FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2002633931> ?p ?o ?g. }

• W2002633931 endingPage "28241" @default.
• W2002633931 startingPage "28233" @default.
• W2002633931 abstract "Serine proteases are implicated in a variety of processes during neurogenesis, including cell migration, axon outgrowth, and synapse elimination. Tissue-type plasminogen activator and urokinase-type activator are expressed in the floor plate during embryonic development. F-spondin, a gene also expressed in the floor plate, encodes a secreted, extracellular matrix-attached protein that promotes outgrowth of commissural axons and inhibits outgrowth of motor axons. F-spondin is processed in vivo to yield an amino half protein that contains regions of homology to reelin and mindin, and a carboxyl half protein that contains either six or four thrombospondin type I repeats (TSRs). We have tested F-spondin to see whether it is subjected to processing by plasmin and to determine whether the processing modulates its biological activity. Plasmin cleaves F-spondin at its carboxyl terminus. By using nested deletion proteins and mutating potential plasmin cleavage sites, we have identified two cleavage sites, the first between the fifth and sixth TSRs, and the second at the fifth TSR. Analysis of the extracellular matrix (ECM) attachment properties of the TSRs revealed that the fifth and sixth TSRs bind to the ECM, but repeats 1–4 do not. Structural functional experiments revealed that two basic motives are required to elicit binding of TSR module to the ECM. We demonstrate further that plasmin releases the ECM-bound F-spondin protein. Serine proteases are implicated in a variety of processes during neurogenesis, including cell migration, axon outgrowth, and synapse elimination. Tissue-type plasminogen activator and urokinase-type activator are expressed in the floor plate during embryonic development. F-spondin, a gene also expressed in the floor plate, encodes a secreted, extracellular matrix-attached protein that promotes outgrowth of commissural axons and inhibits outgrowth of motor axons. F-spondin is processed in vivo to yield an amino half protein that contains regions of homology to reelin and mindin, and a carboxyl half protein that contains either six or four thrombospondin type I repeats (TSRs). We have tested F-spondin to see whether it is subjected to processing by plasmin and to determine whether the processing modulates its biological activity. Plasmin cleaves F-spondin at its carboxyl terminus. By using nested deletion proteins and mutating potential plasmin cleavage sites, we have identified two cleavage sites, the first between the fifth and sixth TSRs, and the second at the fifth TSR. Analysis of the extracellular matrix (ECM) attachment properties of the TSRs revealed that the fifth and sixth TSRs bind to the ECM, but repeats 1–4 do not. Structural functional experiments revealed that two basic motives are required to elicit binding of TSR module to the ECM. We demonstrate further that plasmin releases the ECM-bound F-spondin protein. tissue-type plasminogen activator urokinase-type plasminogen activator extracellular matrix thrombospondin repeat(s) polymerase chain reaction human embryonic kidney alkaline phosphatase monoclonal antibody double mutant thrombospondin-1 Development of the nervous system requires neurons to migrate and to extend axons over long distances from their sites of origin to their intended targets in the peripheral and the central nervous system. Cellular cues often provide physical guides for the growing axons, whereas soluble and cell-attached attractant and repulsive molecules influence axonal steering decisions (1Tessier Lavigne M. Goodman C.S. Science. 1996; 274: 1123-1133Crossref PubMed Scopus (2661) Google Scholar). The axonal growth cone has been proposed to participate actively in modulating the tissue/matrix environment, enabling growth through an impeding substrate (2Ramon y Cajal S. Trab. Labor Invest. Biol. 1921; 18: 4-26Google Scholar). It was anticipated by Krystosek and Seeds (3Krystosek A. Seeds N.W. Science. 