FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003424893> ?p ?o ?g. }

• W2003424893 endingPage "20375" @default.
• W2003424893 startingPage "20366" @default.
• W2003424893 abstract "Two exocellular nucleases with molecular masses of 18 and 34 kDa, which are nutritionally regulated and reach their maximum activity during aerial mycelium formation and sporulation, have been detected in Streptomyces antibioticus. Their function appears to be DNA degradation in the substrate mycelium, and in agreement with this proposed role the two nucleases cooperate efficiently with a periplasmic nuclease previously described inStreptomyces antibioticus to completely hydrolyze DNA. The nucleases cut DNA nonspecifically, leaving 5′-phosphate mononucleotides as the predominant products. Both proteins require Mg2+, and the additional presence of Ca2+ notably stimulates their activities. The two nucleases are inhibited by Zn2+and aurin tricarboxylic acid. The 18-kDa nuclease fromStreptomyces is reminiscent of NUC-18, a thymocyte nuclease proposed to have a key role in glucocorticoid-stimulated apoptosis. The 18-kDa nuclease was shown, by amino-terminal protein sequencing, to be a member of the cyclophilin family and also to possess peptidylprolylcis-trans-isomerase activity. NUC-18 has also been shown to be a cyclophilin, and “native” cyclophilins are capable of DNA degradation. The S. antibioticus 18-kDa nuclease is produced by a proteolytic processing from a less active protein precursor. The protease responsible has been identified as a serine protease that is inhibited byN α -p-tosyl-l-lysine chloromethyl ketone and leupeptin. Inhibition of both of the nucleases or the protease impairs aerial mycelium development in S. antibioticus. The biochemical features of cellular DNA degradation during Streptomyces development show significant analogies with the late steps of apoptosis of eukaryotic cells. Two exocellular nucleases with molecular masses of 18 and 34 kDa, which are nutritionally regulated and reach their maximum activity during aerial mycelium formation and sporulation, have been detected in Streptomyces antibioticus. Their function appears to be DNA degradation in the substrate mycelium, and in agreement with this proposed role the two nucleases cooperate efficiently with a periplasmic nuclease previously described inStreptomyces antibioticus to completely hydrolyze DNA. The nucleases cut DNA nonspecifically, leaving 5′-phosphate mononucleotides as the predominant products. Both proteins require Mg2+, and the additional presence of Ca2+ notably stimulates their activities. The two nucleases are inhibited by Zn2+and aurin tricarboxylic acid. The 18-kDa nuclease fromStreptomyces is reminiscent of NUC-18, a thymocyte nuclease proposed to have a key role in glucocorticoid-stimulated apoptosis. The 18-kDa nuclease was shown, by amino-terminal protein sequencing, to be a member of the cyclophilin family and also to possess peptidylprolylcis-trans-isomerase activity. NUC-18 has also been shown to be a cyclophilin, and “native” cyclophilins are capable of DNA degradation. The S. antibioticus 18-kDa nuclease is produced by a proteolytic processing from a less active protein precursor. The protease responsible has been identified as a serine protease that is inhibited byN α -p-tosyl-l-lysine chloromethyl ketone and leupeptin. Inhibition of both of the nucleases or the protease impairs aerial mycelium development in S. antibioticus. The biochemical features of cellular DNA degradation during Streptomyces development show significant analogies with the late steps of apoptosis of eukaryotic cells. The actinomycetes are a large group of filamentous bacteria that are adapted for growth in soil by forming a ramifying network, called a mycelium. Within this group the predominant isolates belong to the genus Streptomyces, which produce a well developed branched mycelium on agar plates, resulting in a compact colony. In the vegetative phase, the filaments often lack cross-walls (substrate mycelium) and thus have several copies of the chromosome. When the colony ages, a characteristic aerial mycelium is formed, in response to unknown signals involving nutrient limitation, which subsequently fragment