FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003295134> ?p ?o ?g. }

• W2003295134 endingPage "18751" @default.
• W2003295134 startingPage "18736" @default.
• W2003295134 abstract "DNA methylation and histone acetylation inhibitors are widely used to study the role of epigenetic marks in the regulation of gene expression. In addition, several of these molecules are being tested in clinical trials or already in use in the clinic. Antimetabolites, such as the DNA-hypomethylating agent 5-azacytidine (5-AzaC), have been shown to lower malignant progression to acute myeloid leukemia and to prolong survival in patients with myelodysplastic syndromes. Here we examined the effects of DNA methylation inhibitors on the expression of lipid biosynthetic and uptake genes. Our data demonstrate that, independently of DNA methylation, 5-AzaC selectively and very potently reduces expression of key genes involved in cholesterol and lipid metabolism (e.g. PCSK9, HMGCR, and FASN) in all tested cell lines and in vivo in mouse liver. Treatment with 5-AzaC disturbed subcellular cholesterol homeostasis, thereby impeding activation of sterol regulatory element-binding proteins (key regulators of lipid metabolism). Through inhibition of UMP synthase, 5-AzaC also strongly induced expression of 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9) and promoted triacylglycerol synthesis and cytosolic lipid droplet formation. Remarkably, complete reversal was obtained by the co-addition of either UMP or cytidine. Therefore, this study provides the first evidence that inhibition of the de novo pyrimidine synthesis by 5-AzaC disturbs cholesterol and lipid homeostasis, probably through the glycerolipid biosynthesis pathway, which may contribute mechanistically to its beneficial cytostatic properties. DNA methylation and histone acetylation inhibitors are widely used to study the role of epigenetic marks in the regulation of gene expression. In addition, several of these molecules are being tested in clinical trials or already in use in the clinic. Antimetabolites, such as the DNA-hypomethylating agent 5-azacytidine (5-AzaC), have been shown to lower malignant progression to acute myeloid leukemia and to prolong survival in patients with myelodysplastic syndromes. Here we examined the effects of DNA methylation inhibitors on the expression of lipid biosynthetic and uptake genes. Our data demonstrate that, independently of DNA methylation, 5-AzaC selectively and very potently reduces expression of key genes involved in cholesterol and lipid metabolism (e.g. PCSK9, HMGCR, and FASN) in all tested cell lines and in vivo in mouse liver. Treatment with 5-AzaC disturbed subcellular cholesterol homeostasis, thereby impeding activation of sterol regulatory element-binding proteins (key regulators of lipid metabolism). Through inhibition of UMP synthase, 5-AzaC also strongly induced expression of 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9) and promoted triacylglycerol synthesis and cytosolic lipid droplet formation. Remarkably, complete reversal was obtained by the co-addition of either UMP or cytidine. Therefore, this study provides the first evidence that inhibition of the de novo pyrimidine synthesis by 5-AzaC disturbs cholesterol and lipid homeostasis, probably through the glycerolipid biosynthesis pathway, which may contribute mechanistically to its beneficial cytostatic properties. Epigenetic marks, such as DNA methylation and histone acetylation, finely alter chromatin structure to precisely control gene expression in a time-, cell-, and tissue-specific manner (1Jaenisch R. Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals.Nat. Genet. 