FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2002669881> ?p ?o ?g. }

• W2002669881 endingPage "17619" @default.
• W2002669881 startingPage "17610" @default.
• W2002669881 abstract "Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5′-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068–8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068–8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought. Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5′-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068–8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068–8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought. double-stranded single-stranded Herpes simplex virus type 1 Superfamily 1 5-iododeoxyuridine dithiothreitol forked substrate adenosine 5′-O-(thiotriphosphate) polyacrylamide gel electrophoresis DNA helicases catalyze the transient unwinding of dsDNA1 to form ssDNA using the energy of NTP hydrolysis. Helicases are essential in many biological processes including replication, recombination, transcription, and DNA repair and have been isolated from prokaryotes, eukaryotes, and viruses. The helicase-primase complex of herpes simplex virus type 1 (HSV-1) is a heterotrimeric complex composed of the products of the UL5, UL52, and UL8 genes (1Crute J.J. Tsurumi T. Zhu L. Weller S.K. Olivo P.D. Challberg M.D. Mocarski E.S. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 2186-2189Crossref PubMed Scopus (171) Google Scholar). All three genes are essential for viral DNA replication (2Carmichael E.P. Weller S.K. J. Virol. 1989; 63: 591-599Crossref PubMed Google Scholar, 3Goldstein D.J. Weller S.K. J. Virol. 1988; 62: 2970-2977Crossref PubMed Google Scholar, 4Olivo P.D. Challberg M.D. Wagner E. Herpesvirus Transcription and Its Regulation.in: CRC Press, Inc., Boca Raton, FL1990: 137-150Google Scholar, 5Weller S.K. Wagner E. Herpesvirus Transcription and Its Regulation.in: CRC Press, Inc., Boca Raton, FL1990: 105-135Google Scholar, 6Weller S.K. Cooper G.M. Sugden B. Temin R. Implications of the DNA Provirus: Howard Temin's Scientific Legacy.in: ASM Press, Washington, D. C.1995: 189-213Google Scholar, 7Zhu L. Weller S.K. Virology. 1988; 166: 366-378Crossref PubMed Scopus (30) Google Scholar). The UL5-UL52-UL8 complex possesses primase, ssDNA-dependent NTPase, and 5′ to 3′ DNA helicase activities (1Crute J.J. Tsurumi T. Zhu L. Weller S.K. Olivo P.D. Challberg M.D. Mocarski E.S. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 2186-2189Crossref PubMed Scopus (171) Google Scholar, 8Crute J.J. Mocarski E.S. Lehman I.R. Nucleic Acids Res. 1988; 16: 6585-6596Crossref PubMed Scopus (87) Google Scholar, 9Dodson M.S. Crute J.J. Bruckner R.C. Lehman I.R. J. Biol. Chem. 1989; 264: 20835-20838Abstract Full Text PDF PubMed Google Scholar, 10Calder J.M. Stow N.D. Nucleic Acids Res. 1990; 18: 3573-3578Crossref PubMed Scopus (58) Google Scholar, 11Crute J.J. Lehman I.R. J. Biol. Chem. 1991; 266: 4484-4488Abstract Full Text PDF PubMed Google Scholar). The HSV-1 helicase-primase complex can be isolated from insect cells that have been simultaneously infected with recombinant baculoviruses that express each of the three subunits (9Dodson M.S. Crute J.J. Bruckner R.C. Lehman I.R. J. Biol. Chem. 1989; 264: 20835-20838Abstract Full Text PDF PubMed Google Scholar). A subassembly consisting of the UL5 and UL52gene products also exhibits all the enzymatic activities of the holoenzyme in vitro (12Dodson M.S. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1105-1109Crossref PubMed Scopus (84) Google Scholar). The UL5 protein contains seven conserved motifs found in all members of Superfamily 1 (SF1) helicase proteins (13Gorbalenya A.E. Koonin E.V. Curr. Opin. Struct. Biol. 1993; 3: 419-429Crossref Scopus (1017) Google Scholar). The UL52 protein contains several conserved motifs found in other primases (14Klinedinst D.K. Challberg M.D. J. Virol. 