and/or sporulate by the synchronous formation of cross-walls in the multinucleate sporophores followed by separation of the individual cells directly into spores. This is similar to the growth and differentiation of fungi, and from the morphological and metabolic points of view, Streptomyces can be considered as boundary organisms (1Omura S. Queener S.W. Day L.E. The Bacteria. IX. Academic Press, Inc., New York1986: xvii-xxxiGoogle Scholar). Coincident with the morphological differentiation, the streptomycetes produce numerous compounds (secondary metabolites) within which antibiotics are of commercial relevance. As corresponds to their habitat, these bacteria are nutritionally quite versatile, and most produce extracellular hydrolytic enzymes that permit the utilization of polysaccharides, proteins, fats, and other substrates. In this way, the substrate mycelium promote the solubilization of high molecular weight biopolymers. In addition, the onset of aerial mycelium formation coincides with a noticeable lysis of the substrate hyphae (2Wildermuth H. J. Gen. Microbiol. 1970; 60: 43-50Crossref PubMed Scopus (70) Google Scholar,3Méndez C. Braña A.F. Manzanal M.B. Hardisson C. Can. J. Microbiol. 1985; 31: 446-450Crossref PubMed Scopus (66) Google Scholar). This fact, together with the absence of an increase in dry weight during the development of the aerial mycelium and the displacement of labeled protein precursors from the substrate to the aerial mycelium (3Méndez C. Braña A.F. Manzanal M.B. Hardisson C. Can. J. Microbiol. 1985; 31: 446-450Crossref PubMed Scopus (66) Google Scholar), supports the hypothesis that the aerial mycelium reuses material first assimilated into the substrate mycelium. These events, which occur in stressful environmental conditions, are directed to generate and disseminate spores that have a greater potential for survival. The lytic phenomenon observed in the substrate mycelium and the subsequent transformation of aerial mycelium into spores can be considered as a programmed cell death (4Hochman A. Crit. Rev. Microbiol. 1997; 23: 207-214Crossref PubMed Scopus (84) Google Scholar) that takes place within a developmental program (similar to metazoan differentiation) that contributes to the adaptation of the bacteria to the environment. Streptomyces is a great producer of proteolytic enzymes (5Rao M.B. Tanksale A.M. Ghatge M.N. Deshpande V.V. Microbiol. Mol. Biol. Rev. 1998; 62: 597-635Crossref PubMed Google Scholar). It is assumed that extracellular proteases produced in actinomycetes participate in the assimilation of the extracellular proteinaceous nitrogen sources (6Shapiro S. Regulation of Secondary Metabolism in Actinomycetes. CRC Press, Inc., Boca Raton, FL1989: 149-153Google Scholar). However, the proteases involved in the hydrolysis of the substrate mycelium proteins have not been unequivocally identified. The serine-type protease activity produced during the late stationary phase in Streptomyces peucetius has been suggested to have a role in cellular turnover on solid substrates (7Gibb G.D. Strohl W.R. Can. J. Microbiol. 1988; 34: 187-190Crossref PubMed Scopus (49) Google Scholar). Like other hydrolytic exocytoplasmic enzymes, the synthesis of deoxyribonucleases in Streptomyces has also been associated with a nutritional role (8Chater K.F. Hopwood D.A. Hopwood D.A. Chater K.F. Genetics of Bacterial Diversity. Academic Press, London1989: 129-150Google Scholar). However, there are very few reports of their presence (9Yanagida T. Ogawara H. J. Antibiot. (Tokyo). 1980; 33: 1206-1207Crossref PubMed Scopus (13) Google Scholar) or biochemical characteristics (10Vukelic B. Ritonja A. Vitale LJ. Appl. Microbiol. Biotechnol. 1995; 43: 1056-1060Crossref PubMed Scopus (5) Google Scholar). Our group has carried out a detailed biochemical characterization of several nucleases that showed novel specificities for the hydrolysis of DNA and are associated with the cell wall domain in Streptomyces glaucescens and Streptomyces antibioticus (11Aparicio J.F. De los Reyes-Gavilán C.G. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1988; 134: 2345-2351PubMed Google Scholar, 12De los Reyes-Gavilán C.G. Aparicio J.F. Barbes C. Hardisson C. Sánchez J. J. Bacteriol. 