134-amino acid intein found in the ribonucleoside diphosphate reductase gene of Methanobacterium thermoautotrophicum (Mth RIR1 intein; Ref. 7Smith D.R. Doucette-Stamm L.A. Deloughery C. Lee H. Dubois J. Aldredge T. Bashirzadeh R. Blakely D. Cook R. Gilbert K. Harrison D. Hoang L. Keagle P. Lumm W. Pothier B. Qiu D. Spadafora R. Vicaire R. Wang Y. Wierzbowski J. Gibson R. Jiwani N. Caruso A. Bush D. Safer H. Patwell D. Prabhakar S. McDougall S. Shimer G. Goyal A. Pietrokovski S. Church G.M. Daniels C.J. Mao J.-I. Rice P. Nolling J. Reeve J.N. J. Bacteriol. 1997; 179: 7135-7155Crossref PubMed Scopus (1036) Google Scholar). This intein may be close to the minimum amino acid sequence needed to promote splicing, and interestingly, it has a proline residue N-terminal to the first amino acid of the intein, Pro−1(see Fig. 1), which was shown to inhibit splicing in an intein found in the 69-kDa vacuolar ATPase subunit of Saccharomyces cerevisiae (Sce VMA intein; Ref. 8Chong S. Williams K.S. Wotkowicz C. Xu M.-Q. J. Biol. Chem. 1998; 273: 10567-10577Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Studies into the mechanism of splicing led to the development of a protein purification system that utilized thiol-induced cleavage of the peptide bond at the N terminus of the Sce VMA intein (9Chong S. Mersha F.B. Comb D.G. Scott M.E. Landry D. Vence L.M. Perler F.B. Benner J. Kucera R.B. Hirvonen C.A. Pelletier J.J. Paulus H. Xu M.Q. Gene (Amst.). 1997; 192: 271-281Crossref PubMed Scopus (501) Google Scholar). Purification with this system generated a bacterially expressed protein with a C-terminal thioester (9Chong S. Mersha F.B. Comb D.G. Scott M.E. Landry D. Vence L.M. Perler F.B. Benner J. Kucera R.B. Hirvonen C.A. Pelletier J.J. Paulus H. Xu M.Q. Gene (Amst.). 1997; 192: 271-281Crossref PubMed Scopus (501) Google Scholar). Two research groups then applied the chemistry described for native chemical ligation (10Dawson P.E. Muir T.W. Clark-Lewis I. Kent S.B. Science. 1994; 266: 776-779Crossref PubMed Scopus (3140) Google Scholar) to fuse a synthetic peptide with an N-terminal cysteine to a bacterially expressed protein possessing a C-terminal thioester (11Evans J.T.C. Benner J. Xu M.-Q. Protein Sci. 1998; 7: 2256-2264Crossref PubMed Scopus (332) Google Scholar, 12Muir T.W. Sondhi D. Cole P.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6705-6710Crossref PubMed Scopus (957) Google Scholar). This technique, known as intein-mediated protein ligation (IPL) 2The abbreviations used are: IPL, intein-mediated protein ligation; MESNA, the sodium salt of 2-mercaptoethanesulfonic acid; MBP, maltose-binding protein; CBD, chitin-binding domain; M-R-B, a fusion protein consisting of maltose-binding protein-MthRIR1 intein-chitin-binding domain; IPTG, isopropyl-β-d-thiogalactopyranoside; PAGE, poly-acrylamide gel electrophoresis.2The abbreviations used are: IPL, intein-mediated protein ligation; MESNA, the sodium salt of 2-mercaptoethanesulfonic acid; MBP, maltose-binding protein; CBD, chitin-binding domain; M-R-B, a fusion protein consisting of maltose-binding protein-MthRIR1 intein-chitin-binding domain; IPTG, isopropyl-β-d-thiogalactopyranoside; PAGE, poly-acrylamide gel electrophoresis. or also as expressed protein ligation, represented an important advance in protein semi-synthetic techniques (reviewed in Refs. 13Gimble F.S. Chem. Biol. 1998; 5: R251-R256Abstract Full Text PDF PubMed Scopus (31) Google Scholar and 14Holford M. Muir T.W. Structure. 