FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003219076> ?p ?o ?g. }

• W2003219076 endingPage "28676" @default.
• W2003219076 startingPage "28667" @default.
• W2003219076 abstract "Expression of both the apolipoprotein (apo)E and apoC-I genes in the liver is specified by a 319-nucleotide hepatic control region (HCR-1) that is located 15 kilobase pairs downstream of the apoE gene and 5 kilobase pairs downstream of the apoC-I gene. In vivo footprint analysis of HCR-1 in intact nuclei revealed several liver-specific protein-binding sites that were not detectable by in vitro methods. In addition to three previously identified in vitro footprints, four in vivo footprints were identified in a region of HCR-1 that is required for directing gene expression to hepatocytes. Prominent liver-specific DNase I-hypersensitive sites were associated with these footprints. Liver-specific nuclear protein binding to these sites was confirmed by oligonucleotide gel-retention assays. The in vivo analysis also identified a cluster of nuclear protein-binding sites in the Alu family repeat segment adjacent to the domain required for liver expression. Micrococcal nuclease digestion indicated the presence of a nucleosome in the central domain of HCR-1 in liver chromatin that was in phase with the nucleosome location in tissues that did not express the transgene. These results suggest that HCR-1 functions in a highly structured chromatin environment requiring a complex interaction of liver-enriched transcription factors. Expression of both the apolipoprotein (apo)E and apoC-I genes in the liver is specified by a 319-nucleotide hepatic control region (HCR-1) that is located 15 kilobase pairs downstream of the apoE gene and 5 kilobase pairs downstream of the apoC-I gene. In vivo footprint analysis of HCR-1 in intact nuclei revealed several liver-specific protein-binding sites that were not detectable by in vitro methods. In addition to three previously identified in vitro footprints, four in vivo footprints were identified in a region of HCR-1 that is required for directing gene expression to hepatocytes. Prominent liver-specific DNase I-hypersensitive sites were associated with these footprints. Liver-specific nuclear protein binding to these sites was confirmed by oligonucleotide gel-retention assays. The in vivo analysis also identified a cluster of nuclear protein-binding sites in the Alu family repeat segment adjacent to the domain required for liver expression. Micrococcal nuclease digestion indicated the presence of a nucleosome in the central domain of HCR-1 in liver chromatin that was in phase with the nucleosome location in tissues that did not express the transgene. These results suggest that HCR-1 functions in a highly structured chromatin environment requiring a complex interaction of liver-enriched transcription factors. The human apolipoprotein (apo) 1The abbreviations used are: apoapolipoproteinBKLFbasic Krüppel-like factorEKLFerythroid Krüppel-like factorHCRhepatic control regionLMPCRligation-mediated polymerase chain reactionMNasemicrococcal nucleasekbkilobase pair(s)bpbase pair(s). E gene spans 3.6 kb (1Das H.K. McPherson J. Bruns G.A.P. Karathanasis S.K. Breslow J.L. J. Biol. Chem. 1985; 260: 6240-6247Abstract Full Text PDF PubMed Google Scholar, 2Olaisen B. Teisberg P. Gedde-Dahl Jr., T. Hum. Genet. 1982; 62: 233-236Crossref PubMed Scopus (110) Google Scholar, 3Paik Y.-K. Chang D.J. Reardon C.A. Davies G.E. Mahley R.W. Taylor J.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 3445-3449Crossref PubMed Scopus (223) Google Scholar) and is located at the 5′ end of a 45-kb cluster of apolipoprotein genes on chromosome 19, all of which have the same transcriptional orientation (4Lauer S.J. Walker D. Elshourbagy N.A. Reardon C.A. Levy-Wilson B. Taylor J.M. J. Biol. Chem. 1988; 263: 7277-7286Abstract Full Text PDF PubMed Google Scholar). The apoC-I gene (4.7 kb) is located 5.3 kb downstream from the apoE gene, and a 4.4-kb apoC-I′ pseudogene is located 7.5 kb further downstream. The apoC-II gene (3.3 kb) is ∼16 kb downstream from the apoC-I′ pseudogene. Recently, the apoC-IV gene (3.3 kb), located 555 bp upstream from the apoC-II gene, has been identified in this locus (5Allan C.M. Walker D. Segrest J.P. Taylor J.M. Genomics. 