1994; 68: 3693-3701Crossref PubMed Google Scholar, 15Dracheva S. Koonin E.V. Crute J.J. J. Biol. Chem. 1995; 270: 14148-14153Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Neither UL5 nor UL52 appears to possess any enzymatic activities when expressed alone (9Dodson M.S. Crute J.J. Bruckner R.C. Lehman I.R. J. Biol. Chem. 1989; 264: 20835-20838Abstract Full Text PDF PubMed Google Scholar, 12Dodson M.S. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1105-1109Crossref PubMed Scopus (84) Google Scholar). The UL8 gene product does not exhibit any enzymatic activities (10Calder J.M. Stow N.D. Nucleic Acids Res. 1990; 18: 3573-3578Crossref PubMed Scopus (58) Google Scholar, 12Dodson M.S. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1105-1109Crossref PubMed Scopus (84) Google Scholar) but can stimulate both the helicase and primase activities of the helicase-primase complex (16Hamatake R.K. Bifano M. Hurlburt W.W. Tenney D.J. J. Gen. Virol. 1997; 78: 857-865Crossref PubMed Scopus (37) Google Scholar, 17Le Gac N.T. Villane G. Hoffmann J.-S. Boehmer P.E. J. Biol. Chem. 1996; 271: 21645-21651Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 18Sherman G. Gottlieb J. Challberg M.D. J. Virol. 1992; 66: 4884-4892Crossref PubMed Google Scholar, 19Tenney D.J. Hurlburt W.W. Micheletti P.A. Bifano M. Hamatake R.K. J. Biol. Chem. 1994; 269: 5030-5035Abstract Full Text PDF PubMed Google Scholar). Furthermore, UL8 may facilitate the entry of the heterotrimer into the nucleus of infected cells (20Calder J.M. Stow E.C. Stow N.D. J. Gen. Virol. 1992; 73: 531-538Crossref PubMed Scopus (42) Google Scholar, 21Marsden H.S. Cross A.M. Francis G.J. Patel A.H. MacEachran K. Murphy M. McVey G. Haydon D. Abbots A. Stow N.D. J. Gen. Virol. 1996; 77: 2241-2249Crossref PubMed Scopus (28) Google Scholar). Although the molecular details of the mechanism of DNA unwinding is unknown for any helicase, it is likely that the unwinding reaction requires the coupling of several events such as ATP binding, ATP hydrolysis, single strand and double strand DNA binding, and translocation along the DNA. Many helicases function as multimers such as dimers (e.g. Escherichia coli Rep (22Wong I. Chao K.L. Bujalowski W. Lohman T.M. J. Biol. Chem. 1992; 267: 7596-7610Abstract Full Text PDF PubMed Google Scholar, 23Wong I. Lohman T.M. Science. 1992; 256: 350-355Crossref PubMed Scopus (164) Google Scholar)) or hexamers (e.g. helicases of T4 and T7 bacteriophages (24Patel S.S. Hingorani M.M. J. Biol. Chem. 1993; 268: 10668-10675Abstract Full Text PDF PubMed Google Scholar, 25Dong F. von Hippel P.H. J. Biol. Chem. 1996; 271: 19625-19631Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar) and SV40 large T antigen (26Joo W.S. Kim H.Y. Purviance J.D. Sreekumar K.R. Bullock P.A. Mol. Cell. Biol. 1998; 18: 2677-2687Crossref PubMed Scopus (44) Google Scholar, 27Smelkova N.V. Borowiec J.A. J. Virol. 1997; 71: 8766-8773Crossref PubMed Google Scholar)). Although it has been suggested that oligomeric structures provide multiple DNA binding sites, which are required for helicase action (28Lohman T.M. J. Biol. Chem. 1993; 268: 2269-2272Abstract Full Text PDF PubMed Google Scholar), it appears that at least two helicases, E. coliDNA helicase II and Bacillus stearothermophilus PcrA, are active as monomers (29Mechanic L.E. Hall M.C. Matson S.W. J. Biol. Chem. 1999; 274: 12488-12498Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 30Velankar S.S. Soultanas P. Dillingham M.S. Subramanya H.S. Wigley D.B. Cell. 1999; 97: 75-84Abstract Full Text Full Text PDF PubMed Scopus (664) Google Scholar). Three models to explain the mechanism of helicase activity have been proposed. The inchworm model posits that conformational changes caused by binding and hydrolysis of ATP cause a helicase monomer to “inch” along the DNA (30Velankar S.S. Soultanas P. Dillingham M.S. Subramanya H.S. Wigley D.B. Cell. 1999; 97: 75-84Abstract Full Text Full Text PDF PubMed Scopus (664) Google Scholar, 31Yarranton G.T. Gefter M.L. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 1658-1662Crossref PubMed Scopus (149) Google Scholar). Monomeric helicases would presumably contain at least two nonidentical DNA binding sites on each monomer. The rolling model, which is based on the dimeric Rep protein, posits that a helicase must act as (at least) a dimer and that each subunit of the dimer can bind to either ssDNA or duplex DNA (23Wong I. Lohman T.M. Science. 1992; 256: 350-355Crossref PubMed Scopus (164) Google Scholar). According to this model, a helicase rolls along the DNA with alternating subunits binding first to ds then to ssDNA. A third model proposed for the hexameric helicases posits that the core of the hexameric unit provides a channel through which a single strand of DNA can be threaded (32Ahnert P. Patel S.S. J. Biol. Chem. 1997; 272: 32267-32273Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 33Jezewska M.J. Rajendran S. Bujalowska D. Bujalowski W. J. Biol. Chem. 1998; 273: 10515-10529Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 34Jezewska M.J. Rajendran S. Bujalowski W. J. Biol. Chem. 1998; 273: 9058-9069Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The protein would move along one strand with alternating subunits responsible for ATP hydrolysis. To distinguish between these models and to understand the mechanism of helicase action, it will be necessary to obtain more detailed information about how helicases contact DNA. Two members of SF1 helicases, Rep and PcrA, have been crystallized in the presence of DNA (30Velankar S.S. Soultanas P. Dillingham M.S. Subramanya H.S. Wigley D.B. Cell. 1999; 97: 75-84Abstract Full Text Full Text PDF PubMed Scopus (664) Google Scholar, 35Korolev S. Hsieh J. Gauss G.H. Lohman T.M. Waksman G. Cell. 1997; 90: 635-647Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar). The crystal structure of the E. coli Rep helicase bound to ssDNA, and ADP revealed putative contact residues for ssDNA on the protein (35Korolev S. Hsieh J. Gauss G.H. Lohman T.M. Waksman G. Cell. 1997; 90: 635-647Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar); however, many of these assignments have not been confirmed by genetic analysis. Previous DNA binding studies revealed that the UL5-UL52 subcomplex binds to ssDNA more effectively than to dsDNA and that the minimum length of ssDNA that can bind and stimulate its ATPase activity is about 12 nucleotides (36Healy S. You X. Dodson M. J. Biol. Chem. 1997; 272: 3411-3415Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). Herein we show that the UL5-UL52 subcomplex binds much more efficiently to a forked substrate than to either ss or dsDNA. The fact that the HSV-1 helicase is part of a multiprotein complex complicates the analysis of the DNA binding sites of the individual subunits. We have previously shown that both subunits can contact single-stranded DNA in a photocross-linking assay (37Biswas N. Weller S.K. J. Biol. Chem. 1999; 274: 8068-8076Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Moreover, we have shown a complex interdependence on both subunits for DNA binding, in that a mutation in the putative Zinc binding domain of the UL52 subunit has drastic effects on the ability of UL5 to cross-link single-stranded DNA. In this paper we have taken two approaches to study the interaction of the UL5-UL52 subcomplex with DNA. Cross-linking studies using forked substrates with substitutions of deoxyuridine (dIU) in three different positions indicate that the UL5 and UL52 subunits contact the forked substrates at different