1981; 213: 1532-1534Crossref PubMed Scopus (319) Google Scholar) that release of extracellular proteases by the axonal growth cone may facilitate its movement by digesting cell-cell and cell-matrix contacts that block the path of the advancing growth cone. Over the past several years, it became evident that extracellular serine proteases, such as plasminogen, tissue-type plasminogen activator (tPA),1urokinase-type plasminogen activator (uPA) (for review, see Ref. 4Seeds N.W. Friedman G. Hayden S. Thewke D. Haffke S. McGuire P. Krystosek A. Semin. Neurosci. 1996; 8: 405-412Crossref Scopus (24) Google Scholar), thrombin (5Dihanich M. Kaser M. Reinhard E. Cunningham D. Monard D. Neuron. 1991; 6: 575-581Abstract Full Text PDF PubMed Scopus (303) Google Scholar), and neurotrypsin (6Gschwend T.P. Krueger S.R. Kozlov S.V. Wolfer D.P. Sonderegger P. Mol. Cell. Neurosci. 1997; 9: 207-219Crossref PubMed Scopus (103) Google Scholar), are expressed in the nervous system. They have been implicated in a variety of processes during neurogenesis, including cell migration, axon outgrowth, and synapse elimination (7Seeds N.W. Siconolfi L.B. Haffke S.P. Cell Tissue Res. 1997; 290: 367-370Crossref PubMed Scopus (69) Google Scholar, 8Irigoyen J.P. Munoz-Canoves P. Montero L. Koziczak M. Nagamine Y. Cell Mol. Life Sci. 1999; 56: 104-132Crossref PubMed Scopus (339) Google Scholar). They also play a critical role in the adult nervous system by mediating neuronal plasticity (9Huang Y.Y. Bach M.E. Lipp H.P. Zhuo M. Wolfer D.P. Hawkins R.D. Schoonjans L. Kandel E.R. Godfraind J.M. Mulligan R. Collen D. Carmeliet P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8699-8704Crossref PubMed Scopus (275) Google Scholar, 10Baranes D. Lederfein D. Huang Y.Y. Chen M. Bailey C.H. Kandel E.R. Neuron. 1998; 21: 813-825Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar), apoptosis (11Chen Z.L. Strickland S. Cell. 1997; 91: 917-925Abstract Full Text Full Text PDF PubMed Scopus (533) Google Scholar), and peripheral nerve regeneration (12Akassoglou K. Kombrinck K.W. Degen J.L. Strickland S. J. Cell Biol. 2000; 149: 1157-1166Crossref PubMed Scopus (156) Google Scholar). Localization of plasmin activity to neuronal growth cones was initially demonstrated by digestion of a fibrin clot overlay (3Krystosek A. Seeds N.W. Science. 1981; 213: 1532-1534Crossref PubMed Scopus (319) Google Scholar). It was further demonstrated that plasmin cleaves the ECM molecules: collagen, fibronectin (13McGuire P.G. Seeds N.W. Neuron. 1990; 4: 633-642Abstract Full Text PDF PubMed Scopus (88) Google Scholar) and laminin (for review, see Ref. 4Seeds N.W. Friedman G. Hayden S. Thewke D. Haffke S. McGuire P. Krystosek A. Semin. Neurosci. 1996; 8: 405-412Crossref Scopus (24) Google Scholar). In addition to cleaving ECM molecules directly, the extracellular serine proteases may act indirectly by releasing latent proteases and growth factors from the matrix. It was demonstrated that metalloproteases (14O'Grady R.L. Upfold L.I. Stephens R.W. Int. J. Cancer. 1981; 28: 509-515Crossref PubMed Scopus (106) Google Scholar), transforming growth factor-β (15Mars W.M. Zarnegar R. Michalopoulos G.K. Am. J. Pathol. 1993; 143: 949-958PubMed Google Scholar), vascular endothelial growth factor (16Houck K.A. Leung D.W. Rowland A.M. Winer J. Ferrara N. J. Biol. Chem. 1992; 267: 26031-26037Abstract Full Text PDF PubMed Google Scholar), fibroblast growth factor (17Benezra M. Vlodavsky I. Ishai-Michaeli R. Neufeld G. Bar-Shavit R. Blood. 1993; 81: 3324-3331Crossref PubMed Google Scholar), platelet-derived growth factor (18Soyombo A.A. DiCorleto P.E. J. Biol. Chem. 1994; 269: 17734-17740Abstract Full Text PDF PubMed Google Scholar), and hepatic growth factor/scatter factor (15Mars W.M. Zarnegar R. Michalopoulos G.K. Am. J. Pathol. 1993; 143: 949-958PubMed Google Scholar) are produced as matrix-attached latent proteins, subjected to cleavage and subsequently to activation by plasmin. F-spondin, a gene expressed in the floor plate, encodes a secreted, ECM-attached protein (19Klar A. Baldassare M. Jessell T.M. Cell. 1992; 69: 95-110Abstract Full Text PDF PubMed Scopus (305) Google Scholar). It plays a dual role in patterning axonal trajectory in the spinal cord by promoting outgrowth of commissural axons (20Burstyn-Cohen T. Tzarfaty V. Frumkin A. Feinstein Y. Stoeckli E. Klar A. Neuron. 