1998; 6: 945-949Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar). However, the generality of IPL was limited by the use of a synthetic peptide as a ligation partner. We describe the next major advance in intein-mediated protein ligation, which is the modulation of the Mth RIR1 intein for the facile isolation of a protein with an N-terminal cysteine for use in the in vitro fusion of two bacterially expressed proteins. Furthermore, the Mth RIR1 mini-intein, the smallest known protein splicing element, was found to be capable of splicing. These results significantly expand the utility of IPL to include the labeling of extensive portions of a protein for NMR analysis and the isolation of a greater variety of cytotoxic proteins. In addition, this advance opens the possibility of labeling the central portion of a protein by ligating three fragments in succession. The gene encoding theMth RIR1 intein along with 5 native N- and C-extein residues (Fig. 1; Ref. 7Smith D.R. Doucette-Stamm L.A. Deloughery C. Lee H. Dubois J. Aldredge T. Bashirzadeh R. Blakely D. Cook R. Gilbert K. Harrison D. Hoang L. Keagle P. Lumm W. Pothier B. Qiu D. Spadafora R. Vicaire R. Wang Y. Wierzbowski J. Gibson R. Jiwani N. Caruso A. Bush D. Safer H. Patwell D. Prabhakar S. McDougall S. Shimer G. Goyal A. Pietrokovski S. Church G.M. Daniels C.J. Mao J.-I. Rice P. Nolling J. Reeve J.N. J. Bacteriol. 1997; 179: 7135-7155Crossref PubMed Scopus (1036) Google Scholar) was constructed using 10 oligonucleotides (New England Biolabs, Beverly, MA) comprising both strands of the gene and overlapping by at least 20 base pairs. 1) 5′-TCGAGGCAACCAACCCCTGCGTATCCGGTGACACCATTGTAATGACTAGTGGCGGTCCGCGCACTGTGGC TGAACTGGAGGGCAAACCGTTCACCGCAC-3′. 2) 5′-CCGGTTGGCTGCTCGCCACAGTTGTGTACAATGAAGCCATTAGCAGTGAA TGCGCTAGCACCGTAAACAGTAGCGTCATAAACATCCTGGCGG-3′. 3) 5′-pTGATTCGCGGCTCTGGCTACCCATGCCCCTCAGGTTTCTTCCGCACCTGTGAACGTGACGTATATGATCTGCGTACACGT GAGGGTCATTGCTTACGTTT-3′. 4) 5′-pGACCCATGATCACCGTGTTCTGGTGATGGATGGTGGCCTGGAATGGCGTGCCGCGGGTGAACTGGAACGCGGCGACCGCCTGGTGATGGATGATGCAGCT-3′. 5) 5′-pGGCGAGTTTCCGGCACTGGCAACCTTCCGTGGCCTGCGTGGCGCTGGCCGCCAGGATGTTTATGACGCTACTGTTTACGGTGCTAGC-3′. 6) 5′-pGCATTCACTGCTAATGGCTTCATTGTACACAACTGTGGCGAGCAGCCAA-3′. 7) 5′-pCCAGCGCCACGCAGGCCACGGAAGGTTGCCAGTGCCGGAAACTCGCCAGCTGCATCATCCATCACCAGGCGGTCGCCGCGTTCCAGTTCACCCGCGGCAC-3′. 8) 5′-pGCCATTCCAGGCCACCATCCATCACCAGAACACGGTGATCATGGGTCAAACGTAAGCAATGACCCTCACGTGTACGCAGATCATATACGT-3′. 9) 5′-pCACGTTCACAGGTGCGGAAGAAACCTGAGGGGCATGGGTAGCCAGAGCCGCGAATCAGTGCGGTGAACGGTTTGCCCTCCAGTTCAGCCACAGTGCG-3′. 10) 5′-pCGGACCGCCACTAGTCATTACAATGGTGTCACCGGATACGCAGGGGTTGGTTGCC-3′. To ensure maximal Escherichia coli expression, the coding region of the synthetic Mth RIR1 intein incorporates 61 silent base mutations in 48 of the 134 codons. The oligonucleotides were annealed by mixing at equimolar ratios (400 nm) in a ligation buffer (50 mm Tris-HCl, pH 7.5, containing 10 mm MgCl2, 10 mm dithiothreitol, 1 mm ATP, and 25 μg of bovine serum albumin) followed by heating to 95 °C. After cooling to room temperature, the annealed and ligated oligonucleotides were inserted into the XhoI andAgeI sites of pMYB5 (New England Biolabs), replacing theSce VMA intein and creating the plasmid pMRB8P. The uniqueXhoI and SpeI sites flanking the N-terminal splice junction and the unique BsrGI and AgeI sites flanking the C-terminal splice junction allowed substitution of amino acid residues by linker replacement. Pro−1, the proline residue preceding the intein in pMRB8P, was substituted with alanine or glycine to yield pMRB8A and pMRB8G1, respectively. Substitution of Pro−1-Cys1 with Gly-Ser or Gly-Ala yielded pMRB9GS and pMRB9GA, respectively. Replacing Asn134 with Ala in pMRB8G1 resulted in pMRB10G. The following linkers were used for substitution of the native amino acids at the splice junctions. Each linker was formed by annealing two synthetic oligonucleotides as described above. Pro−1-Ala linker: 5′-TCGAGGCAACCAACGCATGCGTATCCGGTGACACCATTGTAATGA-3′ and 5′-CTAGTCATTACAATGGTGTCACCGGATACG CATGCGTTGGTTGCC-3′. Pro−1-Gly linker: 5′-TCGAGGGCTGCGTATCCGGTGACACCATTGTAATGA-3′ and 5′-CTAGTCATTACAATGGTGTCACCGGATACGCAGCCC-3′. Pro−1 → Gly/Cys1 → Ser linker: 5′-TCGAGGGCATCGAGGCAACCAACGGATCCGTATCCGGTGA CACCATTGTAATGA-3′ and 5′-CTAGTCATTACAATGGTGTCACCGGATACGGATCCGTTGGTTGCCTCGATGCCC-3′. Pro−1 → Gly/Cys1 → Ala linker: 5′-TCGAGGGCATCGAGGCAACCAACGGCGCCGTATCCGGTGACACCATTGTAATGA-3′ and 5′-CTAGTCATTACAATGGTGTCACCGGATACGGCGCCGTTGGTTGCCTCGATGCCC-3′. Asn134 → Ala linker: 5′-GTACACGCATGCGGCGAGCAGCCCGGGA-3′ and 5′-CCGGTCCCGGGCTGCTCGCCGCATGCGT-3′. pBRL-A was constructed by substituting the MBP and the CBD coding regions in pMRB9GA with the CBD and the T4 DNA ligase coding regions, respectively, subcloned from the pBYT4 plasmid. 