1995; 28: 291-300Crossref PubMed Scopus (69) Google Scholar). Each of these genes contains four exons (except apoC-IV, which lacks the nontranslated first exon found in the other genes) with the introns located in similar intragenic positions, suggesting that this gene family evolved from a single ancestral gene (1Das H.K. McPherson J. Bruns G.A.P. Karathanasis S.K. Breslow J.L. J. Biol. Chem. 1985; 260: 6240-6247Abstract Full Text PDF PubMed Google Scholar, 3Paik Y.-K. Chang D.J. Reardon C.A. Davies G.E. Mahley R.W. Taylor J.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 3445-3449Crossref PubMed Scopus (223) Google Scholar). apolipoprotein basic Krüppel-like factor erythroid Krüppel-like factor hepatic control region ligation-mediated polymerase chain reaction micrococcal nuclease kilobase pair(s) base pair(s). Human apoE, a 299-amino acid glycoprotein of Mr = 35,000 (3Paik Y.-K. Chang D.J. Reardon C.A. Davies G.E. Mahley R.W. Taylor J.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 3445-3449Crossref PubMed Scopus (223) Google Scholar), is a major component of various plasma lipoprotein classes, including chylomicron remnants, very low density lipoproteins, and high density lipoproteins (6Mahley R.W. Innerarity T.L. Rall Jr., S.C. Weisgraber K.H. J. Lipid Res. 1984; 25: 1277-1294Abstract Full Text PDF PubMed Google Scholar, 7Mahley R.W. Science. 1988; 240: 622-630Crossref PubMed Scopus (3395) Google Scholar). It is required for the receptor-mediated uptake of chylomicron remnants and facilitates the redistribution of cholesterol from peripheral tissues to the liver (6Mahley R.W. Innerarity T.L. Rall Jr., S.C. Weisgraber K.H. J. Lipid Res. 1984; 25: 1277-1294Abstract Full Text PDF PubMed Google Scholar, 8Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4383) Google Scholar). Although apoE is produced by specific cell types in many different tissues, more than 90% of the circulating apoE in human plasma comes from the liver (6Mahley R.W. Innerarity T.L. Rall Jr., S.C. Weisgraber K.H. J. Lipid Res. 1984; 25: 1277-1294Abstract Full Text PDF PubMed Google Scholar, 9Linton M.F. Gish R. Hubl S.T. Bütler E. Esquivel C. Bry W.I. Boyles J.K. Wardell M.R. Young S.G. J. Clin. Invest. 1991; 88: 270-281Crossref PubMed Scopus (291) Google Scholar). Receptor binding-defective variants of apoE having the E2 phenotype are associated with type III hyperlipoproteinemia and premature atherosclerosis (6Mahley R.W. Innerarity T.L. Rall Jr., S.C. Weisgraber K.H. J. Lipid Res. 1984; 25: 1277-1294Abstract Full Text PDF PubMed Google Scholar). A commonly occurring apoE variant, the E4 allele, has been linked to the development of Alzheimer's disease (10Strittmatter W.J. Saunders A.M. Schmechel D. Pericak-Vance M. Enghild J. Salvesen G.S. Roses A.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1977-1981Crossref PubMed Scopus (3731) Google Scholar, 11Saunders A.M. Schmader K. Breitner J.C.S. Benson M.D. Brown W.T. Goldfarb L. Goldgaber D. Manwaring M.G. Szymanski M.H. McCown N. Dole K.C. Schmechel D.E. Strittmatter W.J. Pericak-Vance M.A. Roses A.D. Lancet. 1993; 342: 710-711Abstract PubMed Scopus (484) Google Scholar, 12Saunders A.M. Strittmatter W.J. Schmechel D. St George-Hyslop P.H. Pericak-Vance M.A. Joo S.H. Rosi B.L. Gusella J.F. Crapper-MacLachlan D.R. Alberts M.J. Hulette C. Crain B. Goldgaber D. Roses A.D. Neurology. 