1999; 23: 233-246Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar) and inhibiting outgrowth of motor axons (21Tzarfati-Majar V. Burstyn-Cohen T. Klar A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4722-4727Crossref PubMed Scopus (46) Google Scholar). F-spondin protein is processed in vivo to yield an amino half protein, which contains regions of homology to reelin and mindin, and a carboxyl half protein, which contains either six or four thrombospondin type I repeats (TSRs) (20Burstyn-Cohen T. Tzarfaty V. Frumkin A. Feinstein Y. Stoeckli E. Klar A. Neuron. 1999; 23: 233-246Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 22Burstyn-Cohen T. Frumkin A. Xu Y.T. Scherer S.S. Klar A. J. Neurosci. 1998; 18: 8875-8885Crossref PubMed Google Scholar). F-spondin expression in the nervous system overlaps with expression of several serine proteases. In the floor plate, F-spondin is expressed together with tPA and uPA (19Klar A. Baldassare M. Jessell T.M. Cell. 1992; 69: 95-110Abstract Full Text PDF PubMed Scopus (305) Google Scholar, 22Burstyn-Cohen T. Frumkin A. Xu Y.T. Scherer S.S. Klar A. J. Neurosci. 1998; 18: 8875-8885Crossref PubMed Google Scholar, 23Dent M.A. Sumi Y. Morris R.J. Seeley P.J. Eur. J. Neurosci. 1993; 5: 633-647Crossref PubMed Scopus (82) Google Scholar, 24Sumi Y. Dent M.A. Owen D.E. Seeley P.J. Morris R.J. Development. 1992; 116: 625-637PubMed Google Scholar), whereas in the hippocampus, F-spondin is coexpressed with tPA and neurotrypsin (6Gschwend T.P. Krueger S.R. Kozlov S.V. Wolfer D.P. Sonderegger P. Mol. Cell. Neurosci. 1997; 9: 207-219Crossref PubMed Scopus (103) Google Scholar, 25Feinstein Y. Borrell V. Garcia C. Burstyn-Cohen T. Tzarfaty V. Frumkin A. Nose A. Okamoto H. Higashijima S. Soriano A. Klar A. Development. 1999; 126: 3637-3648PubMed Google Scholar). In addition, several tPA-expressing neurons extend axons toward or through an F-spondin-rich milieu. Embryonic motor neurons are exposed to the floor plate-derived F-spondin (21Tzarfati-Majar V. Burstyn-Cohen T. Klar A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4722-4727Crossref PubMed Scopus (46) Google Scholar). As motor axons emerge from the spinal cord and up-regulate the expression of tPA (26Carroll P.M. Tsirka S.E. Richards W.G. Frohman M.A. Strickland S. Development. 1994; 120: 3173-3183Crossref PubMed Google Scholar), they encounter the somite-derived F-spondin (27Debby-Brafman A. Burstyn-Cohen T. Klar A. Kalcheim C. Neuron. 1998; 22: 475-488Abstract Full Text Full Text PDF Scopus (95) Google Scholar); subsequently, at the peripheral nerve, they are ensheathed by Schwann cell-expressing F-spondin (22Burstyn-Cohen T. Frumkin A. Xu Y.T. Scherer S.S. Klar A. J. Neurosci. 1998; 18: 8875-8885Crossref PubMed Google Scholar). Similarly, embryonic sensory neurons and sympathetic ganglia neurons expressing tPA are also surrounded by F-spondin-expressing cells in the ganglia and along their axonal path (22Burstyn-Cohen T. Frumkin A. Xu Y.T. Scherer S.S. Klar A. J. Neurosci. 1998; 18: 8875-8885Crossref PubMed Google Scholar, 26Carroll P.M. Tsirka S.E. Richards W.G. Frohman M.A. Strickland S. Development. 1994; 120: 3173-3183Crossref PubMed Google Scholar, 28Guillemot F. Lo L.C. Johnson J.E. Auerbach A. Anderson D.J. Joyner A.L. Cell. 1993; 75: 463-476Abstract Full Text PDF PubMed Scopus (914) Google Scholar). In the current study we provide evidence demonstrating that F-spondin is a substrate for plasmin. Plasmin cleaves F-spondin at two sites, the first located between the fifth and sixth TSRs and the second at the fifth TSR. The cleavage sites are located between the extracellular matrix binding TSRs (repeats 5 and 6) and the nonbinding repeats (repeats 1–4). In accordance, treatment of F-spondin with plasmin yields a diffusible, ECM-free, TSR domain protein containing TSRs 1–4. DNA plasmids were constructed by PCR as indicated in Table I. Forward and backward primers were used for PCR using a “template plasmid.” The PCR products were subcloned into a suitable plasmid (cloning vector) into the restriction sites indicated in the table. The mutant plasmids PL1m, PL2m, and DM were generated as follows. Two PCRs were set up with two sets of primers (the upper and lower row of primers in the table). The PCR products of the two reactions were combined, and an additional PCR was performed with the forward primer of the upper row and the backward primer of the lower row. The PCR products were digested and subcloned as indicated in the table.Table IConstruction of DNA plasmids