2003; 33: 245-254Crossref PubMed Scopus (4675) Google Scholar). DNA cytosine methylation, catalyzed by DNA methyltransferases forming 5-methylcytosine at specific CpG dinucleotides, is responsible for the establishment of silent chromatin regions (2Gnyszka A. Jastrzebski Z. Flis S. DNA methyltransferase inhibitors and their emerging role in epigenetic therapy of cancer.Anticancer Res. 2013; 33: 2989-2996PubMed Google Scholar). Inhibitors of DNA methyltransferases, such as the unmethylable cytosine analogs 5-azacytidine (5-AzaC) 4The abbreviations used are:5-AzaC5-azacytidineDAC5-aza-2′-deoxycytidineMDSmyelodysplastic syndromesSREBPsterol regulatory element-binding proteinERendoplasmic reticulumCHXcycloheximideLPDSlipoprotein-deficient serumTBPTATA box-binding proteinSREsterol response elementPAphosphatidic acidCDSPA-CTP cytidylyltransferaseTGtriacylglycerolLDlipid dropletSCAPSREBP cleavage-activating proteinS1P and S2Psite 1 and site 2 protease, respectivelyQPCRquantitative PCR. and 5-Aza-2′-deoxycytidine (DAC), generate hypomethylated DNA, allowing re-expression of silenced hypermethylated genes (2Gnyszka A. Jastrzebski Z. Flis S. DNA methyltransferase inhibitors and their emerging role in epigenetic therapy of cancer.Anticancer Res. 2013; 33: 2989-2996PubMed Google Scholar). Accordingly, based on the premise that they induce re-expression of tumor suppressor genes and because they lower malignant progression to acute myeloid leukemia and increase survival, both 5-AzaC and DAC are used as standards of care for patients with myelodysplastic syndromes (MDS) (3Estey E.H. Epigenetics in clinical practice: the examples of azacitidine and decitabine in myelodysplasia and acute myeloid leukemia.Leukemia. 2013; 27: 1803-1812Crossref PubMed Scopus (106) Google Scholar). 5-azacytidine 5-aza-2′-deoxycytidine myelodysplastic syndromes sterol regulatory element-binding protein endoplasmic reticulum cycloheximide lipoprotein-deficient serum TATA box-binding protein sterol response element phosphatidic acid PA-CTP cytidylyltransferase triacylglycerol lipid droplet SREBP cleavage-activating protein site 1 and site 2 protease, respectively quantitative PCR. Comparative studies have revealed major mechanistic disparities between DAC and 5-AzaC. Although DAC is the most effective hypomethylating agent, 5-AzaC is more potent to reduce cell viability and proliferation in acute myeloid leukemia cell lines (4Hollenbach P.W. Nguyen A.N. Brady H. Williams M. Ning Y. Richard N. Krushel L. Aukerman S.L. Heise C. MacBeth K.J. A comparison of azacitidine and decitabine activities in acute myeloid leukemia cell lines.PLoS One. 2010; 5: e9001Crossref PubMed Scopus (302) Google Scholar, 5Flotho C. Claus R. Batz C. Schneider M. Sandrock I. Ihde S. Plass C. Niemeyer C.M. Lübbert M. The DNA methyltransferase inhibitors azacitidine, decitabine and zebularine exert differential effects on cancer gene expression in acute myeloid leukemia cells.Leukemia. 2009; 23: 1019-1028Crossref PubMed Scopus (258) Google Scholar). Global DNA microarray analyses demonstrated that the effect of each drug on the cellular transcriptome was very distinct, with largely non-overlapping gene expression profiles. In order to be incorporated into DNA, 5-AzaC has to be converted to DAC by ribonucleotide reductase, which is an inefficient process (∼10–20%) (2Gnyszka A. Jastrzebski Z. Flis S. DNA methyltransferase inhibitors and their emerging role in epigenetic therapy of cancer.Anticancer Res. 2013; 33: 2989-2996PubMed Google Scholar). Consequently, 5-AzaC can also be incorporated into different RNA subspecies and may affect nucleic acid and protein metabolism (6Cihák A. Biological effects of 5-azacytidine in eukaryotes.Oncology. 1974; 30: 405-422Crossref PubMed Scopus (173) Google Scholar). Thus, 5-AzaC antineoplastic effects on abnormal hematopoietic cells may rely on methylation-independent mechanisms, which remain to be determined (4Hollenbach P.W. Nguyen A.N. Brady H. Williams M. Ning Y. Richard N. Krushel L. Aukerman S.L. Heise C. MacBeth K.J. A comparison of azacitidine and decitabine activities in acute myeloid leukemia cell lines.PLoS One. 2010; 5: e9001Crossref PubMed Scopus (302) Google Scholar, 6Cihák A. Biological effects of 5-azacytidine in eukaryotes.Oncology. 1974; 30: 405-422Crossref PubMed Scopus (173) Google Scholar, 7Vigna E. Recchia A.G. Madeo A. Gentile M. Bossio S. Mazzone C. Lucia E. Morabito L. Gigliotti V. Stefano L.D. Caruso N. Servillo P. Franzese S. Fimognari F. Bisconte M.G. Gentile C. Morabito F. Epigenetic regulation in myelodysplastic syndromes: implications for therapy.Expert Opin. Investig. Drugs. 