1988; 170: 1339-1345Crossref PubMed Google Scholar, 13De los Reyes-Gavilán C.G. Aparicio J.F. Barbes C. Hardisson C. Sánchez J. FEMS Microbiol. Lett. 1988; 56: 301-306Crossref Scopus (7) Google Scholar, 14De los Reyes-Gavilán C.G. Cal S. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1991; 136: 299-305Crossref Scopus (12) Google Scholar, 15Aparicio J.F. Hardisson C. Sánchez J. Biochem. J. 1992; 281: 231-237Crossref PubMed Scopus (17) Google Scholar, 16Aparicio J.F. Freije J.M.P. Lopez-Otin C. Cal S. Sánchez J. Eur. J. Biochem. 1992; 205: 695-699Crossref PubMed Scopus (2) Google Scholar, 17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar, 18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). Although these enzymes can circumstantially restrict the growth of actinophages (11Aparicio J.F. De los Reyes-Gavilán C.G. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1988; 134: 2345-2351PubMed Google Scholar, 12De los Reyes-Gavilán C.G. Aparicio J.F. Barbes C. Hardisson C. Sánchez J. J. Bacteriol. 1988; 170: 1339-1345Crossref PubMed Google Scholar, 13De los Reyes-Gavilán C.G. Aparicio J.F. Barbes C. Hardisson C. Sánchez J. FEMS Microbiol. Lett. 1988; 56: 301-306Crossref Scopus (7) Google Scholar), they are not restriction endonucleases, and their synthesis is repressed by rich nitrogen sources, which promote high growth rates and also impair aerial mycelium formation (11Aparicio J.F. De los Reyes-Gavilán C.G. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1988; 134: 2345-2351PubMed Google Scholar, 12De los Reyes-Gavilán C.G. Aparicio J.F. Barbes C. Hardisson C. Sánchez J. J. Bacteriol. 1988; 170: 1339-1345Crossref PubMed Google Scholar, 14De los Reyes-Gavilán C.G. Cal S. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1991; 136: 299-305Crossref Scopus (12) Google Scholar). The nucleases are active as monomers and nick double-stranded DNA at dG/dC-rich sequences, which would make the high dG + dC Streptomyces DNA an excellent substrate (16Aparicio J.F. Freije J.M.P. Lopez-Otin C. Cal S. Sánchez J. Eur. J. Biochem. 1992; 205: 695-699Crossref PubMed Scopus (2) Google Scholar, 17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar, 18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). The end products of the hydrolysis of these enzymes are fragments from 7–24 base pairs (for S. glaucescensnuclease) or 35–250 base pairs (for S. antibioticusnuclease). The residual fragments have 5′ or 3′ short single-stranded overhangs with 3′-hydroxyl and 5′-phosphate termini (16Aparicio J.F. Freije J.M.P. Lopez-Otin C. Cal S. Sánchez J. Eur. J. Biochem. 1992; 205: 695-699Crossref PubMed Scopus (2) Google Scholar, 17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar). The specificity and interaction of the S. antibioticus nuclease with oligodeoxynucleotide substrates containing dG base analogues were further analyzed in detail (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). A detailed study of the production of this enzyme in surface cultures of S. antibioticus showed that the appearance of the nuclease always precedes differentiation (14De los Reyes-Gavilán C.G. Cal S. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1991; 136: 299-305Crossref Scopus (12) Google Scholar). Following the role postulated for proteases in the “parasitic” behavior of the aerial mycelium with respect to the substrate mycelium, we proposed an analogous function of the S. antibioticus and S. glaucescens nucleasesi.e. the recycling of DNA deoxynucleotides from the substrate to the aerial mycelium (14De los Reyes-Gavilán C.G. Cal S. Barbes C. Hardisson C. Sánchez J. J. Gen. Microbiol. 1991; 136: 299-305Crossref Scopus (12) Google Scholar, 16Aparicio J.F. Freije J.M.P. Lopez-Otin C. Cal S. Sánchez J. Eur. J. Biochem. 