used in this paperNameTemplate plasmidForward primerBackward primerCloning vectorCloning sitesTS5aF-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGCGTCTAGAGAACTGCTCTCCAT CTGPSecTagBHindIII-XbaITS0F-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGGAGAGATCTAGGGGTGTCATCT TCATCPSecTagBHindIII-XbaITS1F-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGCGTCTAGAGCCATCTTCATCGC TGCAGPSecTagBHindIII-XbaITS2F-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGCGTCTAGAAGGAGAGCACTCCT CGTTGPSecTagBHindIII-XbaITS3F-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGCGTCTAGAGGTATGGCACTCAG GCATCPSecTagBHindIII-XbaITS4F-spondinGCAAGCTTGCGCTCGCTTTCTCGGATGCGTCTAGAGGGGCACTCTGGCA GCATACPSecTagBBamHI-XbaITSR1–6F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCAGATCTAGACCCCTACTAACAA GGGTGCAPSecTagBBamHI-XbaITSR2–6F-spondinGAGAGATCTACCTGTACCATGTCGGACTGAGATCTAGACCCCTACTAACAA GGGTGCAPSecTagBBamHI-XbaITSR1–5 + 5F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGACTGGATCGATGGGC TGCGPSecTagBBamHI-XbaITSR1–5 + 10F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGACCTCCAGCGCAGCT TCTGPSecTagBBamHI-XbaITSR1–5 + 15F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGAGCTCTCTCGGGCCT CCCTPSecTagBBamHI-XbaITSR1–5 + 20F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGACTGCTCACTCCTCC TGCTPSecTagBBamHI-XbaITSR4 + 5F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGAGAGTTCGCAGTCAA TGGGPSecTagBBamHI-XbaITSR4 + 20F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGATTTCCCACAGGACT TGTTPSecTagBBamHI-XbaITSR4 + 30F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTAGACTTCAGCATGCGTT GCCGPSecTagBBamHI-XbaIPL1mF-spondinGAGAGATCTTGCATCTACTCCAACTGGTCGCTCTCTCGGGCCTCACTCCAT GGCAGCTTCTGGATCGAPSecTagBXbaI-SacIITCGATCCAGAAGCTGCCATGGAGTGAGGC CCGAGAGAGCCGTCTAGAGAACTGCTCTCCAT CTGPL2mF-spondinGAGAGATCTTGCATCTACTCCAACTGGTCTCGAATCATGTGACCTTCCCCA CAGGATCCGTTACATTCAG ACCAPSecTagBXbaI-SacIITGGTCTGAATGTAACGGATCCTGTGGGGA AGGTCACATGATTCGACGTCTAGAGAACTGCTCTCCAT CTGDMPL1mGAGAGATCTTGCATCTACTCCAACTGGTCTCGAATCATGTGACCTTCCCCA CAGGATCCGTTACATTCAG ACCAPSecTagBXbaI-SacIITGGTCTGAATGTAACGGATCCTGTGGGGA AGGTCACATGATTCGACGTCTAGAGAACTGCTCTCCAT CTGAP-TSR1TS1GAGAGATCTTGCATCTACTCCAACTGGTCCGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR1–2TS2GAGAGATCTTGCATCTACTCCAACTGGTCCGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR1–4TS4GAGAGATCTTGCATCTACTCCAACTGGTCCGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR1–5TS5GAGAGATCTTGCATCTACTCCAACTGGTCCGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR1–6F-spondinGAGAGATCTTGCATCTACTCCAACTGGTCAGATCTAGACCCCTACTAACAA GGGTGCApcDNA3-APBglII-XbaIAP-TSR5TS5GAGAGATCTATTGACTGCGAACTCAGTGACGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR6TS2–6GAGAGATCTCCAGGCTGTCGGATGCGCCCCGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIAP-TSR5–6TS2–6GAGAGATCTATTGACTGCGAACTCAGTGACGGCTAGCTAGAAGGCACAGTC GAGGpcDNA3-APBglII-XbaIGST-TSR4TS4GCGGATCCATCCCGTGCTTGCTGTCTCGGCTAGCTAGAAGGCACAGTC GAGGpGST-2TKBamHI-XbaIGST-TSR5TS5GAGAGATCTATTGACTGCGAACTCAGTGACGGCTAGCTAGAAGGCACAGTC GAGGpGST-2TKBglII-XbaIAP-TSR4 & 5GST-TSR4GAGAGATCATCCCGTGCTTGCTGTCTCGCGTTGCACAGTCTCTGGGCAG TCCCCCAGCTCTGCCAGpcDNA3-APBglII-XbaIGST-TSR5CTGGCAGAGCTGGGGGACTGCCCAGAGAC TGTGCAACGCGCGCTAGCCAAATAGGGGTTCC GCGCAP-TSR5 & 4GST-TSR4CAGTTTGGAGGTGCACCCTGTAATGAGGA TCTGGAGCAGGCGCTAGCCAAATAGGGGTTCC GCGCpcDNA3-APBglII-XbaIGST-TSR5GAGAGATCTATTGACTGCGAACTCAGTGACTGCTCCAGATCCTCATTACAG GGTGCACCTCCAAACTGTSR2–6F-spondinGAGAGATCTCTCCACCTGTACCATGTCGAGATCTAGACCCCTACTAACAA GGGTGCApSec4xmycBglII-XbaIpSec4x4F-spondinGAGAGATCTTGAAACCTGCATCTACTCCCGTCTAGAGGGGCACTCTGGCA GCATACApSec4xmycBglII-XbaITSR1–6Δ5F-spondinGCTCTAGAAGCCCATCGATCCAGAAGAGATCTAGACCCCTACTAACAA GGGTGCApSec4x4Xba-XbaDNA constructs were generated by PCR using template plasmids, forward and backward primers, and cloning vectors as indicated in the table. The F-spondin template plasmid is the cDNA of the rat F-spondin (19Klar A. Baldassare M. Jessell T.M. Cell. 1992; 69: 95-110Abstract Full Text PDF PubMed Scopus (305) Google Scholar). Open table in a new tab DNA constructs were generated by PCR using template plasmids, forward and backward primers, and cloning vectors as indicated in the table. The F-spondin template plasmid is the cDNA of the rat F-spondin (19Klar A. Baldassare M. Jessell T.M. Cell. 1992; 69: 95-110Abstract Full Text PDF PubMed Scopus (305) Google