1993; 43: 1467-1472Crossref PubMed Google Scholar). Apolipoprotein C-II is an essential cofactor for lipoprotein lipase, giving it an important role in the hydrolysis of lipoprotein triglycerides (13Breckenridge W.C. Little J.A. Steiner G. Chow A. Poapst M. N. Engl. J. Med. 1978; 298: 1265-1273Crossref PubMed Scopus (414) Google Scholar). The function of apoC-I may be to modulate or to inhibit the apoE-mediated cellular uptake of remnants (14Sehayek E. Eisenberg S. J. Biol. Chem. 1991; 266: 18259-18267Abstract Full Text PDF PubMed Google Scholar, 15Weisgraber K.H. Mahley R.W. Kowal R.C. Herz J. Goldstein J.L. Brown M.S. J. Biol. Chem. 1990; 265: 22453-22459Abstract Full Text PDF PubMed Google Scholar). The function of apoC-IV is unknown. Simonet et al. (16Simonet W.S. Bucay N. Lauer S.J. Wirak D.O. Stevens M.E. Weisgraber K.H. Pitas R.E. Taylor J.M. J. Biol. Chem. 1990; 265: 10809-10812Abstract Full Text PDF PubMed Google Scholar, 17Simonet W.S. Bucay N. Pitas R.E. Lauer S.J. Taylor J.M. J. Biol. Chem. 1991; 266: 8651-8654Abstract Full Text PDF PubMed Google Scholar) demonstrated that expression of the apoE and apoC-I genes in the liver requires the presence of a distal downstream tissue-specific enhancer. Subsequent studies by Simonet et al. (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar) and Shachter et al. (19Shachter N.S. Zhu Y. Walsh A. Breslow J.L. Smith J.D. J. Lipid Res. 1993; 34: 1699-1707Abstract Full Text PDF PubMed Google Scholar) demonstrated that this hepatic control region (HCR) is located 19 kb downstream from the transcription start site from the apoE gene and 9 kb downstream from the transcription start site of the apoC-I gene. The HCR contains all sequences necessary to direct expression of both the apoE and apoC-I genes in hepatocytes (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar): constructs that lacked the HCR were not expressed in the livers of transgenic mice, even at low levels. The presence of a previously characterized enhancer element, which lacks tissue specificity, in the promoter of the apoE gene (20Chang D.J. Paik Y.-K. Leren T.P. Walker D.W. Howlett G.J. Taylor J.M. J. Biol. Chem. 1990; 265: 9496-9504Abstract Full Text PDF PubMed Google Scholar, 21Paik Y.-K. Chang D.J. Reardon C.A. Walker M.D. Taxman E. Taylor J.M. J. Biol. Chem. 1988; 263: 13340-13349Abstract Full Text PDF PubMed Google Scholar) was required for transcriptional activation. These results suggested that interaction of a unique hepatocyte-specific combination of distal elements in the HCR with a nonspecific activator sequence in the promoter directed the expression of the apoE/C-I/C-II locus in the liver. Recently, a second HCR sequence (denoted HCR-2), which shares 85% sequence identity with the initially identified HCR (henceforth referred to as HCR-1), was localized ∼5.5 kb downstream of the apoC-I′ pseudogene and ∼10 kb downstream of HCR-1 (22Allan C.M. Walker D. Taylor J.M. J. Biol. Chem. 1995; 270: 26278-26281Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). A construct in which the HCR-2 was ligated to the human apoE gene directed high levels in the liver of the transgenic mouse; however, the function of HCR-2 in the apoE gene locus remains to be determined (22Allan C.M. Walker D. Taylor J.M. J. Biol. Chem. 1995; 270: 26278-26281Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Further analysis of the regulatory sequences of the HCR-1 region demonstrated that full liver-specific activity is contained within a 319-nucleotide domain, as assayed in transgenic mice (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In addition, HCR-1 has a nuclear scaffold attachment capability that may contribute to an apparent position independence in directing liver-specific transgene expression. In vitro footprinting detected three liver-specific protein footprints in the purified HCR-1 DNA fragment (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In this assay, isolated DNA fragments were mixed with mouse liver nuclear extracts to identify protein-binding sites. Unexpectedly, a critical 5′ region required for the activity of the HCR in transgenic mice showed no protein-binding sites, suggesting that this approach may not reveal all of the functional elements in HCR-1. This limitation may be due to the loss or inactivation of nuclear factors during nuclear extract preparation and to the absence of native chromatin structure. In the current study, we employed in vivo footprinting in intact nuclei from human apoE transgenic mice to analyze nuclear protein binding to HCR-1. We used mice expressing the HEG.LE1 construct (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar) in which