3R. Chong, unpublished data. ER2566 cells (11Evans J.T.C. Benner J. Xu M.-Q. Protein Sci. 1998; 7: 2256-2264Crossref PubMed Scopus (332) Google Scholar) containing the appropriate plasmid were grown in LB broth containing 100 μg/ml ampicillin at 37 °C to an A 600 of 0.5–0.8. Protein synthesis was induced by addition of 0.5 mm IPTG and proceeded at 15 °C overnight or at 37 °C for 2 h. Cell extracts were visualized on 12% Tris-glycine gels (Novex Experimental Technology, San Diego, CA) stained with Coomassie Brilliant Blue. Purification was as described previously for theSce VMA and Mxe GyrA inteins (9Chong S. Mersha F.B. Comb D.G. Scott M.E. Landry D. Vence L.M. Perler F.B. Benner J. Kucera R.B. Hirvonen C.A. Pelletier J.J. Paulus H. Xu M.Q. Gene (Amst.). 1997; 192: 271-281Crossref PubMed Scopus (501) Google Scholar, 11Evans J.T.C. Benner J. Xu M.-Q. Protein Sci. 1998; 7: 2256-2264Crossref PubMed Scopus (332) Google Scholar). Briefly, ER2566 cells (11Evans J.T.C. Benner J. Xu M.-Q. Protein Sci. 1998; 7: 2256-2264Crossref PubMed Scopus (332) Google Scholar) containing the appropriate plasmid were grown at 37 °C in LB broth containing 100 μg/ml ampicillin to anA 600 of 0.5–0.6 followed by induction with IPTG (0.5 mm). Induction was either overnight at 15 °C or for 3 h at 30 °C. The cells were pelleted by centrifugation at 3,000 × g for 30 min followed by resuspension in buffer A (20 mm Tris-HCl, pH 7.5, containing 500 mm NaCl). The cell contents were released by sonication. Cell debris was removed by centrifugation at 23,000 ×g for 30 min, and the supernatant was applied to a column packed with chitin resin (bed volume, 10 ml) equilibrated in buffer A. Unbound protein was washed from the column with 10 column volumes of buffer A. Thiol reagent-induced cleavage was initiated by rapidly equilibrating the chitin resin in buffer B (20 mm Tris-HCl, pH 8, containing 500 mm NaCl and 100 mm2-mercaptoethanesulfonic acid (MESNA)). The cleavage reaction proceeded overnight at 4 °C, after which the protein was eluted from the column. Protein purification was performed as described above with buffer A replaced by buffer C (20 mm Tris-HCl, pH 8.5, containing 500 mm NaCl) and buffer B replaced by buffer D (20 mm Tris-HCl, pH 7.0, containing 500 mmNaCl). Also, following equilibration of the column in buffer D the cleavage reaction proceeded overnight at room temperature. Protein concentrations were determined using the Bio-Rad protein assay. Freshly isolated thioester-tagged protein was mixed with freshly isolated protein containing an N-terminal cysteine residue (starting concentration, 1–200 μm). The solution was concentrated with a Centriprep 3 or Centriprep 30 apparatus (Millipore Corporation, Bedford, MA) then with a Centricon 3 or Centricon 10 apparatus to a final concentration of 0.15–1.2 mm for each protein. Ligation reactions proceeded overnight at 4 °C and were visualized using SDS-PAGE with 12% Tris-glycine gels (Novex Experimental Technology, San Diego, CA) stained with Coomassie Brilliant Blue. 2 mg of ligation reaction involving MBP and T4 DNA ligase was bound to 3 ml of amylose resin (New England Biolabs) equilibrated in buffer A (see above). Unreacted T4 DNA ligase was rinsed from the column with 10 column volumes of buffer