1992; 205: 695-699Crossref PubMed Scopus (2) Google Scholar, 17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar, 18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). The periplasmic location of these enzymes would permit them to gain access to the DNA after the lysis of the mycelium. However, other nuclease activities would be required to degrade the nicked and fragmented DNA, produced by the dG/dC-specific nucleases, to the deoxynucleotide level (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). We describe in this work two predominant, nonspecific nucleases in the exocellular fraction of S. antibioticus grown under both surface and submerged conditions. The biochemical characteristics of the purified enzymes have been analyzed, including their capacity to complement the action of the periplasmic enzymes described above. One of the nucleases has been identified as a cyclophilin, a class of proteins previously proposed to have a role in cell death (19Montague J.W. Cidlowski J.A. Experientia. 1996; 52: 957-962Crossref PubMed Scopus (45) Google Scholar, 20Montague J.W. Hughes Jr., F.M. Cidlowski J.A. J. Biol. Chem. 1997; 272: 6677-6684Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 21Montague J.W. Gaido M.L. Frye C. Cidlowski J.A. J. Biol. Chem. 1994; 269: 18877-18880Abstract Full Text PDF PubMed Google Scholar). Also we describe a serine protease that is likely to be involved in the production of active nucleases by proteolytic processing of larger less active precursors. The enzymes analyzed in Streptomyces and the overall process of aerial mycelium formation both show significant analogies with the enzymes and steps described during apoptosis in eukaryotic cells. S. antibioticusATCC11891 was cultured in solid or liquid GAE medium (glucose, asparagine, yeast extract, and salts) (3Méndez C. Braña A.F. Manzanal M.B. Hardisson C. Can. J. Microbiol. 1985; 31: 446-450Crossref PubMed Scopus (66) Google Scholar) at 30 °C and 200 rpm in the case of submerged conditions. Nuclease activity was measured by the formation of acid-soluble DNA products. The standard reaction mixture contained 4 μg of calf thymus DNA (Roche Molecular Biochemicals) in 20 mm Hepes, pH 8.0, 7 mm2-mercaptoethanol, 25 mm NaCl, 10 mmMgCl2, 5 mm CaCl2 (activity buffer). When required, alternative divalent cation combinations were tested, the concentration of NaCl was varied, and the effects of other components (e.g. iodoacetate, EDTA, EGTA, and aurin tricarboxylic acid (ATA) 1The abbreviations ATAaurin tricarboxylic acidTLPtrypsin-like proteaseMes2-(N-morpholino)ethanesulfonic acidPAGEpolyacrylamide gel electrophoresisFPLCfast protein liquid chromatographyAPalkaline phosphatasePNKpolynucleotide kinaseTLCKNα-p-tosyl-l-lysine chloromethyl ketoneCADcaspase-activated deoxyribonucleaseICADinhibitor of caspase-activated deoxyribonuclease ) were investigated (see “Results” for exact conditions). The effects of pH variation were studied using 20 mm levels of sodium acetate (pH 4.0–5.5), Mes (pH 5.0–6.5), Tris (pH 7.0–9.0), Hepes (pH 6.5–8.5), and glycine (pH 8.0–11.0). After the appropriate incubation times at 37 °C, the reaction was terminated by adding 10% trichloroacetic acid plus 20 mm sodium pyrophosphate (22Fraser M.J. Methods Enzymol. 1980; 65: 255-263Crossref PubMed Scopus (32) Google Scholar). The activity was expressed by the increase in the absorbance at 260 nm in the supernatant after trichloroacetic acid precipitation. One unit of the enzyme activity is equivalent to an increase inA 260 of 0.015 obtained under the above reaction conditions. Nuclease activity was also visualized by 0.8% agarose gel electrophoresis analysis of the products of the reaction on λ DNA (0.5 μg) (Roche Molecular Biochemicals) using ethidium bromide detection. aurin tricarboxylic acid trypsin-like protease 2-(N-morpholino)ethanesulfonic acid polyacrylamide gel electrophoresis fast protein liquid chromatography alkaline phosphatase polynucleotide kinase Nα-p-tosyl-l-lysine chloromethyl ketone caspase-activated deoxyribonuclease inhibitor of caspase-activated deoxyribonuclease Plates of solid GAE medium (3Méndez C. Braña A.F. Manzanal M.B. Hardisson C. Can. J. Microbiol. 