the complete apoE gene, together with 5 kb of 5′-flanking sequence and 1.7 kb of 3′-flanking sequence, is ligated to a 3.8-kb downstream fragment containing the HCR-1 domain. The results indicate a complex linear-specific nuclear protein-binding pattern that clarifies the regulatory elements of HCR-1. Intact nuclei were isolated from 3-6-month-old, hemizygous transgenic ICR mice bearing 70 copies of the HEG.LE1 construct (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar), illustrated in Fig. 1A. Nuclei were partially digested with DNase I or micrococcal nuclease (MNase). Then, the DNA was extracted and analyzed by ligation-mediated polymerase chain reaction (LMPCR) as described below. Nuclei were isolated, as described by Dang et al. (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), from either the livers or kidneys of transgenic mice bearing the HEG.LE1 transgene construct (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar). The nuclear pellet was resuspended in Buffer A without EDTA (15 mM Tris-HCl (pH 7.4), 0.15 mM spermine, 0.5 mM spermidine, 80 mM KCl, 1 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride) containing 5% glycerol and 5 mM MgCl2. The nuclei were diluted to 10 A260/ml with the same buffer, and 0.5-ml aliquots were incubated on ice for 10 min with or without different amounts of DNase I (2-40 units). The reactions were quenched by addition of 25 μl of 0.5 M EDTA, 25 μl of 5 M NaCl, 5 μl of 10% SDS, 12.5 μl of 1 M Tris-HCl (pH 8), and 10 μl of 10 mg/ml proteinase K, and then incubated at 50°C for 1 h. Aliquots were extracted with phenol. DNA was precipitated with ethanol, then resuspended in 0.1 × TE (1 mM Tris-HCl (pH 7.4), 0.1 M EDTA (pH 8)) buffer. The viscosity of the DNA was reduced by digestion with EcoRI. For controls, purified genomic DNA was digested in 40 mM Hepes (pH 7.5), 20 mM MgCl2, 5 mM CaCl2 using 0.5-2.5 × 10−5 units of DNase I/μg of DNA. The digestion was carried out for 5 min at 37°C and terminated by the addition of EDTA to 10 mM (24Ganter B. Tan S. Richmond T.J. J. Mol. Biol. 1993; 234: 975-987Crossref PubMed Scopus (29) Google Scholar). Nuclei were isolated as described above from different tissues of transgenic mice bearing the HEG.LE1 transgene construct (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar). The nuclear pellet was resuspended in Buffer A without EDTA (15 mM Tris-HCl (pH 7.4), 0.15 mM spermine, 0.5 mM spermidine, 80 mM KCl, 1 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride) containing 5% glycerol and 3 mM CaCl2. The nuclei were diluted to 10 A260/ml with the same buffer, and 0.5-ml aliquots were incubated at 37°C for 5 min with or without different amounts of MNase I (1-40 units). The reactions were quenched by addition of 25 μl of 0.5 M EDTA, 25 μl of 5 M NaCl, 5 μl of 10% SDS, 12.5 μl of 1 M Tris-HCl (pH 8), and 10 μl of 10 mg/ml proteinase K, and then incubated at 50°C for 1 h. Aliquots were extracted with phenol, and DNA was precipitated with ethanol, then resuspended in 0.1 × TE buffer. DNA was digested with EcoRI to reduce the viscosity prior to analysis. Purified DNA was digested in 20 mM Tris-HCl (pH 8), 150 mM NaCl, 5 mM KCl, 1 mM EDTA, 5 mM CaCl2 using 1.6 × 10−3 to 1.9 × 10−2 units of MNase/μg of DNA. The digestion was carried out for 5 min at 20°C, then terminated by the addition of EDTA to 10 mM (24Ganter B. Tan S. Richmond T.J. J. Mol. Biol. 1993; 234: 975-987Crossref PubMed Scopus (29) Google Scholar). Purified genomic DNA from transgenic mouse liver was incubated with 0.5% dimethyl sulfate at 20°C for 2 min, quenched by a stop buffer containing 1.5 M sodium acetate (pH 7) and 1 M 2-mercaptoethanol and precipitated with ethanol. The methylated DNA was hydrolyzed using the guanidine-specific reaction of Maxam and Gilbert (25Maxam A.M. Gilbert W. Methods Enzymol. 1980; 65: 499-560Crossref PubMed Scopus (9015) Google Scholar). Experimental details of LMPCR analysis have been described (26Arcinas M. Sizer K.C. Boxer L.M. J. Biol. Chem. 1994; 269: 21919-21924Abstract Full Text PDF PubMed Google Scholar, 27Garrity P.A. Wold B.