A. Unligated MBP and the MBP-T4 DNA ligase fusion protein were eluted from the amylose resin using buffer E (20 mm Tris-HCl, pH 7.5, containing 500 mm NaCl and 10 mm maltose). Overnight incubation of the eluted protein with a 200:1 protein:bovine factor Xa (New England Biolabs) ratio (w/w) at 4 °C resulted in the proteolysis of the fusion protein and regeneration of a band on SDS-PAGE gels that ran at a molecular weight similar to T4 DNA ligase. N-terminal amino acid sequencing of the proteolyzed fusion protein was performed on a Procise 494 protein sequencer (PE Applied Biosystems, Foster City, CA). The splicing activity of the Mth RIR1 intein with its 5 native N- and C-extein residues was investigated by expressing it as an in-frame fusion between E. coli maltose-binding protein (15Duplay P. Bedouelle H. Fowler A. Zabin I. Saurin W. Hofnung M. J. Biol. Chem. 1984; 259: 10606-10613Abstract Full Text PDF PubMed Google Scholar) and the chitin-binding domain (16Watanabe T. Ito Y. Yamada T. Hashimoto M. Sekine S. Tanaka H. J. Bacteriol. 1994; 176: 4465-4472Crossref PubMed Scopus (264) Google Scholar) from Bacillus circulans. In this protein context splicing products were detected (Fig.2, lane 1), although the majority of the protein remained in the precursor form (M-R-B). Splicing proficiency was increased by mutating the Pro−1to an Ala (Fig. 2, lane 3). Furthermore, the Pro−1 → Ala or Pro−1 → Gly mutants also displayed cleavage at the N- and C-terminal junctions of the intein (Fig. 2, lanes 3 and 5). The identity of splicing and cleavage products were confirmed by Western blot analysis using anti-MBP and anti-CBD polyclonal antibodies (data not shown). The cleavage and/or splicing activity of the M-R-B precursor was more proficient when protein synthesis was induced at 15 °C than when the induction temperature was raised to 37 °C (Fig. 2). Replacement of Pro−1 with a Gly and Cys1 with a Ser resulted in a double mutant, M-R-B (Pro−1 → Gly/Cys1→ Ser), which showed only in vivo C-terminal cleavage activity when protein synthesis was induced at 15 °C but not at 37 °C (Fig. 2, lanes 7 and 8). Another double mutant, M-R-B (Pro−1 → Gly/Cys1 → Ala) displayed slow cleavage, even at 15 °C, which allowed the accumulation of substantial amounts of the precursor protein (data not shown) and showed potential for use as a C-terminal cleavage construct for protein purification. The C- and N-terminal cleavage constructs of the Mth RIR1 intein were used to purify T4 DNA ligase or thioredoxin with an N-terminal cysteine or MBP with a C-terminal thioester. Two C-terminal cleavage constructs, pBRL-A and pBRT (Fig. 3, data not shown for pBRT), resulted in the isolation of 4–6 mg/liter cell culture and 5–10 mg/liter cell culture of T4 DNA ligase and thioredoxin, respectively. These proteins possessed N-terminal cysteine residues based on amino acid sequencing following the ligation reaction (see below under “Intein-mediated Protein Ligation”). Conversely, an intein with only N-terminal cleavage activity was generated by changing Pro−1 to Gly and the C-terminal Asn134 to an Ala creating M-R-B (Pro−1 → Gly, Cys1 → Ser). N-terminal cleavage products were detected when protein synthesis was induced at both 15 and 37 °C (Fig. 2, lanes 9 and 10). However, more precursor accumulated at the higher induction temperature. The remaining precursor protein could undergo thiol-mediated cleavage with reagents such as dithiothreitol or MESNA and could be used to purify thioester-tagged proteins as described previously (Fig. 3 and Refs. 11Evans J.T.C. Benner J. Xu M.-Q. Protein Sci. 1998; 7: 2256-2264Crossref PubMed Scopus (332) Google Scholarand 12Muir T.W. Sondhi D. Cole P.