positions; UL5 appears to contact DNA near the fork, whereas UL52 appears to contact the ss tail of the forked substrate. Neither subunit appears to directly contact dsDNA. In a second approach, we performed DNA binding and cross-linking assays on a series of UL5 mutants whose mutations lie in conserved helicase motifs shared by other SF1 members (38Graves-Woodward K. Weller S.K. J. Biol. Chem. 1996; 271: 13629-13635Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The results confirm a complex interdependence between the two subunits and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought. Furthermore, these studies suggest that the HSV-1 helicase-primase may act as a monomer (one heterotrimer per replication fork) and favor the inchworm model for the mechanism for helicase activity. Supplemented Graces's medium and 10% Pluronic®F were purchased from Life Technologies, Inc. Fetal calf serum was obtained from Atlanta Biologicals. Penicillin-streptomycin solution, ampicillin, phenylmethylsulfonyl fluoride, leupeptin, and pepstatin were purchased from Sigma. The 20-ml HiLoad 16/10 SP-Sepharose fast flow column was from Amersham Pharmacia Biotech. Inc. The 12-ml Uno Q (Q-12) column was from Bio-Rad. The 25-ml Superose 12 HR column was from Bio-Rad. Radiolabeled nucleotides were purchased from Amersham Pharmacia Biotech. Substituted oligonucleotides were synthesized from Cruachem. A polyclonal antibody (1248) directed against the C-terminal 10 amino acids of UL52 was a kind gift from Dr. Mark Challberg (National Institutes of Health, Bethesda, MD). Buffer A consists of 20 mm HEPES (pH 7.6), 1.0 mm dithiothreitol (DTT), 10 mm sodium bisulfite, 5 mm MgCl2, 0.5 mmphenylmethylsulfonyl fluoride, 0.5 μg/ml leupeptin, 1 μg/ml pepstatin, and 2 μg/ml aprotinin. Buffer B contains 20 mmHEPES, pH 7.6, 1.0 mm DTT, 10% (v/v) glycerol, and 0.5 mm EDTA. All buffers were passed through a 0.22-μm filter and degassed before use. Spodoptera frugiperda(Sf9) cells were maintained at 27 °C in Graces's insect medium containing 10% fetal calf serum, 0.33% lactalbumin hydrolysate, 0.33% yeastolate, 0.1 mg/ml streptomycin, and 100 units/ml penicillin. The recombinant Autographa californicanuclear polyhedrosis baculovirus expressing HSV-1 UL5 was generously provided by Dr. Robert Lehman (Stanford University School of Medicine, Stanford, CA). The recombinant baculovirus expressing UL52 was a kind gift from Dr. Nigel D. Stow (Medical Research Council Virology Unit, Glasgow, United Kingdom). The recombinant baculovirus expressing UL8 was generously provided by Dr. Mark Challberg (National Institutes of Health). Baculovirus recombinants harboring UL5 motif mutant genes, AcUL5G102V (motif I), BacUL5-DE249,250AA (motif II), BacUL5-G290S (motif III), AcUL5R345K (motif IV), AcUL5-G815A (motif V), and BacUL5-Y836A (motif VI) were described previously (39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Viral stocks were amplified in Sf9 cells grown in suspension as described previously (39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Stocks were titered by determining the volume of viral stock, which gave the maximum level of recombinant protein expression on 1 × 106 Sf9 cells at 48 h post-infection. 2 liters of Sf9 cells were grown in suspension at 27 °C in Graces's insect medium as described previously (39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The wild type and variant UL5-UL52 subcomplexes were purified essentially as described earlier with an additional gel filtration step. Cells were dounced using 15 strokes of a tight fitting pestle in Buffer A, and the cytosolic extracts were clarified by centrifugation at 35,000 × g for 30 min. UL5-UL52 subcomplexes were precipitated from the cytosolic extract by the addition of an equal volume of Buffer B containing 0.2m NaCl and 