2011; 20: 465-493Crossref PubMed Scopus (17) Google Scholar, 8Aimiuwu J. Wang H. Chen P. Xie Z. Wang J. Liu S. Klisovic R. Mims A. Blum W. Marcucci G. Chan K.K. RNA-dependent inhibition of ribonucleotide reductase is a major pathway for 5-azacytidine activity in acute myeloid leukemia.Blood. 2012; 119: 5229-5238Crossref PubMed Scopus (101) Google Scholar). Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that coordinates homeostatic gene expression of proteins and enzymes required for uptake and biosynthesis of cholesterol, fatty acids, triacylglycerols, and phospholipids (9Brown M.S. Goldstein J.L. Cholesterol feedback: from Schoenheimer's bottle to Scap's MELADL.J. Lipid Res. 2009; 50: S15-S27Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar). The proteolytic release of the N-terminal transcriptionally active fragment of SREBPs from their membrane-bound precursor is finely regulated by cholesterol through a negative feedback loop mediated by sterol-sensing endoplasmic reticulum (ER)-resident proteins. Impairment of this mechanism can result in imbalance of cellular cholesterol and lipid content and is associated with severe clinical complications, such as non-alcoholic fatty liver disease, atherosclerosis, and cancer (10Moon Y.A. Liang G. Xie X. Frank-Kamenetsky M. Fitzgerald K. Koteliansky V. Brown M.S. Goldstein J.L. Horton J.D. The Scap/SREBP pathway is essential for developing diabetic fatty liver and carbohydrate-induced hypertriglyceridemia in animals.Cell Metab. 2012; 15: 240-246Abstract Full Text Full Text PDF PubMed Scopus (233) Google Scholar, 11Tang J.J. Li J.G. Qi W. Qiu W.W. Li P.S. Li B.L. Song B.L. Inhibition of SREBP by a small molecule, betulin, improves hyperlipidemia and insulin resistance and reduces atherosclerotic plaques.Cell Metab. 2011; 13: 44-56Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar, 12Currie E. Schulze A. Zechner R. Walther T.C. Farese Jr., R.V. Cellular fatty acid metabolism and cancer.Cell Metab. 2013; 18: 153-161Abstract Full Text Full Text PDF PubMed Scopus (1213) Google Scholar). Complementary to genome-wide association studies that have identified loci associated with lipid production (13Global Lipids Genetics Consortium Willer C.J. Schmidt E.M. Sengupta S. Peloso G.M. Gustafsson S. Kanoni S. Ganna A. Chen J. Buchkovich M.L. Mora S. Beckmann J.S. Bragg-Gresham J.L. Chang H.Y. Demirkan A. Den Hertog H.M. Do R. Donnelly L.A. Ehret G.B. Esko T. Feitosa M.F. Ferreira T. Fischer K. Fontanillas P. Fraser R.M. Freitag D.F. Gurdasani D. Heikkilä K. Hyppönen E. Isaacs A. Jackson A.U. Johansson A. Johnson T. Kaakinen M. Kettunen J. Kleber M.E. Li X. Luan J. Lyytikäinen L.P. Magnusson P.K. Mangino M. Mihailov E. Montasser M.E. Müller-Nurasyid M. Nolte I.M. O'Connell J.R. Palmer C.D. Perola M. Petersen A.K. Sanna S. Saxena R. Service S.K. Shah S. Shungin D. Sidore C. Song C. Strawbridge R.J. Surakka I. Tanaka T. Teslovich T.M. Thorleifsson G. Van den Herik E.G. Voight B.F. Volcik K.A. Waite L.L. Wong A. Wu Y. Zhang W. Absher D. Asiki G. Barroso I. Been L.F. Bolton J.L. Bonnycastle L.L. Brambilla P. Burnett M.S. Cesana G. Dimitriou M. Doney A.S. Doring A. Elliott P. Epstein S.E. Eyjolfsson G.I. Gigante B. Goodarzi M.O. Grallert H. Gravito M.L. Groves C.J. Hallmans G. Hartikainen A.L. Hayward C. Hernandez D. Hicks A.A. Holm H. Hung Y.J. Illig T. Jones M.R. Kaleebu P. Kastelein J.J. Khaw K.T. Kim E. Klopp N. Komulainen P. Kumari M. Langenberg C. Lehtimaki T. Lin S.Y. Lindstrom J. Loos R.J. Mach F. McArdle W.L. Meisinger C. Mitchell B.D. Muller G. Nagaraja R. Narisu N. Nieminen T.V. Nsubuga R.N. Olafsson I. Ong K.K. Palotie A. Papamarkou T. Pomilla C. Pouta A. Rader D.J. Reilly M.P. Ridker P.M. Rivadeneira F. Rudan I. Ruokonen A. Samani N. Scharnagl H. Seeley J. Silander K. Stancakova A. Stirrups K. Swift A.J. Tiret L. Uitterlinden A.G. van Pelt L.J. Vedantam S. Wainwright N. Wijmenga C. Wild S.H. Willemsen G. Wilsgaard T. Wilson J.F. Young E.H. Zhao J.H. Adair L.S. Arveiler D. Assimes T.L. Bandinelli S. Bennett F. Bochud M. Boehm B.O. Boomsma D.I. Borecki I.B. Bornstein S.R. Bovet P. Burnier M. Campbell H. Chakravarti A. Chambers J.C. Chen Y.D. Collins F.S. Cooper R.S. Danesh J. Dedoussis G. de Faire U. Feranil A.B. Ferrieres J. Ferrucci L. Freimer N.B. Gieger C. Groop L.C. Gudnason V. Gyllensten U. Hamsten A. Harris