Scholar). HEK293 T cells were transfected with the various plasmids using the liposome-mediated transfection reagent DOTAP (Roche, Manheim, Germany), and LipofectAMINE (Life Technologies, Inc.). Conditioned medium was collected after 2–4 days and treated with the appropriate reagents at 37 °C for 1 h. For plasmin cleavage assays, conditioned medium was treated with plasmin (Chromogenix, Sweden) at the indicated concentrations and the chromogenic substrate specific for plasmin, S-2251 (Val-Leu-Lys-p-nitroanilide, Chromogenix) in 100 mm Tris-HCl, pH 7.4, in a final volume of 100 µl, in microtiter plates for 1 h at 37 °C. Plasmin activity was measured by monitoring the increase of absorbance at 405 nm, using a Thermomax thermostat plate reader (Molecular Devices Corp.). In other cases, plasmin was generated from its zymogen Glu-plasminogen, 10 µg/ml (Chromogenix), and activated by 100 pm recombinant single chain tPA (Actylase, Roche, Manheim) using 20 µg/ml fibrin (Chromogenix) as a cofactor. In some cases, an inhibitor to serine proteases, such as aprotinin (Sigma), was used at a final concentration of 10 µg/ml, or an inhibitor to metalloproteinases such as EGTA (Merck) at a final concentration of 20 mm was added to the reaction mixture. Bovine corneal endothelial cells (second to fifth passages) were plated in 35-mm tissue culture dishes at an initial density of 2 × 105 cells/ml and cultured as described above, except that 4% Dextran T-40 was included in the growth medium. Na235SO4 (25 µCi/ml) (Amersham Pharmacia Biotech) was added on days 2 and 5 after seeding, and the cultures were incubated with the label without medium change. On day 12, the subendothelial ECM was exposed by dissolving the cell layer with phosphate-buffered saline containing 0.5% Triton X-100 and 20 mm NH4OH followed by four washes with phosphate-buffered saline. The ECM remained intact, free of cellular debris and firmly attached to the entire area of the tissue culture dish. Nearly 80% of the ECM radioactivity was incorporated into heparin sulfate proteoglycans. ECM plates were prepared as described above. Conditioned medium of transfected HEK293 Τ cells was incubated on the ECM for 90 min at room temperature. The plates were washed for 5 min three times with HABA (Hanks' balanced salt solution, 0.5 mg/ml BSA, 0.1% NaN3, 20 mm Hepes, pH 7.0), 5 min twice with phosphate-buffered saline, and 2 min with AP buffer (29Cheng H.J. Flanagan J.G. Mol. Biol. Cell. 1994; 5: 943-953Crossref PubMed Scopus (41) Google Scholar). Bound alkaline phosphatase was detected by incubation with p-nitrophenyl phosphate for 2 h at room temperature. TSR2–6 conditioned medium was treated with 50 µg/ml plasmin for 1 h at 37 °C. The reactions were stopped by adding 10 µg/ml aprotinin, then incubated in 96-wells plates covered with ECM, for 90 min. Wells were washed with phosphate-buffered saline, blocked with 1% bovine serum albumin, and then incubated with 9E10 mAb overnight at 40c, followed by incubating with horseradish peroxidase-conjugated anti-mouse secondary antibody. Proteins bound to the ECM were detected using the colorimetric reagent 3,3′,5,5′-tetramethylbenzidine (Chemicon). To test whether F-spondin is cleaved by tPA, we incubated conditioned medium of carboxyl-terminal Myc-tagged F-spondin (Fig.1A) together with elements of the tPA proteolysis complex. Incubation of F-spondin with plasmin (the tPA-activated plasminogen) (Fig. 1 B, lane 2) or with all of the proteolysis components: plasminogen, fibrin, and tPA (Fig. 1 B, lane 8), caused elimination of the 110-kDa protein (Fig. 1 B, lane 1). Incubation with the isolated components: Fb (Fig. 1 B, lane 5), tPA (Fig. 1 B, lane 6), tPA and plasminogen (Fig. 1 B, lane 7), and tPA and fibrin (Fig. 1 B, lane 9), did not result in cleavage of F-spondin. On the other hand, a combination of plasminogen and fibrin was active in the processing (Fig. 1 B, lane 4). This activity is probably mediated by the tPA that is produced by HEK293 Τ cells (30Arrick B.A. Lopez A.R. Elfman F. Ebner R. Damsky C.H. Derynck R. J. Cell Biol. 1992; 118: 715-726Crossref PubMed Scopus (148) Google Scholar, 31Kawakubo Y. Matsushita T. Funatsu K. Appl. Microbiol. Biotechnol. 