2 m ammonium sulfate and incubation on ice for 4 h. The resultant protein pellets were resuspended in Buffer B containing 0.1 m NaCl and dialyzed against the same buffer. The dialyzed sample was loaded onto an SP-Sepharose column equilibrated with Buffer B containing 0.1 m NaCl, and the column was washed with 5 column volumes of the equilibration buffer. Fractions containing the UL5-UL52 subcomplex were identified by SDS polyacrylamide gel electrophoresis. The UL5-UL52 subcomplex elutes from the column in the void volume. Pooled fractions from the SP-Sepharose column were loaded onto a 12-ml Uno Q column equilibrated with Buffer B containing 0.1 m NaCl. The column was washed with five column volumes of Buffer B containing 0.1 m NaCl, and the protein was eluted using a 185-ml linear gradient of Buffer B containing 0.1–1 m NaCl. Pooled fractions from the Uno Q column were concentrated using a centrifugal concentrator with a 10-kDa cut-off (MicrosepTM, Pall Filtron) and loaded onto a 25-ml Superose 12 HR column equilibrated with Buffer B containing 0.1m NaCl. The fractions containing the peak activities were pooled, concentrated, and frozen at −70 °C. An 18-mer of oligo(dT), PCdT18(5), with a dIU substitution at the 5th T from the 5′ end was synthesized by Cruachem and end-labeled with [γ-32P]ATP. Forked DNA substrate A was constructed by heat denaturing and annealing 80 pmol of the helicase 48C/FS oligonucleotide (5′ CGAAAGTACGTTATTGCGACTGGCCGTCGCTCTACAACGTCGTGACTG 3′) radiolabeled at its 5′ end with [γ-32P]ATP and 80 pmol of unlabeled 48FS oligonucleotide (5′CAGTCACGACGTTGTAGAGCGACGGCCAGTCGGTTATTGCATGAAAGC 3′). The underlined residues are complementary and create the duplex region of the molecule. After annealing, the products were subjected to electrophoresis on an 8% nondenaturing polyacrylamide gel, and the forked substrate was purified by electroelution and ethanol precipitation. Forked substrates (FS B, FS C, and FS D) were prepared by annealing 80 pmol of each of the end-labeled 48C/FSM oligonucleotide (5′ CGAAAGdIUACGTTATTGCGACTGGCCGTCGCTCTACAACGTCGTGACTG3′), 48C/FSM27 oligonucleotide (5′ CGAAAGTACGTTATTGCGACTGGCCGdIUCGCTCTACAACGTCGTGACTG3′), or 48C/FSM15 oligonucleotide (5′ CGAAAGTACGTTATdIUGCGACTGGCCGTCGCTCTACAACGTCGTGACTG3′), respectively, to 80 pmol of the unlabeled 48FS oligonucleotide. In FS B, the substitution is in the 7th position from the 5′ end of the lower (labeled) strand (see Fig. 2). In FS C, the dIU substitution is within the duplex region (see Fig. 2), and in FS D, the substitution is within the ss region of the lower (labeled) strand very near the ss/dsDNA junction. The duplex DNA substrate was prepared in a similar manner; 80 pmol of 32 S oligonucleotide (5′CAGTCACGACGTTGTAGAGCGACGGCCAGTCG3′) was annealed to the complementary 32 CS oligonucleotide (5′CGACTGGCCGTCGCTC- TACAACGTCGTGACTG3′). Gel mobility shift assays were essentially performed as described previously (39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The reaction mixture (25 μl) contained 20 mm Na+ HEPES (pH 7.6), 1 mm DTT, 0.1 mg/ml bovine serum albumin, 10% glycerol, 5 mm MgCl2, 1.2 pmol (molecules) of the DNA substrates labeled with [γ-P32]ATP and 4 pmol of the UL5-UL52 subcomplex with or without UL8 protein (12 pmol), ATP (5 mm), ADP (5 mm), or ATPγS (5 mm). The reaction was allowed to proceed for 10 min on ice and terminated by the addition of one-tenth of a volume of a loading solution (80% glycerol, 0.1% bromphenol blue). Reaction products were analyzed on a 4% nondenaturing acrylamide, 0.11% bisacrylamide gel at 150 V at 4 °C. The gels were dried and exposed to film at −70 °C. Photocross-linking experiments were performed essentially as described previously with 1.2 pmol of the indicated DNA substrate molecules and 4 pmol of UL5-UL52 subcomplex in 20 mm Na+ HEPES (pH 