T.B. Hingorani A. Hirschhorn J.N. Hofman A. Hovingh G.K. Hsiung C.A. Humphries S.E. Hunt S.C. Hveem K. Iribarren C. Jarvelin M.R. Jula A. Kahonen M. Kaprio J. Kesaniemi A. Kivimaki M. Kooner J.S. Koudstaal P.J. Krauss R.M. Kuh D. Kuusisto J. Kyvik K.O. Laakso M. Lakka T.A. Lind L. Lindgren C.M. Martin N.G. Marz W. McCarthy M.I. McKenzie C.A. Meneton P. Metspalu A. Moilanen L. Morris A.D. Munroe P.B. Njolstad I. Pedersen N.L. Power C. Pramstaller P.P. Price J.F. Psaty B.M. Quertermous T. Rauramaa R. Saleheen D. Salomaa V. Sanghera D.K. Saramies J. Schwarz P.E. Sheu W.H. Shuldiner A.R. Siegbahn A. Spector T.D. Stefansson K. Strachan D.P. Tayo B.O. Tremoli E. Tuomilehto J. Uusitupa M. van Duijn C.M. Vollenweider P. Wallentin L. Wareham N.J. Whitfield J.B. Wolffenbuttel B.H. Ordovas J.M. Boerwinkle E. Palmer C.N. Thorsteinsdottir U. Chasman D.I. Rotter J.I. Franks P.W. Ripatti S. Cupples L.A. Sandhu M.S. Rich S.S. Boehnke M. Deloukas P. Kathiresan S. Mohlke K.L. Ingelsson E. Abecasis G.R. Discovery and refinement of loci associated with lipid levels.Nat. Genet. 2013; 45: 1274-1283Crossref PubMed Scopus (1888) Google Scholar), epigenetics represents one of the most promising fields to study the impact of induced environmental reprogramming of gene expression in metabolic diseases (14Rakyan V.K. Down T.A. Balding D.J. Beck S. Epigenome-wide association studies for common human diseases.Nat. Rev. Genet. 2011; 12: 529-541Crossref PubMed Scopus (900) Google Scholar). Indeed, mounting evidence indicates that gene promoter DNA methylation levels may be associated with lipid metabolism gene expression (15Ehara T. Kamei Y. Takahashi M. Yuan X. Kanai S. Tamura E. Tanaka M. Yamazaki T. Miura S. Ezaki O. Suganami T. Okano M. Ogawa Y. Role of DNA methylation in the regulation of lipogenic glycerol-3-phosphate acyltransferase 1 gene expression in the mouse neonatal liver.Diabetes. 2012; 61: 2442-2450Crossref PubMed Scopus (39) Google Scholar). In the present study, we explored the effects of DNA methylation inhibitors 5-AzaC and DAC on cholesterogenic and lipid gene expression and defined a previously unrecognized mechanism regulating the activation of SREBPs. Treatment of various cell lines or injection of mice with 5-AzaC strongly and selectively reduced expression of SREBP target genes independently of DNA methylation. Our data show that 5-AzaC, unlike DAC, promotes triglyceride synthesis and accumulation of lipid droplets and impedes SREBPs activation. In sterol-resistant Chinese hamster ovary cells, the activation of SREBP-2 was insensitive to 5-AzaC, indicating that this antimetabolite alters the ER cholesterol content. Co-incubation with UMP or cytidine completely reversed the effects of 5-AzaC, demonstrating that inhibition of UMP synthase and CTP depletion is the underlying mechanism. Taken together, these data highlight a major DNA methylation-independent effect of 5-AzaC and the existing link between the de novo pyrimidine and glycerolipid biosynthesis pathways and SREBP signaling. Cytidine (catalog no. C4654), 5-AzaC (catalog no. A2385), DAC (catalog no. A3656), uridine 5′-monophosphate (catalog no. U6375), actinomycin D (catalog no. A9415), mevastatin (catalog no. M2537), mevalonolactone (catalog no. M4667), cholesterol (catalog no. C3045), 25-hydroxycholesterol (catalog no. H1015), cycloheximide (CHX; catalog no. C7698), propranolol (catalog no. P0884), and filipin III (catalog no. F4767) were purchased from Sigma-Aldrich. Pyrazofurin (catalog no. PYA 11004) was purchased from Berry and Associates. Human lipoprotein-deficient serum (LPDS) was obtained from Millipore (catalog no. LP4), and the HCS LipidTOX Phospholipidosis/Steatosis Detection Kit (catalog no. H34157) and BODIPY 493/503 (catalog no. D3922) were from Molecular Probes. The authentic LC/MS metabolite standards were purchased from Sigma-Aldrich, and LC/MS grade ammonium acetate, LC/MS grade water, and LC/MS grade acetonitrile were purchased from Fisher. Human V5-tagged PCSK9 and LDLR subcloned into pIRES2-EGFP vector were a kind gift from Dr. Nabil Seidah (Clinical Research Institute of Montreal). PC5 and furin (pDONR221-hPC5 and pENTR223-Furin, DF/HCC DNA Resource Core, Harvard Medical School) were