1985; 31: 446-450Crossref PubMed Scopus (66) Google Scholar) were used to analyze the production of the different exocellular nuclease forms of S. antibioticus ATCC11891. The nucleases were directly extruded from the medium by forcing the agar through the nozzle (about 2 mm across) of a 20-ml plastic syringe (Becton Dickinson) without needle. The resulting suspension was centrifuged, at 4 °C, for 30 min at 15,000 rpm, and the supernatant was filtered through a 0.2-μm diameter Millipore cellulose-acetate filter to eliminate the remaining agar. Samples were concentrated by acetone precipitation (1:3 (v/v) sample:acetone; −20 °C for 45 min; centrifugation) and resuspended in 0.5 ml of 20 mmTris-HCl, pH 8.0, 1 mm EDTA, 7 mm2-mercaptoethanol, 50 mm NaCl. The nucleases were separated using a 12% SDS-PAGE gel containing 10 μg/ml of denatured calf thymus DNA. SDS for these experiments was from BDH Laboratory Supplies (Poole, Dorset, United Kingdom). Following electrophoresis, the proteins were renatured by repeatedly washing the gel with the above buffer (2 h, at 4 °C) followed by Milli-Q-purified water at room temperature (23Rosenthal A. Lacks S.A. Anal. Biochem. 1977; 80: 76-90Crossref PubMed Scopus (254) Google Scholar). Nuclease activity was visualized by incubating the gels, for 4 h at 37 °C, in 20 mm Tris-HCl, pH 8.0, 7 mm 2-mercaptoethanol, 20 mm NaCl, 10 mm MgCl2, 5 mm CaCl2, 10% Me2SO following by staining with ethidium bromide and viewing under UV light. Micrococcal nuclease and bovine pancreatic DNase I (Amersham Pharmacia Biotech) were included as controls. DNA degradation in the substrate mycelium of S. antibioticus was analyzed after a controlled extraction from the cells and medium and subsequent agarose gel electrophoresis. The plates were homogenized by slowly forcing the agar through a 20-ml plastic syringe without needle, as described above. To the agar paste, 0.2 m phosphate-citric acid buffer, pH 7.8, containing 20 mm EDTA and 0.1% Triton X-100 was added, and the agar suspension was carefully mixed, at 30 °C, for 30 min. The suspension was centrifuged (4 °C) at 15,000 rpm, and the supernatant was then extracted with an equal volume of buffered phenol (1×) and with a 1:1 phenol/chloroform mixture (2×). DNA was precipitated, from the aqueous phase, with 3m sodium acetate/ethanol, washed with 70% ethanol, and air-dried. The precipitate was gently resuspended in 10 mmTris-HCl, pH 7.5, 15 mm NaCl and treated with RNase A (50 μg/ml) for 2 h at 37 °C. After a further precipitation and washing, the DNA was resuspended in 10 mm Tris-HCl, pH 8.0, 1 mm EDTA buffer and analyzed on a 0.8% agarose gel with ethidium bromide staining. The 34-kDa nuclease was purified from liquid GAE cultures after 28–34-h incubation at 30 °C. Mycelia were pelleted by centrifugation (12,000 rpm, 1 h, 4 °C), and the proteins in the supernatant were precipitated with (NH4)2SO4. The fraction obtained between 60 and 80% (NH4)2SO4saturation (fraction 1) was resuspended in buffer A (20 mmTris-HCl, pH 8.8, 1 mm EDTA, 1 mmNaN3, 7 mm 2-mercaptoethanol, 50 mmNaCl) and dialyzed overnight against this buffer. The resulting solution was applied to a DEAE-Sephacel column (Amersham Pharmacia Biotech) (flow rate of 24 ml/h) in buffer A containing 0.1m NaCl and eluted with a linear gradient of 0.1–1m NaCl in buffer A. The enzyme eluted at 0.3 msalt (fraction 2). Following dialysis against buffer A, fraction 2 was applied to a heparin-agarose column (Sigma) (flow rate of 6 ml/h) and eluted with a linear gradient of 50 mm to 0.5 msalt. The nuclease eluted at 0.21 m NaCl (fraction 3). This fraction was dialyzed against buffer A, applied to a Mono-Q HR 5/5 FPLC column (Amersham Pharmacia Biotech) (flow rate of 0.5 ml/min), and eluted with a linear gradient of 50 mm to 0.5 mNaCl. The nuclease eluted at 0.25 m NaCl to give fraction 4, which was concentrated using a Centricon 10 (Amicon). The concentrated fraction 4 was applied, in 200-μl volumes, to a Superdex G-75 FPLC column (Amersham Pharmacia Biotech) equilibrated and eluted with buffer A plus 0.15 m NaCl. The fractions containing pure protein (fraction 5) were concentrated (Centricon 10) and stored at −20 °C in buffer A with 1 mm dithiothreitol, 0.1m NaCl, 20% (v/v) glycerol. During the purification process, the nuclease was detected by activity gel analysis and also by visualization of the products of λ DNA hydrolysis using gel electrophoresis (see above). When necessary, protein concentration was estimated colorimetrically (17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar) with a Bio-Rad protein assay kit. The purification of the 18-kDa nuclease followed that of the 34-kDa nuclease up to the preparation of fraction 1 dialyzed against buffer A. This fraction was then was then