7.6), 1 mm DTT, 0.1 mg/ml bovine serum albumin, 10% glycerol, and 5 mmMgCl2 (37Biswas N. Weller S.K. J. Biol. Chem. 1999; 274: 8068-8076Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). The samples were incubated on ice for 10 min before irradiation. An IK series He-Cd laser (IK 3302R-E, KIMMON; Kimmon Electric Co., Ltd.) was used to achieve monochromatic 325-nm light. The laser beam output was 34 milliwatts measured with a power meter, Mentor MA10, Scientech® (Scientech, Inc., Boulder, CO). Samples were irradiated in a methacrylate cuvette (catalog number 14-385-938; Fisherbrand) at room temperature. At different time points aliquots were withdrawn, boiled for 5 min in SDS-PAGE loading buffer, and subjected to SDS-PAGE on an 8% gel. The gels were dried and exposed to film at −70 °C. Previous studies with the UL5-UL52 subcomplex indicated a preference for ssversus dsDNA; in a filter-binding experiment the subcomplex bound ssDNA about 5-fold more effectively than it did dsDNA (36Healy S. You X. Dodson M. J. Biol. Chem. 1997; 272: 3411-3415Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). We previously showed that the UL5-UL52 subcomplex could bind a forked substrate generated by the annealing of partially complementary oligonucleotides (39Graves-Woodward K.L. Gottlieb J. Challberg M.D. Weller S.K. J. Biol. Chem. 1997; 272: 4623-4630Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Here we compare the binding efficiencies of UL5-UL52 to the forked substrate and to single- and double-stranded DNA using a mobility shift experiment. Fig. 1shows that the UL5-UL52 subcomplex can bind forked, ss, and dsDNA (Fig.1, lanes b, i, and p, respectively). The gel shift data indicate that the binding of the UL5-UL52 subcomplex to a forked substrate is at least 8-fold higher than to ssDNA and is at least 35-fold higher than to dsDNA. Addition of UL8 to the binding reaction resulted in a supershift to a slower migrating species (Fig.1, lanes c, j, and q); in the case of the forked substrate (Fig. 1, lane c), the supershifted band is somewhat smeared, perhaps reflecting the complex interactions exhibited by UL5-UL52 with forked DNA (see below). Quantification of the gel shift data indicates that the UL8 stimulates the binding of UL5-UL52 to both forked (1.8-fold) and ss (2.2-fold) DNA substrates (Table I). To determine whether nucleotide di- and triphosphates play a role in the DNA binding properties of UL5-UL52, the binding of the subcomplex with ss and forked DNA substrates was tested in the presence of ATP, ADP, and ATPγS (Fig. 1). Single strand DNA binding was stimulated 1.6-fold in the presence of ADP, and the binding of UL5-UL52 to forked substrate was stimulated in the presence of ATP (1.4-fold), ADP (1.3-fold), and ATPγS (1.5-fold) (Table I). In summary, it appears that the UL5-UL52 subcomplex binds much more efficiently to the forked substrate than to either single-stranded or double-stranded DNA; the addition of UL8 or nucleotide cofactors exhibited modest but reproducible stimulatory effects on DNA binding of the subcomplex. The similar levels of stimulation observed with ADP, ATP, and ATPγS suggest that the binding of ATP but not its hydrolysis is important for optimal binding of UL5-UL52 to the forked substrate.Table IRelative affinity of UL5-UL52 for forked and single strand oligo DNA substrates in the presence and absence of UL8 and nucleotides% Shifted DNA substrate 1-aDNA binding was measured with a phosphorimager system. The relative DNA binding efficiencies were calculated with respect to the total number of counts; 100% is defined as the net number of counts in the aliquot lacking any enzyme. The values represent the average of three independent experiments. Mean deviations are shown.Forked substrateSingle strand oligoUL5-UL5212 ± 21.5 ± 0.2UL5-UL52 + UL821.6 ± 1.43.3 ± 0.2UL5-UL52 + ATP16.8 ± 1.21.4 ± 0.1UL5-UL52 + ADP15.4 ± 1.72.4 ± 0.2UL5-UL52 + ATPγS18 ± 21.4 ± 0.11-a DNA binding was measured with a phosphorimager system. The relative DNA binding efficiencies were calculated with respect to the total number of counts; 100% is defined as the net number of counts in the aliquot lacking any enzyme. The values represent the average of three independent experiments. Mean deviations are shown. Open table in a new tab We have previously used a photocross-linking assay to show that both UL5 and UL52 subunits of the wild type UL5-UL52 subcomplex can contact a short ss oligomer (37Biswas N. Weller S.K. J. Biol. Chem. 1999; 274: 8068-8076Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). During replication, the helicase-primase would presumably contact a replication fork consisting of double- and single-stranded DNA; we therefore initiated cross-linking studies using a series of forked substrates shown in Fig.2. A He-Cd light source that emits at 325 nm was used to photocross-link the UL5-UL52 subcomplex to a32P end-labeled forked substrate in which dIU was substituted for one of the thymidine residues. In FS B, dIU was placed in the ss portion of the substrate at a position 7 nucleotides from the 5′ end of the lower strand (Fig. 2). The UL5-UL52 subcomplex was cross-linked to a 5′ 32P-labeled single strand oligonucleotide (Fig. 3 A,lane a) or to a 5′ 32P-labeled forked substrate (FS B) (Fig. 3 A, lane b). As previously reported (37Biswas N. Weller S.K. J. Biol. Chem. 1999; 274: 8068-8076Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar), when the subcomplex was cross-linked to the single strand oligonucleotide, two labeled bands were observed by SDS-PAGE, one migrating at ∼100 kDa corresponding to UL5 and a slower band migrating at 120 kDa corresponding to UL52 (Fig. 3 A,lane a). When the UL5-UL52 subcomplex was cross-linked to FS B, however, slower migrating bands were observed (Fig. 3 A,lane b); the uppermost band migrates at a position corresponding to ∼220 kDa and a lower set of smeared bands, which may contain two or more species migrating at a position corresponding to 170–195 kDa. A time course of binding in which the UL5-UL52 subcomplex was incubated with FS B irradiated for varying lengths of times was performed to determine whether the pattern of cross-linked bands changes with time. Fig. 3 B shows that the time of irradiation correlates with the amount of cross-linked material and that the pattern of bands, a 220-kDa band and two or more bands migrating between 170 and 195 kDa, remains constant throughout the experiment. To f" @default.
• W2002669881 created "2016-06-24" @default.
• W2002669881 creator A5027226960 @default.
• W2002669881 creator A5046730925 @default.
• W2002669881 date "2001-05-01" @default.
• W2002669881 modified "2023-10-16" @default.
• W2002669881 title "The UL5 and UL52 Subunits of the Herpes Simplex Virus Type 1 Helicase-Primase Subcomplex Exhibit a Complex Interdependence for DNA Binding" @default.
• W2002669881 cites W1519314712 @default.
• W2002669881 cites W1521918462 @default.
• W2002669881 cites W1531287894 @default.
• W2002669881 cites W1579009843 @default.
• W2002669881 cites W1591068460 @default.
• W2002669881 cites W1595354886 @default.
• W2002669881 cites W1603167745 @default.
• W2002669881 cites W1665467628 @default.
• W2002669881 cites W179615635 @default.
• W2002669881 cites W1814375881 @default.
• W2002669881 cites W1990056682 @default.
• W2002669881 cites W1992657957 @default.
• W2002669881 cites W1996320201 @default.
• W2002669881 cites W2000581423 @default.
• W2002669881 cites W2003660437 @default.
• W2002669881 cites W2008163029 @default.
• W2002669881 cites W2010103213 @default.
• W2002669881 cites W2011541267 @default.
• W2002669881 cites W2013862684 @default.