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6705-6710Crossref PubMed Scopus (957) Google Scholar). IPL reactions consisted of mixing freshly purified MBP with T4 DNA ligase or thioredoxin (Fig.4 and “Experimental Procedures”). Ligation was monitored by the appearance of an extra band on SDS-PAGE (Fig. 3 and data not shown for thioredoxin) corresponding to the predicted molecular weight of the ligation product. Typical ligation efficiencies ranged from 20–60%. A factor Xa site in MBP that exists 5 amino acids N-terminal from the site of fusion (17Maina C.V. Riggs P.D. Grandea III, A.G. Slatko B.E. Moran L.S. Tagliamonte J.A. McReynolds L.A. Guan C.D. Gene (Amst.). 1988; 74: 365-373Crossref PubMed Scopus (462) Google Scholar) allowed amino acid sequencing through the ligation junction (see “Experimental Procedures”). The sequence obtained was NH2-TLEGCGEQPTGXLK-COOH, which matched the last 4 residues of MBP (TLEG) followed by a linker sequence (CGEQPTG) and the start of T4 DNA ligase (ILK). During amino acid sequencing, the cycle expected to yield an isoleucine did not have a strong enough signal to assign it to a specific residue, so it was represented as anX. The cysteine was identified as the acrylamide alkylation product. The C-terminal cleavage activity of the mutated MthRIR1 intein advanced IPL technology by providing a means to isolate proteins possessing an N-terminal cysteine to act as substrates in thein vitro fusion of large, bacterially expressed proteins. Initially, an intein that cleaves in vivo was tested for the ability to generate a protein with an N-terminal cysteine. However, the side chain of the N-terminal cysteine residue appeared to be modifiedin vivo by an unidentified pathway (data not shown). Although this problem could be circumvented using a protease to cut on the N-terminal side of a cysteine residue, concern over nonspecific proteolysis and the need to remove the protease after cleavage limited its usefulness. Interestingly, C-terminal cleavage using theMth RIR1 intein appeared to protect the cysteine residue until it could be released in vitro. A recently developedSce VMA intein with thiol-inducible C-terminal cleavage activity could not be used because it would undergo splicing instead of cleavage with an N-terminal cysteine on the target protein (18Chong S. Montello G.E. Zhang A. Cantor E.J. Liao W. Xu M.Q. Benner J. Nucleic Acids Res. 1998; 26: 5109-5115Crossref PubMed Scopus (185) Google Scholar). The concentration dependence of the ligation reaction was probably due to the need to increase the ligation reaction rate to effectively compete with thioester hydrolysis, which would prevent ligation. Protein fusion occurred at 20–40% efficiency at 6.5–8.5 mg/ml of each reactant (data not shown), although greater extents of reaction (50–60%, Fig. 3) were observed at higher protein concentrations. Many proteins can exist in solution at the lower concentrations, indicating that IPL will be useful for a wide range of applications. However, these conditions are problematic for some proteins, and future work may determine procedures that will lower this concentration requirement. N-terminal amino acid sequencing through the ligation junction demonstrated that the two proteins were fused tail-to-head in a continuous polypeptide chain and had not fused to form an unusual branched structure. Furthermore, these data reinforce past studies reporting that a native peptide bond is formed using native chemical ligation chemistry (10Dawson P.E. Muir T.W. Clark-Lewis I. Kent S.B. Science. 1994; 266: 776-779Crossref PubMed Scopus (3140) Google Scholar) because the polypeptide sequencing reaction requires a peptide bond between amino acid residues. Previously, studies with the Sce VMA intein reported that splicing was inhibited when a proline replaced the naturally occurring glycine at the −1 position (8Chong S. Williams K.S. Wotkowicz C. Xu M.