1994; 41: 413-418Crossref PubMed Scopus (8) Google Scholar). To test the specificity of the cleavage, the serine protease inhibitor aprotinin and the metalloproteinase inhibitor EGTA were added. Addition of aprotinin abolished the plasmin-mediated cleavage of F-spondin (Fig.1 C, lanes 3 and 9), whereas addition of EGTA (Fig. 1 C, lanes 4 and 10) did not inhibit the degradation of F-spondin (compare with the non-inhibited plasmin-treated samples (Fig. 1 C, lanes 2 and 8)). Thus, F-spondin is cleaved specifically by plasmin at its carboxyl terminus. To map the plasmin cleavage sites we generated nested deletion constructs. F-spondin expression constructs containing the reelin/spondin domain and the reelin/spondin plus nested TSRs (Fig.2A) were transfected into HEK293 Τ cells. The conditioned medium was subjected to plasmin proteolysis, and the protein products were analyzed by the anti-reelin domain antibody R8. Except for TSR5a, the size of all the plasmin-treated proteins was unchanged. TS5a protein, however, was reduced, and thus the treated protein migrated faster than its untreated counterpart. This suggests that the cleavage site is carboxyl to the fourth TSR. To visualize the two protein cleavage products, an anti-TSR domain antibody (R2) was used. Proteins containing TSRs 1–6 and TSRs 2–6 (Fig. 2 B) were subjected to plasmin treatment. The 55-kDa TSR1–6 protein yielded a 40-kDa protein and a 16-kDa protein. The 46-kDa TSR2–6 protein yielded a 28-kDa and a 16-kDa protein (Fig.2 B) The 16-kDa proteolytic protein migrated to the same extent in both proteins, suggesting that the cleavage site in these proteins is identical. It is difficult to ascertain the precise cleavage site by the molecular masses of the plasmin proteolytic fragments because an N-linked glycosylation site is present at amino acids 681–683, within the fifth TSR. To pinpoint the plasmin cleavage site, nested deletions of 5 amino acids each, covering the 30-amino acid region that interspaced repeats 5 and 6, were generated. All of the proteins were equipped with the Myc epitope at the carboxyl terminus. The proteins were subjected to plasmin digestion and analyzed with anti-Myc mAb, to visualize the cleaved product, and anti-TSR antibody to detect the unprocessed and processed protein. TSR1–5+5 was resistant to 10 µg/ml plasmin, whereas TSR1–5+10, TSR1–5+15, and TSR1–5+20 were sensitive to plasmin (Fig. 3,A and B). Thus, a sensitive site (designated PL1) to plasmin is located carboxyl to the fifth TSR. It is plausible that another site is located amino to the PL1 site, within the fifth TSR. To test this hypothesis we incubated the TSR1–5+5 and TSR1–5+20 with increasing concentrations of plasmin. TSR1–5+20 was cleaved at 10 µg/ml, and TSR1–5+5 was fully cleaved at 50 µg/ml plasmin (Fig.3 C). The size products of the fully cleaved proteins were identical. Hence, it appears that a second site (PL2) is located amino to PL1. In the absence of PL1, the PL2 site is less sensitive to plasmin. We assume that an intermediate protein product appears with the TSR1–5+20 protein. Presumably, at 10 µg/ml plasmin, only the PL1 and not the PL2 site is digested. The fact that no intermediate size protein is detected suggests that the PL2 site renders high sensitivity after the PL1 site is cleaved. Plasmin cleaves after arginine or lysine. Two arginines are located at amino acids 730 and 732, between TSR1–5+5 and TSR1–5+10. Thus, these two arginines are potential cleavage sites for plasmin. The two arginines were mutated to proline and serine (Fig.4A). The mutated protein, designated PL1m, was analyzed with 9E10 and R2 antibodies (Fig. 4,A and B). The mutated protein was resistant to low concentrations of plasmin (Fig. 4 B). At higher concentrations, 50 µg/ml, a cleaved product was apparent (Fig. 4,C and D). The size of the cleaved product was identical to the size of the cleaved control protein TSR1–5a. Thus, mutating the arginines at positions 730–732 created a PL1-resistant protein. To locate the PL2 site, a similar approach was taken. Nested deletion proteins, of 5-amino acid intervals, in the fifth TSR, between TSR4+5 and TSR4+30 were generated. TSR4+5 (Fig.5A) TSR4+10 and TSR4+15 (data not shown) were resistant to plasmin at concentrations ranging from 10 to 100 µg/ml, as assessd by the anti-TSR antibody R2, and the anticarboxyl end 9E10. TSR1–4+30 (Fig. 5 B) and TSR1–4+20 (Fig. 5 C) were partially cleaved by 10 µg/ml and fully cleaved by 