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1021-1025Crossref PubMed Scopus (202) Google Scholar, 28Mueller P.R. Wold B. Science. 1989; 246: 780-786Crossref PubMed Scopus (799) Google Scholar, 29Pfeifer G.P. Steigerwald S.D. Mueller P.R. Wold B. Riggs A.D. Science. 1989; 246: 810-813Crossref PubMed Scopus (309) Google Scholar). In the present study, illustrated in Fig. 1 (B and C), sequence-specific oligonucleotide primers were used first to generate double-stranded copies of the region of interest (using 1.5-5 μg of genomic DNA from DNase I-digested nuclei or MNase-digested nuclei) in the HCR or to the sequences adjacent to the start site of transgene transcription. The primer locations on the HCR or near the first exon are shown in Fig. 1C. A common linker was ligated to the blunt end of the double-stranded fragments. To increase specificity, a second primer that is internal to the first primer and a primer hybridized to the linker primer were used for subsequent PCR amplification. For maximum resolution, DNA amplification was carried out by either of two reaction systems: (a) Sequenase (U. S. Biochemical Corp.) for first strand synthesis and Taq DNA polymerase (Perkin-Elmer) for PCR (26Arcinas M. Sizer K.C. Boxer L.M. J. Biol. Chem. 1994; 269: 21919-21924Abstract Full Text PDF PubMed Google Scholar), or (b) Vent DNA polymerase (New England Biolabs) for both reactions (27Garrity P.A. Wold B.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1021-1025Crossref PubMed Scopus (202) Google Scholar). Amplified fragments were detected by a radioactively labeled third sequence-specific primer that is internal to the second primer. DNA was extracted with phenol/chloroform, and the footprint pattern was revealed by gel electrophoresis on a 6% denaturing sequencing gel (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) followed by autoradiography. Oligonucleotides for in vivo footprinting analysis were synthesized via a nucleic acid synthesis system (Millipore, Bedford, MA), or ordered from Oligo Etc. (Wilsonville, OR). Primers for the common linker were as follows: 1, GCGGTGACCCGGGAGATCTGAATTC; and 2, GAATTCAGATC. Specific primers complementary to HCR-1 or the human apoE gene with their last nucleotide positions indicated (Fig. 1C) were those listed below. The assays were carried out essentially as described (20Chang D.J. Paik Y.-K. Leren T.P. Walker D.W. Howlett G.J. Taylor J.M. J. Biol. Chem. 1990; 265: 9496-9504Abstract Full Text PDF PubMed Google Scholar) with minor modifications. In brief, 1.2 μg of mouse liver or kidney nuclear extract was incubated with 2 μg of poly(dI·dC) at 20°C for 5 min in 20 μl of nuclear dialysis buffer. Where appropriate, specific oligonucleotide competitors were added to each sample and incubated at 20°C for 10 min. Then, 2.5 ng of end-labeled oligonucleotide was added to the mixture and incubated at 20°C for 15 min. Samples were resolved by electrophoresis in 5% polyacrylamide gels in 0.5 × TBE (45 mM Tris borate, 1 mM EDTA) buffer, and then the gel was dried and examined by autoradiography. For antibody supershift assays, 2 μl of an antibody to a specific transcription factor was added to the reaction mixture either before or after the addition of poly(dI·dC) and oligonucleotide probes. Then, the reaction was incubated for an additional 20 min. Nuclear extracts from mouse liver and kidney were isolated by the method of Gorski et al. (31Gorski K. Carneiro M. Schibler U. Cell. 1986; 47: 767-776Abstract Full Text PDF PubMed Scopus (973) Google Scholar) with minor modifications as described (20Chang D.J. Paik Y.