applied to a DEAE-Sephacel column and eluted in one step with buffer A plus 0.1 m NaCl to give fraction 2. The sample was concentrated by acetone precipitation (1:5 (v/v); −20 °C for 45 min), resuspended in buffer A with 25 mm NaCl, and applied to a single-stranded DNA-cellulose affinity column (Sigma). The nuclease was eluted in buffer A plus 50 mm NaCl to give fraction 3. The sample was concentrated (Centricon 10) and applied to a Superdex-G-75 HR 10/30 FPLC column (Amersham Pharmacia Biotech) using buffer A containing 0.15m NaCl. The homogeneous protein (fraction 4) was concentrated and stored at −20 °C in the same buffer used to store the 34-kDa nuclease. The 74-kDa nuclease precursor was partially purified from 14–18-h cultures by (NH4)2SO4 precipitation (80% saturation) and chromatography on DEAE-Sephacel using the same conditions as those described above for the 18-kDa enzyme. The purity of the enzymes after the last purification step was assessed by SDS-PAGE using silver staining (17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar) and also by activity gel analysis (see above). For the analysis of the molecular mass in SDS-PAGE, bovine serum albumin (66 kDa), ovalbumin (45 kDa), glyceraldehyde-3-phosphate dehydrogenase (36 kDa), carbonic anhydrase (29 kDa), trypsinogen (24 kDa), and trypsin inhibitor (20 kDa) were used as standards. Sequencing of the amino-terminal end of the purified 34- and 18-kDa nucleases was carried out by an Edman degradation after the electrophoretic transfer of the protein to a polyvinylidene difluoride Immobilon membrane (24Matsudaira P. J. Biol. Chem. 1987; 262: 10035-10038Abstract Full Text PDF PubMed Google Scholar). Gel filtration chromatography on Superdex-G-75 (operated as described in the purification protocols above) was used to determine the native molecular masses of the 18- and 34-kDa nuclease. The column was calibrated with proteins of known molecular mass (all obtained from Sigma): bovine serum albumin (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (29 kDa), and cytochrome c (12 kDa). All digestions by the 18- and 34-kDa nucleases were carried out in 20 mm Hepes, pH 8.0, 7 mm 2-mercaptoethanol, 25 mm NaCl, 10 mm MgCl2, 5 mm CaCl2 (activity buffer) at 37 °C. For the determination of the phosphodiester bond cleaved, phage λ DNA (3 μg) was partially digested with 4 units of the nucleases for 30, 60, and 120 min. The resulting DNA was purified by phenol/chloroform/iso-amyl alcohol (25:24:1) extraction and divided into two aliquots, one of which was further treated with alkaline phosphatase (AP) (1 unit for 1 h) (17Cal S. Aparicio J.F. de los Reyes-Gavilán C.G. Nicieza R.G. Sánchez J. Biochem. J. 1995; 306: 93-100Crossref PubMed Scopus (22) Google Scholar). Following AP treatment, the DNA in this aliquot was purified by phenol/chloroform/iso-amyl alcohol (25:24:1) extraction and ethanol/sodium acetate precipitation. The DNA in both aliquots was labeled using T4 polynucleotide kinase (PNK) (Roche Molecular Biochemicals) and [γ-32P]ATP (∼3000 Ci/mmol; Amersham Pharmacia Biotech) (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar), and the labeled DNA was separated from excess [γ-32P]ATP by successive ethanol precipitations. The radioactivity present in the DNA was determined using scintillation counting. To confirm that 5′-phosphates were formed, labeled fragments were produced using the 18/34-kDa nuclease/AP/PNK and further treated with nuclease P1 (2 units for 1 h) (Sigma) in 5 mmsodium acetate, pH 5.3. The products were analyzed by TLC using poly(ethyleneimine) cellulose F plates as described before (16Aparicio J.F. Freije J.M.P. Lopez-Otin C. Cal S. Sánchez J. Eur. J. Biochem. 