PCR-amplified and fused in frame with the V5 epitope tag subcloned into pIRES2-EGFP (16Mayer G. Hamelin J. Asselin M.C. Pasquato A. Marcinkiewicz E. Tang M. Tabibzadeh S. Seidah N.G. The regulated cell surface zymogen activation of the proprotein convertase PC5A directs the processing of its secretory substrates.J. Biol. Chem. 2008; 283: 2373-2384Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Full-length human SREBP-2 was purchased from Open Biosystems (pCMV-SPORT6-hSREBP2; accession number BC056158, catalog no. MHS1010-9205715). The cDNA fragment encoding the transcriptionally active nuclear form of SREBP-2 (amino acids 1–468 with stop codon) (17Horton J.D. Shimomura I. Brown M.S. Hammer R.E. Goldstein J.L. Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2.J. Clin. Invest. 1998; 101: 2331-2339Crossref PubMed Google Scholar) was PCR-amplified using Phusion High-Fidelity DNA polymerase (catalog no. F-530, Finnzymes) and subcloned into pIRES2-EGFP vector. All selected clones were verified by DNA sequencing. Human hepatoma cell lines HepG2 and Huh-7 were routinely cultivated in Dulbecco's modified Eagle's medium (DMEM; catalog no. 319-005-CL, Wisent) supplemented with 10% fetal bovine serum (FBS; catalog no. 080-350, Wisent). For sterol-regulated conditions, HepG2 cells were incubated in 5% LPDS, 50 μm mevastatin, and 50 μm mevalonolactone in the absence (−sterols) or presence of 1 μg/ml 25-hydroxycholesterol and 10 μg/ml cholesterol (+sterols) for 24 h. Fresh medium was added (−/+ sterols) without (−) or with (+) 10 μm 5-AzaC for another 24 h. Human embryonic kidney 293 (HEK293) cells were cultivated in complete DMEM without sodium pyruvate (catalog no. 319-015-CL, Wisent). Chinese hamster ovary (CHO)-K1 cells and CHO-K1-derived cell lines 25-RA (SCAP+) (18Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein.Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar), M19 (S2P-deficient) (19Rawson R.B. Zelenski N.G. Nijhawan D. Ye J. Sakai J. Hasan M.T. Chang T.Y. Brown M.S. Goldstein J.L. Complementation cloning of S2P, a gene encoding a putative metalloprotease required for intramembrane cleavage of SREBPs.Mol. Cell. 1997; 1: 47-57Abstract Full Text Full Text PDF PubMed Scopus (393) Google Scholar), and AC29 (SCAP+ and ACAT-deficient) (20Chang C.C. Huh H.Y. Cadigan K.M. Chang T.Y. Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells.J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar) were cultivated in F12K/DMEM (1:1) medium containing 5% FBS. HepG2 cells were transfected with X-tremeGENE 9 (catalog no. 06365779001, Roche Applied Science), and HEK293 cells were transfected with Lipofectamine 2000 (catalog no. 11668-019, Invitrogen) DNA transfection reagents according to the manufacturer's recommendations. Wild-type C57BL/6 male mice were obtained from Charles River and maintained on a standard rodent diet for 3 days in a 12-h light/12-h dark cycle for acclimatization. Pcsk9-deficient male mice (Pcsk9−/−; Jackson Laboratories) were continuously backcrossed to C57BL/6 mice at least six generations prior to experimentations. 8–10-week-old male mice (∼25 g) were injected intraperitoneally or subcutaneously with 0.9% NaCl (saline) or with 2.5, 5, or 10 mg/kg/day 5-AzaC. 24, 48, or 120 h postinjection, mice were anesthetized, and blood was collected by cardiac puncture, and dissected livers were snap-frozen in liquid nitrogen for further analyses. The Montreal Heart Institute Animal Care and Ethical Committee approved all animal studies. The integrity of total RNA samples, isolated using TRIzol (catalog no. 15596026, Invitrogen), was verified by agarose gel electrophoresis or by an Agilent 2100 Bioanalyzer profile. Afterward, cDNA was prepared using SuperScript II reverse transcriptase according the manufacturer's instructions (catalog no. 18064-014, Invitrogen). Quantitative real-time PCR was performed with the MX3000p real-time thermal cycler (Agilent) using PerfeCTa SYBR Green SuperMix, UNG, Low ROX (catalog no. 95070–100, Quanta Biosciences). For each gene of interest, dissociation curves and agarose gel electrophoresis were performed to ensure a unique PCR product. Arbitrary units were determined from PCR duplicates for each sample using