-K. Leren T.P. Walker D.W. Howlett G.J. Taylor J.M. J. Biol. Chem. 1990; 265: 9496-9504Abstract Full Text PDF PubMed Google Scholar). Complementary oligonucleotide pairs for gel retardation experiments were obtained from the same sources and annealed in a buffer containing 250 mM Tris-HCl (pH 7.6). The annealed products were purified by polyacrylamide gel electrophoresis, then labeled by T4 DNA kinase in the presence of [γ-32P]ATP (Du Pont). Oligonucleotide sequences were as follows: 1b, CTGCAGGCTCAGAGGCACACAGGAGTTTCTGGGCTCACCCTGCCCCCTTCCAA; 2, CCCCTCAGTTCCCATCCTCCAGCAGCTGTTTGTGTGCTGCCTCT; 3, AGTCCACACTGAACAAACTTCAGCCTAC; 7, GAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTG; 10, AATAAACATTTGGTTTTTTTGTT; 11, GTTTTGTTTTGTTTTTTGAGA; EKLF, AGAGCCACACCCTGAAG (32Feng W.C. Southwood C.M. Bieker J.J. J. Biol. Chem. 1994; 269: 1493-1500Abstract Full Text PDF PubMed Google Scholar); Tf-Lf2, AGTCTGTCTTTGACCTTGAGCCC (33Ochoa A. Brunel F. Mendelzon D. Cohen G.N. Zakin M.M. Nucleic Acids Res. 1989; 17: 119-133Crossref PubMed Scopus (34) Google Scholar); HNF4, TCGACTCTCTGCAAGGGTCATCAGTAC (34Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (861) Google Scholar); C/EBP, GACCTTTTGCAATCCTGG (35Metzger S. Leff T. Breslow J.L. J. Biol. Chem. 1990; 265: 9978-9983Abstract Full Text PDF PubMed Google Scholar). In vivo footprinting of HCR-1 reveals a dense concentration of protein-binding sites in the minimal domain required for full liver-specific expression, shown in Fig. 2, Fig. 3. In this assay, DNase I penetrates the membranes of intact nuclei and cleaves accessible DNA mainly in those chromatin regions that are decondensed and transcriptionally active. Bound nuclear factors protect the underlying nucleotides from being digested; these sites are identified by subsequent LMPCR, and the exact location of protected sites is determined by analyzing the sequence of guanine nucleotides in amplified control DNA (Fig. 2, lane G). In HCR-1, a low level of DNase I revealed a distinct digestion pattern of protein footprints (Fig. 2, A-D), and most of these footprint sites were still partially protected under a higher level of DNase I digestion (i.e. Fig. 2, A and B, compare lane 4 with lane 5). These footprints were observed when either the 5′ strand (Fig. 2, A and B) or the 3′ strand (Fig. 2, C and D) were examined. The lack of footprints found on HCR-1 in kidney nuclear chromatin indicated that nuclear protein binding was liver-specific.Fig. 3Nucleotide sequence of HCR-1 domain. Panel A, nucleotide sequence of HCR-1 required for full liver expression activity (5-325) and adjacent region (upstream to −60). Panel B, nucleotide sequence of the footprint region of the nearby Alu sequence in the HCR domain. In vivo footprint sequences are boxed, and the arrows indicate TGTTTGC-like motifs.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Similarly, a cluster of five footprints was detected in the Alu family sequence adjacent to HCR-1 (Fig. 2, E and F), although these footprints tended to be less distinct than those located within the liver-specific HCR-1 domain. Since functional tests in transgenic mice demonstrated that the Alu sequence region was not required for full HCR-1 activity (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), the potential role (if any) of this repeated sequence in HCR-1 function remains unclear. Previous in vitro analysis had revealed a limited number of protein-binding sites in the HCR domain when nuclear extracts were incubated with isolated DNA (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In this approach, some footprints could have been missed or artifactual footprints might have been observed for various reasons. For example, the appropriate structure for specific protein binding may not be presented by purified, short, linear DNA fragments in vitro. In addition, some transcription factors may have been inactivated or lost during the preparation of nuclear extracts. Nevertheless, all six of the protein-binding sites detected previously by the in vitro assay in a 774-bp HCR-containing fragment were observed by in vivo footprinting, as summarized in Fig. 3. Three of these footprints (Footprints 4-6; Fig. 2, Fig. 3) were in the minimum domain required for high level liver-expressing activity (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), two of which (Footprints 5 and 6) also had been found by an independent laboratory (19Shachter N.S. Zhu Y. Walsh A. Breslow J.L. Smith J.D. J. Lipid Res. 1993; 34: 1699-1707Abstract Full Text PDF PubMed Google Scholar). In addition, three footprints (Footprints 8, 9, and 12; Fig. 2, Fig. 3) downstream