-Q. J. Biol. Chem. 1998; 273: 10567-10577Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). However, the Mth RIR1 intein has a naturally occurring proline at this position and was thought to be able to splice with this unique amino acid. The low splicing activity of the Mth RIR1 intein shows that it is capable of splicing but that it may not be folding properly when expressed in E. coli. Alternatively, this intein may require more native extein sequence than provided or require a cofactor such as a prolyl isomerase to promote proficient splicing activity. The Mth RIR1 intein primary sequence was compared with the amino acid sequence and crystal structure of another mini-intein, theMxe GyrA intein (19Klabunde T. Sharma S. Telenti A. Jacobs W.R.J. Sacchettini J.C. Nat. Struct. Biol. 1998; 5: 31-36Crossref PubMed Scopus (203) Google Scholar, 20Telenti A. Southworth M. Alcaide F. Daugelat S. Jacobs J. William R. Perler F.B. J. Bacteriol. 1997; 179: 6378-6382Crossref PubMed Google Scholar). Most of the amino acids that form two α-helices and a disordered region in the Mxe GyrA intein appeared to be missing in the Mth RIR1 intein. The α-helical and disordered regions were previously found not to be required for splicing of the Ssp DnaB intein (21Wu H. Xu M.-Q. Liu X.-Q. Biochim. Biophys. Acta. 1998; 1387: 422-432Crossref PubMed Scopus (153) Google Scholar), and this portion of the protein may only serve as a linker. The small size of this region in the Mth RIR1 intein may decrease its stability and may account for some of its induction temperature-dependent activity. The mechanism of the induction temperature-dependent splicing and cleavage activity has yet to be determined, but it may be due to reactions occurring at the C terminus of the intein. C-terminal cleavage was more severely affected by induction temperature than N-terminal cleavage activity (Fig. 2). It is also possible that theMth RIR1 intein could be misfolding in E. coliwhen induced at the higher temperature, an interesting possibility considering that M. thermoautotrophicum is a thermophilic bacteria. In conclusion, this report demonstrated that the smallest known intein, the Mth RIR1 intein, along with its 5 native extein residues was capable of splicing. Furthermore, this intein was capable of generating both thioester-tagged proteins and proteins with an N-terminal cysteine. The latter was of particular importance because it facilitated the next major advance in intein-mediated protein ligation, which is the fusion of two large, bacterially expressed proteins. This paves the way for greater freedom in the labeling of proteins for NMR analysis, the isolation of cytotoxic proteins, and in the future the controlled fusion of three bacterially expressed proteins. We thank Bill Jack, Inca Ghosh, Francine Perler, Eric Adam, Lixin Chen, Maurice Southworth, Shoarong Chong, Eric Cantor, Chudi Guan, Richard Whitaker, Marilena Hall, and Fana Mersha for valuable discussions and assistance; Shaorong Chong for the gift of the pBYT4 plasmid; Eric Adam and Sanjay Kumar for assistance in amino acid alignments of the Mth RIR1 intein; and Don Comb for support and encouragement." @default.
• W2002184487 created "2016-06-24" @default.
• W2002184487 creator A5007474953 @default.
• W2002184487 creator A5035914775 @default.
• W2002184487 creator A5052319792 @default.
• W2002184487 date "1999-02-01" @default.
• W2002184487 modified "2023-10-06" @default.
• W2002184487 title "The in Vitro Ligation of Bacterially Expressed Proteins Using an Intein from Methanobacterium thermoautotrophicum" @default.
• W2002184487 cites W1546730880 @default.
• W2002184487 cites W1585164939 @default.
• W2002184487 cites W1947962930 @default.
• W2002184487 cites W1964117837 @default.
• W2002184487 cites W1969542242 @default.
• W2002184487 cites W1979074409 @default.
• W2002184487 cites W1998834713 @default.