50–100 µg/ml. Thus, the PL2 site is located between TS4+15 and TS4+20. There are two lysines between the TSR1–4+15 and TSR1–4+20 at positions 682 and 686. The lysines were mutated to glycine and glutamic acid to generate PL2m (Fig.6A). A double mutant, DM, containing the PL1m and PL2m was also constructed. Analysis of the sensitivity of the proteins to plasmin with the 9E10 antibody, revealed that the carboxyl end of the wild type, TSR1–5a protein and the mutant PL2m protein were cleaved at low concentrations of plasmin. The PL1m and the DM were both resistant to low plasmin, with the DM protein being more resistant to higher concentrations of plasmin than PL1m (Fig. 6 B). The high sensitivity of PL2m, as judged by the elimination of the carboxyl end, is caused by the presence of a PL1-sensitive site in this protein. Analysis of the cleaved product with the R2 antibody revealed that there is a hierarchy in the appearance of the cleaved protein. The wild type protein is the most sensitive, followed by the PL2m, PL1m with the DM being the most resistant protein (Fig. 6, C and D). The super-resistance of the DM demonstrates that mutating the lysines at positions 682 and 686 reduced the plasmin sensitivity of F-spondin. Nevertheless, the DM protein is not completely resistant. There are two arginines at positions 693 and 695 (Fig. 6 A). Mutating those two sites did not change the plasmin sensitivity of F-spondin (data not shown). It is conceivable that mutating the 682 and 686 sites changed the conformation of the protein and exposed arginines 693 and 695 to plasmin.Figure 6A second plasmin cleavage site is located at lysines 682 and 686. Panel A, sequence of 40 amino acids of the fifth TSR. The lysines at position 682 and 686 (upper line, bold letters) were mutated to glycine and glutamic acid (second line, bold lowercaseletters). The arginines at positions 691 and 693 areunderlined. PL2m and DM were constructed in the backbone of TSR1–5a; hence, they have the Myc epitope at the carboxyl end.Panel B, analysis of plasmin (Plm) digestion using the 9E10 antibody. TSR1–5a and PL2m are sensitive to 10 µg/ml, whereas PL1m and DM are resistant to 10 and 20 µg/ml plasmin. A slight decrease of the band intensity is apparent with the 50 µg/ml plasmin. Panel C, analysis of panel A with the R2 antibody. The wild type protein is the most sensitive followed by PL2m, PL1m, and DM being the most resistant protein. Panel D, a densitometry of the bands in panel C was performed using NIH Image software. The ratio between the intensities of uncleaved to cleaved proteins was plotted in a logarithmic scale (y) as a function of plasmin concentrations (x).View Large Image Figure ViewerDownload (PPT) We have shown previously that the TSR domain of F-spondin binds to the ECM (19Klar A. Baldassare M. Jessell T.M. Cell. 1992; 69: 95-110Abstract Full Text PDF PubMed Scopus (305) Google Scholar, 25Feinstein Y. Borrell V. Garcia C. Burstyn-Cohen T. Tzarfaty V. Frumkin A. Nose A. Okamoto H. Higashijima S. Soriano A. Klar A. Development. 1999; 126: 3637-3648PubMed Google Scholar). To examine whether the processing of F-spondin by plasmin modulates its interaction with the ECM, we tested the binding properties of the TSRs. Fusion proteins containing an alkaline phosphatase (AP) fused to various combinations of TSRs were generated (Fig.7A). The conditioned media of HEK293 Τ transfected cells were incubated with tissue culture plates coated with bovine corneal endothelial cell ECM. The amount of bound protein was measured by an AP colorimetric reaction. All of the fusion proteins that contained TSR 5 or 6 or both (AP-TSR1–6, AP-TSR1–5, AP-TSR5, AP-TSR6, and AP-TSR5–6) bound to the ECM (Fig.7 B). Proteins restricted to repeats 1–4 (AP-TSR1, AP-TSR1–2, AP-TSR1–4) did not bind to the ECM (Fig. 7 B). The fifth TSR is more adhesive than the sixth. The binding levels of AP-TSR1–5 and AP-TSR1–6 are lower than the isolated fifth and sixth TSRs. This suggests that repeats 1–4 might reduce the affinity of repeats 5 and 6 in the context of the nonprocessed protein. Nevertheless, even binding the entire TSR domain is significantly gre" @default.
• W2002633931 created "2016-06-24" @default.
• W2002633931 creator A5013001058 @default.
• W2002633931 creator A5016883141 @default.
• W2002633931 creator A5028384912 @default.