from the minimum HCR domain were detected by both in vitro and in vivo methods. Most of the protein-binding sites identified in intact nuclei are slightly larger than when detected using purified DNA and nuclear extracts (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Most notably, Footprint 4 is 20 bp longer in the in vivo experiments. This extended protein-binding sequence includes two tandemly repeated TGTTTGC motifs in addition to the two tandem copies of this motif located within the in vitro footprint region. Only Footprint 5 had essentially the same length when determined by both in vitro and in vivo methods. Previous studies showed that nucleotides 6-72 were involved in liver expression activity, with nucleotides 72-122 being absolutely required for any HCR activity (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). However, no footprints were detected in this region by in vitro analysis with liver nuclear extracts (19Shachter N.S. Zhu Y. Walsh A. Breslow J.L. Smith J.D. J. Lipid Res. 1993; 34: 1699-1707Abstract Full Text PDF PubMed Google Scholar, 23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In contrast, the in vivo method revealed three protein-binding sites (Footprints 1b, 2, and 3; Fig. 2, panels A-D) in this essential regulatory sequence. Footprints 2 and 3, covering nucleotides 61-128 in the required liver expression domain, each contained a sequence that was closely related to the TGTTTGC motif of Footprint 4, differing by only 1 nucleotide at both sites (Fig. 3). The 5′ end of Footprint 1b was marked by a relatively weak sensitivity to DNase I, and it was located at the 5′ boundary of HCR-1. Another footprint (denoted 1a) was found immediately upstream of this boundary and was nearly contiguous with Footprint 1b. Since it had been shown previously that the region of the apolipoprotein E gene locus containing Footprint 1a was not required or involved in liver-specific expression (18Simonet W.S. Bucay N. Lauer S.J. Taylor J.M. J. Biol. Chem. 1993; 268: 8221-8229Abstract Full Text PDF PubMed Google Scholar, 23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), the protein-binding character of this sequence was not investigated further. An additional new footprint was found near the 3′ portion of the required liver expression domain of HCR-1 (Footprint 7, Fig. 2, panels B and E). No clear footprints were reproducibly detected in the adjacent 75-nucleotide segment downstream of Footprint 7, suggesting that Footprint 7 may constitute the 3′ boundary of the liver expression domain of HCR-1, consistent with functional tests of HCR activity in transgenic mice in which only the region between nucleotides 6 and 325 was required for full liver-specific activity (23Dang Q. Walker D. Taylor S. Allan C. Chin P. Fan J. Taylor J. J. Biol. Chem. 1995; 270: 22577-22585Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). The in vivo method also detected two new protein-binding sites, Footprints 10 and 11, in the Alu family member that is adjacent to HCR-1. These in vivo footprints overlapped in the A-rich 3′ tail of this repeated sequence element. The finding of liver-specific nuclear protein-binding sites in the 3′ end of a highly repeated sequence near HCR-1 suggested that this region of the transgenic mouse genome was in a more open chromatin environment in the liver than in the kidney. Nuclear protein binding to the newly detected in vivo footprint sequences was examined by gel retardation assays us" @default.
• W2003219076 created "2016-06-24" @default.
• W2003219076 creator A5070186599 @default.
• W2003219076 creator A5088766033 @default.
• W2003219076 date "1996-11-01" @default.
• W2003219076 modified "2023-09-28" @default.
• W2003219076 title "In Vivo Footprinting Analysis of the Hepatic Control Region of the Human Apolipoprotein E/C-I/C-IV/C-II Gene Locus" @default.
• W2003219076 cites W1479280408 @default.
• W2003219076 cites W1483346790 @default.
• W2003219076 cites W1493312303 @default.
• W2003219076 cites W1499891289 @default.
• W2003219076 cites W1502098572 @default.
• W2003219076 cites W1504034854 @default.