• W2002669881 cites W2026133647 @default.
• W2002669881 cites W2026628085 @default.
• W2002669881 cites W2042648413 @default.
• W2002669881 cites W2043274368 @default.
• W2002669881 cites W2045141872 @default.
• W2002669881 cites W2048182350 @default.
• W2002669881 cites W2058226943 @default.
• W2002669881 cites W2061271492 @default.
• W2002669881 cites W2062698938 @default.
• W2002669881 cites W2064774284 @default.
• W2002669881 cites W2067362960 @default.
• W2002669881 cites W2072690167 @default.
• W2002669881 cites W2090108157 @default.
• W2002669881 cites W2101288526 @default.
• W2002669881 cites W2103286702 @default.
• W2002669881 cites W2103946321 @default.
• W2002669881 cites W2113985542 @default.
• W2002669881 cites W2119300356 @default.
• W2002669881 cites W2122571070 @default.
• W2002669881 cites W2132748660 @default.
• W2002669881 cites W2136297873 @default.
• W2002669881 cites W2143048739 @default.
• W2002669881 cites W2149550829 @default.
• W2002669881 cites W2151541959 @default.
• W2002669881 cites W1545033923 @default.
• W2002669881 doi "https://doi.org/10.1074/jbc.m010107200" @default.
• W2002669881 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11278618" @default.
• W2002669881 hasPublicationYear "2001" @default.
• W2002669881 type Work @default.
• W2002669881 sameAs 2002669881 @default.
• W2002669881 citedByCount "22" @default.
• W2002669881 countsByYear W20026698812013 @default.
• W2002669881 countsByYear W20026698812014 @default.
• W2002669881 countsByYear W20026698812015 @default.
• W2002669881 countsByYear W20026698812017 @default.
• W2002669881 countsByYear W20026698812018 @default.
• W2002669881 countsByYear W20026698812019 @default.
• W2002669881 countsByYear W20026698812021 @default.
• W2002669881 crossrefType "journal-article" @default.
• W2002669881 hasAuthorship W2002669881A5027226960 @default.
• W2002669881 hasAuthorship W2002669881A5046730925 @default.
• W2002669881 hasBestOaLocation W20026698811 @default.
• W2002669881 hasConcept C104317684 @default.
• W2002669881 hasConcept C121332964 @default.
• W2002669881 hasConcept C153911025 @default.
• W2002669881 hasConcept C156719811 @default.
• W2002669881 hasConcept C159047783 @default.
• W2002669881 hasConcept C161223559 @default.
• W2002669881 hasConcept C194830204 @default.
• W2002669881 hasConcept C2522874641 @default.
• W2002669881 hasConcept C2781196997 @default.
• W2002669881 hasConcept C49105822 @default.
• W2002669881 hasConcept C54355233 @default.
• W2002669881 hasConcept C552990157 @default.
• W2002669881 hasConcept C67705224 @default.
• W2002669881 hasConcept C77400797 @default.
• W2002669881 hasConcept C86339819 @default.
• W2002669881 hasConcept C86803240 @default.
• W2002669881 hasConcept C94966510 @default.
• W2002669881 hasConceptScore W2002669881C104317684 @default.
• W2002669881 hasConceptScore W2002669881C121332964 @default.
• W2002669881 hasConceptScore W2002669881C153911025 @default.
• W2002669881 hasConceptScore W2002669881C156719811 @default.
• W2002669881 hasConceptScore W2002669881C159047783 @default.
• W2002669881 hasConceptScore W2002669881C161223559 @default.
• W2002669881 hasConceptScore W2002669881C194830204 @default.
• W2002669881 hasConceptScore W2002669881C2522874641 @default.
• W2002669881 hasConceptScore W2002669881C2781196997 @default.
• W2002669881 hasConceptScore W2002669881C49105822 @default.
• W2002669881 hasConceptScore W2002669881C54355233 @default.
• W2002669881 hasConceptScore W2002669881C552990157 @default.
• W2002669881 hasConceptScore W2002669881C67705224 @default.

• next