the TATA box-binding protein (TBP), the ribosomal protein S14, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a normalizer. Oligonucleotide sequences are listed in Table 1.TABLE 1Oligonucleotides used for quantitative PCR and plasmid constructionsQuantitative PCRForward (5′ → 3′)Reverse (5′ → 3′)Gene (accession no.) Human PCSK9 (NM_174936)ATCCACGCTTCCTGCTGCCACGGTCACCTGCTCCTG Human HMGCR (NM_000859)GTCACATGATTCACAACAGGGTCCTTTAGAACCCAATGC Human LDLR (NM_000527)AGGAGACGTGCTTGTCTGTCCTGAGCCGTTGTCGCAGT Human SREBF2 (NM_004599)AGAATGTCCTTCTGATGTCCGGAGAGTCTGGCTCATCTT Human AGPAT9 (NM_032717)CGTCTGTGACGTGTGGTACATCCTCCATCCCAGGGAAGTT Human H19 (NR_002196)CTTTACAACCACTGCACTACCTGACGATGGTGTCTTTGATGTTGGGCTGA Human TBP (NM_001172085)CGAATATAATCCCAAGCGGTTTGTGGTTCGTGGCTCTCTTATCC Human RPS14 (NM_001025071)GGCAGACCGAGATGAATCCTCACAGGTCCAGGGGTCTTGGTCC Mouse Pcsk9 (NM_153565)TGCAAAATCAAGGAGCATGGGCAGGGAGCACATTGCATCC Mouse Hmgcr (NM_008255)GTACGGAGAAAGCACTGCTGAATGACTGCCAGAATCTGCATGTC Mouse Lldlr (NM_010700)GTATGAGGTTCCTGTCCATCCCTCTGTGGTCTTCTGGTAG Mouse RPS16 (NM_013647)AGGAGCGATTTGCTGGTGTGGGCTACCAGGGCCTTTGAGATG Hamster Ldlr (NM_001246823)AAGGAGAAGGACACTGTTCCATGCTGGAGATAGAGTGGAG Hamster Gapdh (NM_001244854)ACCCAGAAGACTGTGGATGGCGACATGTGAGATCCACGACpGLuc constructs TBPTGTACTAGTTGAGTATGTAGGATAGATAGTCGCAAAGCTTGATGTTCACTTTCTTCTTGGC LDLRTGTACTAGTCTTATTCCTGGGGGAACCGCGCAAAGCTTGCTCGCAGCCTCTGCCAGGCAGTG PCSK9 (1000 bp)TACACTAGTCTGGTACACAATAGGTGTTTACTGTGAAAGCTTGAGGGCCAGGGGAGAGGTTGC PCSK9 (400 bp)ACAACTAGTAGTCCGGGGGTTCCGTTAATGTTCTCGGTGGGCTTGGCCTC PCSK9 (1000 bp; SRE-mut)PCR1: CAAGGTGGACCCAGGAAACACTPCR1: CGCAGATCACGGATCCAGAGCCCCATCGPCR2: GGCTCTGGATCCGTGATCTGCGCGCCCCAGGPCR2: TGAAAGCTTGAGGGCCAGGGGAGAGGTTGC PCSK9 (1000 bp; HNF-mut)PCR1: CAAGGTGGACCCAGGAAACACTPCR1: CCTATCTGATTAAACATTCCAGGAACCCCCGGAPCR2: GGGGTTCCTGGAATGTTTAATCAGATAGGATCGPCR2: TGAAAGCTTGAGGGCCAGGGGAGAGGTTGCNuclear SREBP-2 pIRES-nBP2 (amino acids 1–468)CCGCTCGAGGGGCGGTGGCGACGGCACCGCGTGGATCCTCAGTCTGGCTCATCTTTGACC Open table in a new tab Extracted total RNA was purified with the RNeasy MinElute cleanup kit (catalog no. 74204, Qiagen). The quality of the total RNA was evaluated on an Agilent 2100 Bioanalyzer system. The microarray experiment was performed using the GeneChip Human Gene 1.0 ST (catalog no. 901085, Affymetrix). For each sample, 100 ng of total RNA was converted into cDNA using the Ambion WT Expression Kit (catalog no. 4411974, Invitrogen). 6 μg of the single-stranded cDNA was fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit (catalog no. 900670), and 2 μg of the resulting cDNA was hybridized onto the chip. The whole hybridization procedure was performed using the Affymetrix GeneChip system according to the protocol recommended by Affymetrix. The hybridization was evaluated with Affymetrix GeneChip Command Console Software (AGCC), and the quality of the chips was evaluated with Affymetrix Expression Console. Partek Genomics Suite was used for data analysis. First, the data were normalized by the RMA (robust multichip average) algorithm, which uses background adjustment, quantile normalization, and summarization. Then the transcripts found to be significantly differentially expressed between control (DMEM) and treatment (5-AzaC) groups by more than 2-fold were included in the gene enrichment and pathway analyses, which were performed using the Web-based DAVID functional enrichment algorithm (21Huang da W. Sherman B.T. Lempicki R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources.Nat. Protoc. 2009; 4: 44-57Crossref PubMed Scopus (25470) Google Scholar). Complete microarray data can be found in supplemental File 1. Human PCSK9 (−1000 bp), LDLR (−1020 bp), and TBP (−1000 bp) proximal promoter cDNAs were generated by PCR using genomic DNA from HepG2 cells as template. Sterol response element (SRE; bp −345 to −337) and HNF1 (hepatocyte nuclear factor 1) motifs (bp −386 to −374) were mutated within the 1000-bp PCSK9 proximal promoter by directed mutagenesis, as described (22Li H. Dong B. Park S.W. Lee H.S. Chen W. Liu J. Hepatocyte nuclear factor 1α plays a critical role in PCSK9 gene transcription and regulation by the natural hypocholesterolemic compound berberine.J. Biol. Chem. 2009; 284: 