• W2003219076 cites W1509027462 @default.
• W2003219076 cites W1530975353 @default.
• W2003219076 cites W1552597422 @default.
• W2003219076 cites W1554323039 @default.
• W2003219076 cites W1556915726 @default.
• W2003219076 cites W1558516755 @default.
• W2003219076 cites W1567308646 @default.
• W2003219076 cites W1590095886 @default.
• W2003219076 cites W1591191431 @default.
• W2003219076 cites W1625604824 @default.
• W2003219076 cites W1652729057 @default.
• W2003219076 cites W1714683344 @default.
• W2003219076 cites W1799635531 @default.
• W2003219076 cites W1890954725 @default.
• W2003219076 cites W1920171370 @default.
• W2003219076 cites W1945443309 @default.
• W2003219076 cites W1965258786 @default.
• W2003219076 cites W1973924691 @default.
• W2003219076 cites W1978713358 @default.
• W2003219076 cites W1983430442 @default.
• W2003219076 cites W1985064850 @default.
• W2003219076 cites W1987225334 @default.
• W2003219076 cites W1999631936 @default.
• W2003219076 cites W2001772277 @default.
• W2003219076 cites W2005144583 @default.
• W2003219076 cites W2007327608 @default.
• W2003219076 cites W2008857546 @default.
• W2003219076 cites W2015232786 @default.
• W2003219076 cites W2018302259 @default.
• W2003219076 cites W2021181758 @default.
• W2003219076 cites W2025847301 @default.
• W2003219076 cites W2028189691 @default.
• W2003219076 cites W2028263033 @default.
• W2003219076 cites W2034968148 @default.
• W2003219076 cites W2039307052 @default.
• W2003219076 cites W2068044409 @default.
• W2003219076 cites W2072422194 @default.
• W2003219076 cites W2077219082 @default.
• W2003219076 cites W2080831516 @default.
• W2003219076 cites W2081495213 @default.
• W2003219076 cites W2084744450 @default.
• W2003219076 cites W2086548325 @default.
• W2003219076 cites W2089019735 @default.
• W2003219076 cites W2097608504 @default.
• W2003219076 cites W2100427612 @default.
• W2003219076 cites W2101141723 @default.
• W2003219076 cites W2107749430 @default.
• W2003219076 cites W2107828904 @default.
• W2003219076 cites W2110749080 @default.
• W2003219076 cites W2115309238 @default.
• W2003219076 cites W2118299921 @default.
• W2003219076 cites W2122616238 @default.
• W2003219076 cites W2122953595 @default.
• W2003219076 cites W2129872577 @default.
• W2003219076 cites W2141511238 @default.
• W2003219076 cites W2143784503 @default.
• W2003219076 cites W2144515939 @default.
• W2003219076 cites W2154715299 @default.
• W2003219076 cites W2156510371 @default.
• W2003219076 cites W2165218504 @default.
• W2003219076 cites W2169578753 @default.
• W2003219076 cites W2327887667 @default.
• W2003219076 cites W4230162640 @default.
• W2003219076 cites W4252346318 @default.
• W2003219076 cites W4255110190 @default.
• W2003219076 doi "https://doi.org/10.1074/jbc.271.45.28667" @default.
• W2003219076 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8910501" @default.
• W2003219076 hasPublicationYear "1996" @default.
• W2003219076 type Work @default.
• W2003219076 sameAs 2003219076 @default.
• W2003219076 citedByCount "17" @default.
• W2003219076 countsByYear W20032190762013 @default.
• W2003219076 crossrefType "journal-article" @default.
• W2003219076 hasAuthorship W2003219076A5070186599 @default.
• W2003219076 hasAuthorship W2003219076A5088766033 @default.
• W2003219076 hasBestOaLocation W20032190761 @default.
• W2003219076 hasConcept C104317684 @default.
• W2003219076 hasConcept C153911025 @default.
• W2003219076 hasConcept C185592680 @default.
• W2003219076 hasConcept C207001950 @default.
• W2003219076 hasConcept C2778021871 @default.
• W2003219076 hasConcept C2778163477 @default.
• W2003219076 hasConcept C54355233 @default.
• W2003219076 hasConcept C55493867 @default.
• W2003219076 hasConcept C62746215 @default.

• next