1992; 205: 695-699Crossref PubMed Scopus (2) Google Scholar). The spots were detected by autoradiography. Endonucleolytic activity was detected by the hydrolysis of the closed circular plasmid pBR322 (0.2 μg) (MBI-Fermentas) with the 18- and 34-kDa nucleases for between 0 and 60 min. Starting materials and products were separated by 0.8% agarose gel electrophoresis and detected using ethidium bromide staining. DNA hydrolysis specificity was investigated using a double helical oligodeoxyribonucleotide, 36 bases in length, composed of ATCCAATGAGTACCTGGGGGACTTAGGAGCTTACTC and its complementary strand (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). Labeling at the 5′ terminus was carried out using 10 pmol of the substrate with PNK and [γ-32P]ATP. Hybridization of the complementary oligonucleotides was carried out as described (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar). The hydrolytic products of the nucleases were analyzed by denaturing gel electrophoresis using 20% polyacrylamide gels containing 7m urea. The bands produced were detected by autoradiography. DNA digestion by a combination of the S. antibioticusperiplasmic nuclease and the 18- or 34-kDa exocellular nucleases was investigated by first treating calf thymus DNA with the periplasmic enzyme, followed by hydrolysis with either of the two exocellular enzymes. Calf thymus DNA (4 μg) was treated with 8 units of the purified periplasmic nuclease (18Cal S. Nicieza R.G. Connolly B.A. Sanchez J. Biochemistry. 1996; 35: 10828-10836Crossref PubMed Scopus (8) Google Scholar) for 10 min. The DNA was purified by phenol/chloroform/iso-amyl alcohol (25:24:1) extraction and ethanol/sodium acetate precipitation and hydrolyzed with 4 units of the 18- or the 34-kDa nuclease in the activity buffer described above. The activity was followed by measuring the absorbance of the trichloroacetic acid-soluble products. The purified 18-kDa nuclease was tested for this activity, as described previously (25Fischer G. Wittmann-Liebold B. Lang K. Kiefhaber T. Schmid F.X. Nature. 1989; 337: 476-478Crossref PubMed Scopus (1212) Google Scholar). The substrate used wasN-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Bachem, Feinchemikalien AG) at 50 μm concentration in 1 ml of 35 mm Hepes, pH 8.0. The substrate and 18-kDa nuclease were preincubated for 15 min at room temperature before the addition of 400 μg of α-chymotrypsin (Sigma). The reaction was followed, at 390 nm, for 3 min at 12 °C. The existence of a nuclease precursor was inferred from two types of experiments. In one of them, the proteins were extruded from plates of GAE medium and concentrated by acetone precipitation, as detailed above in the activity gel analysis section. The precipitate was resuspended in buffer A (see above) and loaded in a DEAE-Sephacel column, as already specified for the purification of the nucleases. The proteins were eluted as described for the 34-kDa nuclease. The fraction corresponding to the peak of maximum activity was used for the detection of the proteolytic processing. This was visualized by the appearance of nuclease bands, after activity gel analysis, and by an increase in the nucleolytic activity, measured on λ DNA (see above). In other assays, the 74-kDa hypothetical precursor of the 18-kDa nuclease was partially purified, as specified in the above section, and subjected to the activity of the purified serine protease 2J. Huergo, R. Gonzalez, and J. Sanchez, manuscript in preparation. present in the fractions used for the detection of the proteolytic processing (as detailed under “Results”). The resulting products were analyzed by activity gel and immunoreactivity, using the antibody raised against the 18-kDa nuclease (see below). To test the effect of nuclease and protease inhibitors on aerial mycelium formation, Petri dishes of 5-cm diameter were used. ZnCl2 was added in 0.25 ml of water to the surface of previously grown plates (times detailed under “Results”).N α -p-tosyl-l-lysine ch" @default.
• W2003424893 created "2016-06-24" @default.
• W2003424893 creator A5014708687 @default.
• W2003424893 creator A5051009806 @default.
• W2003424893 creator A5059665923 @default.
• W2003424893 creator A5071353575 @default.
• W2003424893 date "1999-07-01" @default.
• W2003424893 modified "2023-10-10" @default.
• W2003424893 title "Purification, Characterization, and Role of Nucleases and Serine Proteases in Streptomyces Differentiation" @default.
• W2003424893 cites W1490406634 @default.
• W2003424893 cites W1514575046 @default.
• W2003424893 cites W1538805645 @default.
• W2003424893 cites W1550978696 @default.
• W2003424893 cites W1582577880 @default.
• W2003424893 cites W1624001120 @default.
• W2003424893 cites W1845459216 @default.
• W2003424893 cites W1857778690 @default.