28885-28895Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar). All amplified products were digested with SpeI and HindIII endonucleases and ligated into pCMV-GLuc vector (catalog no. N8081S, New England Biolabs) in order to replace the CMV promoter. Selected clones were verified by DNA sequencing. All oligonucleotides used are listed in Table 1. Before transfection, HepG2 cells were seeded in 24-well plates at a density of 1.5 × 105/well. 24 h later, cells were transfected in duplicate with the corresponding pGLuc construct. After overnight incubation, cells were washed twice with DMEM and incubated in 0.5 ml of DMEM without or with 10 μm 5-AzaC for 24 h. 20 μl of conditioned media was loaded into black 96-well plates, and relative activity of secreted Gaussia luciferase was assessed by luminescence measurements using the BioLux kit (catalog no. E3300L, New England Biolabs) and the BioTek Synergy 2 microplate reader. Cells were washed three times in phosphate-buffered saline (PBS) and lysed in radioimmune precipitation assay buffer (50 mm Tris/HCl, pH 8.0, 1% (v/v) Nonidet P-40, 0.5% sodium deoxycholate, 150 mm NaCl, and 0.1% (v/v) SDS) supplemented with a complete protease inhibitor mixture (catalog no. 11 697 498 001, Roche Applied Science). Proteins were separated by 8% SDS-polyacrylamide gel electrophoresis, blotted on nitrocellulose membranes (Bio-Rad), and blocked for 1 h in Tris-buffered saline-Tween 20 (TBS-T; 50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.1% Tween 20) containing 5% nonfat dry milk. Membranes were then incubated overnight in TBS-T supplemented with 1% nonfat milk and the indicated antibodies: rabbit anti-PCSK9 (amino acids 31–454) (1:2500; custom made, GenScript), goat anti-human or anti-mouse LDLR (1:1000; catalog no. AF2148 or A2255, R&D Systems), mouse anti-SREBP-1 (1:1000; catalog no. MS-1207, Thermo Fisher Scientific), rabbit anti-SREBP-2 (1:2000 (catalog no. ab30682, Abcam) or 1:10,000 (kindly provided by Dr. Sahng Park, Yonsei University College of Medicine, Seoul, Korea) (23Jeong H.J. Lee H.S. Kim K.S. Kim Y.K. Yoon D. Park S.W. Sterol-dependent regulation of proprotein convertase subtilisin/kexin type 9 expression by sterol-regulatory element binding protein-2.J. Lipid Res. 2008; 49: 399-409Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar)), mouse anti-V5-tag (1:5000; catalog no. A00641, GenScript), rabbit anti-Stat1 (1:1000; catalog no. 9172, Cell Signaling), hamster anti-SREBP-2 (purified from hybridoma IgG-7D4 (1:5; ATCC), anti-transferrin receptor (1:2500; catalog no. 13-6800, Invitrogen), rabbit anti-β-actin (1:5000; catalog no. A2066, Sigma-Aldrich), or horseradish peroxidase (HRP)-conjugated goat anti-human albumin (1:5000; catalog no. AL10H-G1a, Academy Bio-medical). Appropriate HRP-conjugated secondary antibodies (1:10,000; GE healthcare) were used for detection using the Western Lightning Ultra chemiluminescence kit (catalog no. NEl112001EA, PerkinElmer Life Sciences) and BioFlex EC Films (catalog no. CLEC810, InterScience). Circulating mouse Pcsk9 was immunoprecipitated and analyzed by Western blotting, as described previously (24Seidah N.G. Poirier S. Denis M. Parker R. Miao B. Mapelli C. Prat A. Wassef H. Davignon J. Hajjar K.A. Mayer G. Annexin A2 is a natural extrahepatic inhibitor of the PCSK9-induced LDL receptor degradation.PLoS One. 2012; 7: e41865Crossref PubMed Scopus (90) Google Scholar). Total SREBP-2 was immunoprecipitated from 1 mg of protein (1:500; provided by Dr. Park) together with 50 μl of protein A/G PLUS-agarose (catalog no. sc-2003, Santa Cruz Biotechnology, Inc.) supplemented with protease inhibitors and 25 μg/ml N-acetyl-leucinal-leucinal-norleucinal (catalog no. 208750, Calbiochem). Following overnight incubation, beads were washed six times in radioimmune precipitation assay buffer and resuspended in 75 μl of Laemmli sample buffer. All of the immunoprecipitation procedure was carried out at 4 °C. 24 h after treatment, HepG2 or CHO cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100/PBS for 1" @default.
• W2003295134 created "2016-06-24" @default.
• W2003295134 creator A5015741667 @default.
• W2003295134 creator A5026563745 @default.
• W2003295134 creator A5030058216 @default.