• W2002633931 creator A5044506996 @default.
• W2002633931 creator A5045991293 @default.
• W2002633931 creator A5048803548 @default.
• W2002633931 creator A5058411556 @default.
• W2002633931 creator A5073484207 @default.
• W2002633931 date "2001-07-01" @default.
• W2002633931 modified "2023-10-10" @default.
• W2002633931 title "Plasmin-mediated Release of the Guidance Molecule F-spondin from the Extracellular Matrix" @default.
• W2002633931 cites W1501425607 @default.
• W2002633931 cites W1535245497 @default.
• W2002633931 cites W1543370562 @default.
• W2002633931 cites W1549631663 @default.
• W2002633931 cites W1597493507 @default.
• W2002633931 cites W1624346216 @default.
• W2002633931 cites W1671991021 @default.
• W2002633931 cites W1866676984 @default.
• W2002633931 cites W1942960670 @default.
• W2002633931 cites W1978849941 @default.
• W2002633931 cites W1979505297 @default.
• W2002633931 cites W1980876283 @default.
• W2002633931 cites W1983277257 @default.
• W2002633931 cites W1986551332 @default.
• W2002633931 cites W1992557354 @default.
• W2002633931 cites W1993655511 @default.
• W2002633931 cites W1994339372 @default.
• W2002633931 cites W1994551148 @default.
• W2002633931 cites W1997599469 @default.
• W2002633931 cites W1997792407 @default.
• W2002633931 cites W1998596090 @default.
• W2002633931 cites W2006108406 @default.
• W2002633931 cites W2014771072 @default.
• W2002633931 cites W2021131210 @default.
• W2002633931 cites W2021238307 @default.
• W2002633931 cites W2022665089 @default.
• W2002633931 cites W2023395361 @default.
• W2002633931 cites W2023825486 @default.
• W2002633931 cites W2025798304 @default.
• W2002633931 cites W2034299466 @default.
• W2002633931 cites W2041788236 @default.
• W2002633931 cites W2055515174 @default.
• W2002633931 cites W2059940674 @default.
• W2002633931 cites W2061850059 @default.
• W2002633931 cites W2062005186 @default.
• W2002633931 cites W2075172358 @default.
• W2002633931 cites W2086386772 @default.
• W2002633931 cites W2088320968 @default.
• W2002633931 cites W2091284497 @default.
• W2002633931 cites W2092751827 @default.
• W2002633931 cites W2093338466 @default.
• W2002633931 cites W2095378524 @default.
• W2002633931 cites W2106291035 @default.
• W2002633931 cites W2113240223 @default.
• W2002633931 cites W2124248841 @default.
• W2002633931 cites W2131405836 @default.
• W2002633931 cites W2137868041 @default.
• W2002633931 cites W2158499654 @default.
• W2002633931 cites W2167259460 @default.
• W2002633931 cites W2169628793 @default.
• W2002633931 cites W2185263664 @default.
• W2002633931 cites W2187818572 @default.
• W2002633931 cites W4230053059 @default.
• W2002633931 doi "https://doi.org/10.1074/jbc.m102585200" @default.
• W2002633931 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11359777" @default.
• W2002633931 hasPublicationYear "2001" @default.
• W2002633931 type Work @default.
• W2002633931 sameAs 2002633931 @default.
• W2002633931 citedByCount "33" @default.
• W2002633931 countsByYear W20026339312012 @default.
• W2002633931 countsByYear W20026339312013 @default.
• W2002633931 countsByYear W20026339312015 @default.
• W2002633931 countsByYear W20026339312016 @default.
• W2002633931 countsByYear W20026339312017 @default.
• W2002633931 countsByYear W20026339312018 @default.
• W2002633931 countsByYear W20026339312020 @default.
• W2002633931 countsByYear W20026339312022 @default.
• W2002633931 crossrefType "journal-article" @default.
• W2002633931 hasAuthorship W2002633931A5013001058 @default.
• W2002633931 hasAuthorship W2002633931A5016883141 @default.
• W2002633931 hasAuthorship W2002633931A5028384912 @default.
• W2002633931 hasAuthorship W2002633931A5044506996 @default.
• W2002633931 hasAuthorship W2002633931A5045991293 @default.
• W2002633931 hasAuthorship W2002633931A5048803548 @default.
• W2002633931 hasAuthorship W2002633931A5058411556 @default.
• W2002633931 hasAuthorship W2002633931A5073484207 @default.
• W2002633931 hasBestOaLocation W20026339311 @default.
• W2002633931 hasConcept C106487976 @default.
• W2002633931 hasConcept C12554922 @default.
• W2002633931 hasConcept C181199279 @default.
• W2002633931 hasConcept C185592680 @default.
• W2002633931 hasConcept C189165786 @default.
• W2002633931 hasConcept C2781071845 @default.
• W2002633931 hasConcept C28406088 @default.
• W2002633931 hasConcept C43617362 @default.

• next