• W2003424893 cites W1914739533 @default.
• W2003424893 cites W1932052686 @default.
• W2003424893 cites W1961246031 @default.
• W2003424893 cites W1964617786 @default.
• W2003424893 cites W1966556908 @default.
• W2003424893 cites W1975062891 @default.
• W2003424893 cites W1976129849 @default.
• W2003424893 cites W1979128141 @default.
• W2003424893 cites W1980037437 @default.
• W2003424893 cites W1988886218 @default.
• W2003424893 cites W1990347745 @default.
• W2003424893 cites W1996358093 @default.
• W2003424893 cites W2011079772 @default.
• W2003424893 cites W2014286993 @default.
• W2003424893 cites W2018291258 @default.
• W2003424893 cites W2021954648 @default.
• W2003424893 cites W2023024201 @default.
• W2003424893 cites W2027714304 @default.
• W2003424893 cites W2031538453 @default.
• W2003424893 cites W2032495925 @default.
• W2003424893 cites W2036272159 @default.
• W2003424893 cites W2037801832 @default.
• W2003424893 cites W2041090790 @default.
• W2003424893 cites W2044117808 @default.
• W2003424893 cites W2045850215 @default.
• W2003424893 cites W2049110705 @default.
• W2003424893 cites W2049516652 @default.
• W2003424893 cites W205138462 @default.
• W2003424893 cites W2057730808 @default.
• W2003424893 cites W2060810889 @default.
• W2003424893 cites W2064127449 @default.
• W2003424893 cites W2070470488 @default.
• W2003424893 cites W2073186504 @default.
• W2003424893 cites W2073702968 @default.
• W2003424893 cites W2078792233 @default.
• W2003424893 cites W2082771462 @default.
• W2003424893 cites W2089126878 @default.
• W2003424893 cites W2102628698 @default.
• W2003424893 cites W2104325332 @default.
• W2003424893 cites W2106410559 @default.
• W2003424893 cites W2119612992 @default.
• W2003424893 cites W2132370546 @default.
• W2003424893 cites W2141639645 @default.
• W2003424893 cites W2155285661 @default.
• W2003424893 cites W2341733344 @default.
• W2003424893 cites W2399369151 @default.
• W2003424893 doi "https://doi.org/10.1074/jbc.274.29.20366" @default.
• W2003424893 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10400660" @default.
• W2003424893 hasPublicationYear "1999" @default.
• W2003424893 type Work @default.
• W2003424893 sameAs 2003424893 @default.
• W2003424893 citedByCount "58" @default.
• W2003424893 countsByYear W20034248932012 @default.
• W2003424893 countsByYear W20034248932013 @default.
• W2003424893 countsByYear W20034248932014 @default.
• W2003424893 countsByYear W20034248932017 @default.
• W2003424893 countsByYear W20034248932019 @default.
• W2003424893 countsByYear W20034248932020 @default.
• W2003424893 crossrefType "journal-article" @default.
• W2003424893 hasAuthorship W2003424893A5014708687 @default.
• W2003424893 hasAuthorship W2003424893A5051009806 @default.
• W2003424893 hasAuthorship W2003424893A5059665923 @default.
• W2003424893 hasAuthorship W2003424893A5071353575 @default.
• W2003424893 hasBestOaLocation W20034248931 @default.
• W2003424893 hasConcept C181199279 @default.
• W2003424893 hasConcept C182220744 @default.
• W2003424893 hasConcept C185592680 @default.
• W2003424893 hasConcept C2776414213 @default.
• W2003424893 hasConcept C2779920670 @default.
• W2003424893 hasConcept C523546767 @default.
• W2003424893 hasConcept C54355233 @default.
• W2003424893 hasConcept C55493867 @default.
• W2003424893 hasConcept C86803240 @default.
• W2003424893 hasConcept C95444343 @default.
• W2003424893 hasConceptScore W2003424893C181199279 @default.
• W2003424893 hasConceptScore W2003424893C182220744 @default.
• W2003424893 hasConceptScore W2003424893C185592680 @default.
• W2003424893 hasConceptScore W2003424893C2776414213 @default.
• W2003424893 hasConceptScore W2003424893C2779920670 @default.
• W2003424893 hasConceptScore W2003424893C523546767 @default.
• W2003424893 hasConceptScore W2003424893C54355233 @default.

• next