• W2002184487 cites W2005579644 @default.
• W2002184487 cites W2025583051 @default.
• W2002184487 cites W2031305555 @default.
• W2002184487 cites W2057530446 @default.
• W2002184487 cites W2065055005 @default.
• W2002184487 cites W2071938141 @default.
• W2002184487 cites W2076845200 @default.
• W2002184487 cites W2077080679 @default.
• W2002184487 cites W2109050242 @default.
• W2002184487 cites W2112988974 @default.
• W2002184487 cites W2118358984 @default.
• W2002184487 cites W2130511335 @default.
• W2002184487 cites W2161904803 @default.
• W2002184487 cites W4213262935 @default.
• W2002184487 doi "https://doi.org/10.1074/jbc.274.7.3923" @default.
• W2002184487 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9933578" @default.
• W2002184487 hasPublicationYear "1999" @default.
• W2002184487 type Work @default.
• W2002184487 sameAs 2002184487 @default.
• W2002184487 citedByCount "135" @default.
• W2002184487 countsByYear W20021844872012 @default.
• W2002184487 countsByYear W20021844872013 @default.
• W2002184487 countsByYear W20021844872014 @default.
• W2002184487 countsByYear W20021844872015 @default.
• W2002184487 countsByYear W20021844872016 @default.
• W2002184487 countsByYear W20021844872018 @default.
• W2002184487 countsByYear W20021844872019 @default.
• W2002184487 countsByYear W20021844872020 @default.
• W2002184487 countsByYear W20021844872021 @default.
• W2002184487 countsByYear W20021844872022 @default.
• W2002184487 crossrefType "journal-article" @default.
• W2002184487 hasAuthorship W2002184487A5007474953 @default.
• W2002184487 hasAuthorship W2002184487A5035914775 @default.
• W2002184487 hasAuthorship W2002184487A5052319792 @default.
• W2002184487 hasBestOaLocation W20021844871 @default.
• W2002184487 hasConcept C104317684 @default.
• W2002184487 hasConcept C185592680 @default.
• W2002184487 hasConcept C202751555 @default.
• W2002184487 hasConcept C2775954774 @default.
• W2002184487 hasConcept C2779824996 @default.
• W2002184487 hasConcept C54458228 @default.
• W2002184487 hasConcept C550995028 @default.
• W2002184487 hasConcept C55493867 @default.
• W2002184487 hasConcept C67705224 @default.
• W2002184487 hasConcept C86803240 @default.
• W2002184487 hasConcept C89423630 @default.
• W2002184487 hasConceptScore W2002184487C104317684 @default.
• W2002184487 hasConceptScore W2002184487C185592680 @default.
• W2002184487 hasConceptScore W2002184487C202751555 @default.
• W2002184487 hasConceptScore W2002184487C2775954774 @default.
• W2002184487 hasConceptScore W2002184487C2779824996 @default.
• W2002184487 hasConceptScore W2002184487C54458228 @default.
• W2002184487 hasConceptScore W2002184487C550995028 @default.
• W2002184487 hasConceptScore W2002184487C55493867 @default.
• W2002184487 hasConceptScore W2002184487C67705224 @default.
• W2002184487 hasConceptScore W2002184487C86803240 @default.
• W2002184487 hasConceptScore W2002184487C89423630 @default.
• W2002184487 hasIssue "7" @default.
• W2002184487 hasLocation W20021844871 @default.
• W2002184487 hasOpenAccess W2002184487 @default.
• W2002184487 hasPrimaryLocation W20021844871 @default.
• W2002184487 hasRelatedWork W1598298585 @default.
• W2002184487 hasRelatedWork W1601962391 @default.
• W2002184487 hasRelatedWork W1750090655 @default.
• W2002184487 hasRelatedWork W1988517316 @default.
• W2002184487 hasRelatedWork W1992393617 @default.
• W2002184487 hasRelatedWork W2002184487 @default.
• W2002184487 hasRelatedWork W2024431897 @default.
• W2002184487 hasRelatedWork W2046533420 @default.
• W2002184487 hasRelatedWork W2062765954 @default.
• W2002184487 hasRelatedWork W51264526 @default.
• W2002184487 hasVolume "274" @default.
• W2002184487 isParatext "false" @default.
• W2002184487 isRetracted "false" @default.
• W2002184487 magId "2002184487" @default.
• W2002184487 workType "article" @default.