• W2003295134 creator A5047179498 @default.
• W2003295134 creator A5073998071 @default.
• W2003295134 creator A5078784244 @default.
• W2003295134 creator A5089576069 @default.
• W2003295134 creator A5090257416 @default.
• W2003295134 date "2014-07-01" @default.
• W2003295134 modified "2023-10-12" @default.
• W2003295134 title "The Epigenetic Drug 5-Azacytidine Interferes with Cholesterol and Lipid Metabolism" @default.
• W2003295134 cites W1490548175 @default.
• W2003295134 cites W1615873781 @default.
• W2003295134 cites W1859037964 @default.
• W2003295134 cites W1967064280 @default.
• W2003295134 cites W1967502002 @default.
• W2003295134 cites W1975701262 @default.
• W2003295134 cites W1980568044 @default.
• W2003295134 cites W1986053870 @default.
• W2003295134 cites W1991858306 @default.
• W2003295134 cites W1991952570 @default.
• W2003295134 cites W1995164843 @default.
• W2003295134 cites W2007809519 @default.
• W2003295134 cites W2008688211 @default.
• W2003295134 cites W2011857098 @default.
• W2003295134 cites W2017061507 @default.
• W2003295134 cites W2020988004 @default.
• W2003295134 cites W2021632088 @default.
• W2003295134 cites W2025714915 @default.
• W2003295134 cites W2029033394 @default.
• W2003295134 cites W2032435199 @default.
• W2003295134 cites W2038369321 @default.
• W2003295134 cites W2040612932 @default.
• W2003295134 cites W2047695409 @default.
• W2003295134 cites W2050348933 @default.
• W2003295134 cites W2052378749 @default.
• W2003295134 cites W2063607020 @default.
• W2003295134 cites W2063700981 @default.
• W2003295134 cites W2064877960 @default.
• W2003295134 cites W2070706618 @default.
• W2003295134 cites W2081458493 @default.
• W2003295134 cites W2081987270 @default.
• W2003295134 cites W2083462343 @default.
• W2003295134 cites W2106833395 @default.
• W2003295134 cites W2107108445 @default.
• W2003295134 cites W2116269315 @default.
• W2003295134 cites W2117810638 @default.
• W2003295134 cites W2119176939 @default.
• W2003295134 cites W2121471194 @default.
• W2003295134 cites W2122391469 @default.
• W2003295134 cites W2130616164 @default.
• W2003295134 cites W2138486337 @default.
• W2003295134 cites W2140901093 @default.
• W2003295134 cites W2141597250 @default.
• W2003295134 cites W2149683741 @default.
• W2003295134 cites W2153118028 @default.
• W2003295134 cites W2158217645 @default.
• W2003295134 cites W2159216465 @default.
• W2003295134 cites W2159728029 @default.
• W2003295134 cites W2160241210 @default.
• W2003295134 cites W2170467167 @default.
• W2003295134 cites W2171779663 @default.
• W2003295134 cites W2186316312 @default.
• W2003295134 cites W2596098505 @default.
• W2003295134 doi "https://doi.org/10.1074/jbc.m114.563650" @default.
• W2003295134 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4081918" @default.
• W2003295134 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/24855646" @default.
• W2003295134 hasPublicationYear "2014" @default.
• W2003295134 type Work @default.
• W2003295134 sameAs 2003295134 @default.
• W2003295134 citedByCount "34" @default.
• W2003295134 countsByYear W20032951342014 @default.
• W2003295134 countsByYear W20032951342015 @default.
• W2003295134 countsByYear W20032951342016 @default.
• W2003295134 countsByYear W20032951342017 @default.
• W2003295134 countsByYear W20032951342018 @default.
• W2003295134 countsByYear W20032951342019 @default.
• W2003295134 countsByYear W20032951342020 @default.
• W2003295134 countsByYear W20032951342021 @default.
• W2003295134 countsByYear W20032951342022 @default.
• W2003295134 countsByYear W20032951342023 @default.
• W2003295134 crossrefType "journal-article" @default.
• W2003295134 hasAuthorship W2003295134A5015741667 @default.
• W2003295134 hasAuthorship W2003295134A5026563745 @default.
• W2003295134 hasAuthorship W2003295134A5030058216 @default.
• W2003295134 hasAuthorship W2003295134A5047179498 @default.
• W2003295134 hasAuthorship W2003295134A5073998071 @default.
• W2003295134 hasAuthorship W2003295134A5078784244 @default.
• W2003295134 hasAuthorship W2003295134A5089576069 @default.
• W2003295134 hasAuthorship W2003295134A5090257416 @default.
• W2003295134 hasBestOaLocation W20032951341 @default.
• W2003295134 hasConcept C104317684 @default.
• W2003295134 hasConcept C185592680 @default.
• W2003295134 hasConcept C2778163477 @default.
• W2003295134 hasConcept C2780035454 @default.
• W2003295134 hasConcept C41091548 @default.

• next